Free Cf Research Articles

Determination of salivary concentrations of leptin and adiponectin, ability to reduce ferric ions and total antioxidant capacity of saliva in patients with severe early childhood caries.

IntroductionOne of the most common oral diseases affecting children is early childhood caries (ECC). The link between oxidative stress and ECC has been proven in numerous clinical studies. Technical and biological variability were so high in most of the studies that none of the markers have yet been proven suitable for routine clinical use. This study aimed to evaluate the antioxidant status and the levels of leptin and adiponectin in saliva of children with severe early childhood caries (S-ECC).MethodsMorning unstimulated saliva samples were collected from children (n = 40, 0–6 years old) for the evaluation of oxidative stress which were measured by total antioxidant capacity (TAC), and by the ferric reducing antioxidant power (FRAP) assays, as well as to assess the salivary levels of leptin and adiponectin. FRAP, TAC, leptin and adiponectin concentrations were evaluated in S-ECC group (n = 31) and caries free group CF (n = 9). All results were analyzed based on age and sex.ResultsOverall median salivary leptin and adiponectin levels were 5.59 pg/mL and 24.86 ng/mL, respectively. Significantly lower leptin levels were observed in saliva of caries free children (4.66 pg/mL) than in the S-ECC group (6.64 pg/mL, p < 0.01). No significant difference was observed for adiponectin levels (S-ECC and CF, 25.31 and 23.2 ng/mL, respectively, p = 0.961). TAC and FRAP values of saliva had similar values in children with S-ECC and caries free children. TAC and FRAP values also remained stable with the age of the children, without significant differences with respect to sex.ConclusionThe increased concentrations of leptin in saliva of children with S-ECC suggests that leptin may play a role in inflammatory and immune responses in the development of early childhood caries.

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Cell-free DNA analysis as a molecular tool to monitor response to immune checkpoint inhibition in endometrial cancer.

5592 Background: Immune checkpoint inhibitors (ICI) targeting PD-1 have meaningful activity in microsatellite instability high (MSI-H), hypermutated or mismatch repair deficient (dMMR) advanced endometrial cancer (EC). We investigated if high-depth circulating cell free (cf)DNA sequencing can be used to assess MSI status and monitor ICI response in EC patients enrolled in a phase II trial (NCT03241745). Methods: Patients with recurrent/persistent MSI-H/dMMR/hypermutated EC with measurable disease and ≥1 prior lines of cytotoxic therapy were treated from 06/2018-01/2022 with nivolumab until progression of disease (PD) or unacceptable toxicity. Radiologic tumor response was assessed every 12 wks by RECIST 1.1 criteria.Pre-treatment ECs and matched normal blood-derived DNA were subjected to whole-exome sequencing (WES); cfDNA from plasma at baseline, 2 wks and every 6 wks thereafter was subjected to high-depth MSK-ACCESS sequencing (129 genes). MSI in WES and cfDNA was calculated by MSIsensor and ADMIE, respectively. Results: Ten patients with ≥10 ng cfDNA at baseline and 2 weeks after nivolumab initiation were included. Most (80%) had grade 3 endometrioid EC; 70% had MLH1 hypermethylated EC. Two patients had partial response (PR), 3 had stable disease (SD) and 5 had PD on nivolumab. A high-depth sequencing assay captured somatic mutations in cfDNA at baseline in all patients (median, 29.5; range, 2-75). Median circulating tumor (ct)DNA fraction in cfDNA was 13.1% at baseline (range, 0.0-86.0%). In 8 cases, ctDNA fraction was sufficient to perform MSI assessment. Liquid biopsy MSI status matched tumor MSI status assessed by WES: in 7 patients with MSI-H disease by tumor WES, cfDNA MSI status was also MSI-H ( &gt; 0; range, 0.21-5.46); in 1 patient with MSI-low but hypermutated tumor, cfDNA MSI was 0.0. In all cases, changes in ctDNA fractions reflected ICI response. Median ctDNA fraction percent change from week 0 to week 8 was -51.6% (IQR, -6.2, -85.1) in patients with PR and SD vs +17.7% (IQR, -6.6, +356.6) in patients with PD (p = 0.08). In patients with PR, ctDNA fraction decreased at week 2 and stayed low at week 8 and weeks 32-55 of nivolumab in concordance with ongoing response. In 3 patients with SD, ctDNA fractions decreased by week 2. In 1 patient with SD at week 8 and PD at week 22, ctDNA fraction increased from week 8 to week 20. In 5 patients with PD, 4 had increased ctDNA fraction by week 8. The last patient had a stable ctDNA fraction but increasing allele frequency of 2 truncating B2M alterations, possibly associated with ICI resistance. Conclusions: In patients with advanced hypermutated ECs, cfDNA sequencing can be used to accurately detect MSI status. Early changes in ctDNA fraction may be associated with durable response to ICI or may anticipate radiological progression. Future studies may use ctDNA to assess mechanisms of ICI resistance and offer opportunities for adaptive therapy intervention. Clinical trial information: NCT03241745.

Circulating tumor DNA (ctDNA) using Guardant360 to predict response in BRAF V600 WT metastatic melanoma (MM) patients (pts) receiving immune checkpoint inhibitors (ICI).

10050 Background: ctDNA detected by ddPCR predicts ICI response in MM, although its utility is limited to pts with known recurring mutations eg. BRAF, NRAS, KIT. We sought to overcome this limitation by using a next generation sequencing approach in BRAF V600 wild type (WT) MM pts. Methods: Plasma was collected at baseline and Week (wk) 6 in 35 BRAF V600 WT MM pts treated with ICI. Cell free (cf)DNA was analyzed using Guardant360 and only somatic non-synonymous and promoter variants were considered. Pts who failed cfDNA extraction at baseline were excluded (n = 3). Favorable ctDNA was defined as undetectable ctDNA at wk 6 and unfavorable ctDNA defined as detectable ctDNA at wk6. Response was according to RECIST at first restaging. Results: Of the evaluable 32 pts (64 plasma samples), median baseline cfDNA quantity was 33ng (range 4-657ng) and ctDNA was detected in 29/32 pts (91%). All 3 pts with undetectable baseline ctDNA had less than 10ng cfDNA compared to only 1/29 pts with detectable baseline ctDNA. Number of mutations identified in the 29 ctDNA-positive pts was 4 per pt (range 1-22). Response assessment was performed on 30 evaluable pts. Candidate driver mutation(s) in BRAF, NF1, or N/K/HRAS were identified in 26/30 pts. These mutations were often detected with other established mutations involved in tumorigenesis (eg. TERT promoter), or passenger mutations (eg. clonal hematopoiesis). Analysis of driver mutations revealed a sensitivity and specificity in predicting treatment failure of 92% and 93%, respectively (table). When all mutations identified were evaluated for treatment response, 9/18 responding pts retained some ctDNA at wk 6, although this never included TERT variants. The resulting sensitivity and specificity in predicting treatment failure changed to 100% and 50%, respectively, when all cfDNA variants were included. Conclusions: The extensive coverage of Guardant360 improves ctDNA detection in BRAF V600 WT MM pts, allowing non-invasive, rapid, and longitudinal assessment of response in a broader population. The expanded coverage also identifies passenger variants of potential non-MM origin, eg. clonal hematopoiesis, and with significant overlap with ctDNA, it is not possible to distinguish between the two in the circulation. We therefore recommend identification and monitoring of known cancer driver mutations only. [Table: see text]

Abstract 5581: Clinical validation of a highly sensitive assay to detect mutations in plasma from advanced lung adenocarcinoma patients

Abstract The use of different liquid biopsy tools including circulating tumor DNA (ctDNA) and circulating tumor cells (CTCs) have shown great promise for the use in personalized cancer diagnostics, treatment monitoring, and research, especially among metastatic patients. The power of ctDNA analyses in early detection of acquired resistance against e.g. EGFR-targeted therapies in non-small cell lung cancer (NSCLC) have been demonstrated in several studies. However, NSCLC patients display lower ctDNA and CTC concentrations than expected and in particular brain metastases pose a challenge, probably due to the blood-brain barrier. In this study, we used a novel highly sensitive assay to detect clinically relevant mutations in ctDNA and detected CTCs in blood from metastatic NSCLC patients. 56 metastatic NSCLC cases were enrolled in this study. 37 patients presented with brain metastases and 20 of them had brain as the only site of metastasis (oligo-metastatic disease). Cell free (cf)DNA was isolated from 1.5-2ml of plasma using the Circulating Nucleic Acid kit (Qiagen). The ctDNA quantity was measured by Qubit Fluorometer (Thermo Fisher) and the quality was assessed by Tapestation (Agilent technologies). The UltraSEEK™ Lung Panel on the MassARRAY® System (Agena Bioscience) was used for the detection of mutations in five genes EGFR, KRAS, BRAF, ERBB2 and PIK3CA covering 67 different hot spot mutation loci. CTCs were detected by the CellSearch system. The total cfDNA concentration yields were low in most cases (median; 21ng/30µl, mean; 39ng/30µl, ± SD 2.6 ng/µl isolated from 1.5-2ml of plasma). Mutations could be detected in 26 samples (46.4%), with the variant allele frequency ranging between 0.1% and 5%. EGFR mutations were detected in 23.2% (13/56), KRAS in 21.4%, ERBB2 in 7.1%, PIK3CA in 3.6% and BRAF in 1.8% of the samples. Mutations were detected in 57.9% of patients with peripheral (non-brain) metastases, whereas 40.5% of brain metastatic patients had mutations detected in blood. Among oligo-metastatic patients, 30.5% had detectable mutations in plasma. In 42 samples, the EGFR mutation status in the primary tumor tissue was also determined. In 90.5% of samples, concordant results between plasma and tissue were found. In two patients, an EGFR mutation was only detected in the plasma, whereas in two other samples the mutation was only detected in the tumor tissue. In 46 patients, CTCs were measured. In 11 patients (23.9%), ≥ 1 CTC was detected. In 64.7% of patients, an informative result was obtained when results from both liquid biopsy approaches were combined. The UltraSEEK technology was able to detect mutations in cfDNA in plasma from NSCLC patients with limited, oligo-metastatic tumor burden, low amounts of total cfDNA, and very low fractions of ctDNA. Parallel assessment of CTCs in patients without detectable ctDNA enlarged the population of patients amenable to successful liquid biopsy analysis. Citation Format: Harriet Wikman, Malte Mohme, Melanie Janning, Alexander Sartori, Katrin Lamszus, Sabine Riethdorf, Darryl Irwin, Manfred Westphal, Sonja Loges, Klaus Pantel. Clinical validation of a highly sensitive assay to detect mutations in plasma from advanced lung adenocarcinoma patients [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 5581.

Abstract 641: Cell free DNA in the supernatant of pleural effusion can detect driver and resistance mutations and can guide TKI treatment decisions

Abstract Introduction: Molecular profiling of tumors has become the mainstay of diagnostics for metastasized solid malignancies and guides personalized treatment, especially in non-small cell lung cancer (NSCLC). In current practice it is often challenging to obtain sufficient tumor material for reliable molecular analysis. Cell free (cf) DNA in blood or other bio-sources could present an alternative approach to obtain genetic information from the tumor. In a retrospective cohort we analyzed the added value of cfDNA analysis in pleural effusions for molecular profiling. Methods: We retrospectively analyzed both the supernatant and the cell pellet of 44 pleural effusions sampled from 39 patients with KRAS (23) or EGFR (16) positive tumors for the original driver gene mutation as well as for EGFR T790M resistance mutations. Patients were diagnosed with either NSCLC (32), colon carcinoma (4), appendiceal carcinoma (2) or adenocarcinoma of unknown primary (1). Samples collected in the context of routine clinical care were stored in the NKI-AVL biobank. We used Bio-Rad QX200 droplet digital PCR for analysis. Results: The original driver gene mutation could be detected in 37 of the 44 pleural effusions by analysis of both supernatant (35/44 positive) and cell pellet (29/44 positive). In 7 out of 20 pleural effusions from patients with EGFR mutation positive tumors, a T790M mutation was detected. All 7 supernatants were positive as were 5 of the 7 cell pellets. The EGFR T790M mutation was confirmed in all supernatants (4/4) and in 3 of the 4 cell pellets sampled from patients with T790M positive tumors (4). Conclusions: Cell free DNA in pleural effusion proved to be a valuable bio-source and can be used to detect driver gene mutations as well as resistance mechanisms like EGFR T790M in pleural effusion. Citation Format: Karlijn Hummelink, Mirte Muller, Dorothe Linders, Vincent van der Noort, Petra Nederlof, Sjaak Burgers, Gerrit Meijer, Michel van den Heuvel, Daan van den Broek, Kim Monkhorst. Cell free DNA in the supernatant of pleural effusion can detect driver and resistance mutations and can guide TKI treatment decisions [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 641.

Cell free (cf) DNA as a tumor marker in transitional cell cancer (TCC): Monitoring response to checkpoint inhibitor (CPI) therapy.

e16522Background: CPI induces long term response in ~25% of patients (pts). Assessment of response is challenging given the nuances of radiographic findings. cfDNA (Guardant 360) appears to correla...

Cell free (cf)DNA as a tumor marker in transitional cell carcinoma (TCC).

e16514Background: Assessment of tumor response is challenging given the nuances of radiographic findings, especially in bone. cfDNA appears to correlate with tumor burden (GUASCO 2018) and thus has...

What would be missed in the first trimester if nuchal translucency measurement is replaced by cell free DNA foetal aneuploidy screening?

The aim of this study was to evaluate which chromosomal abnormalities in our cohort of foetuses with increased nuchal translucency (NT) in the first trimester of pregnancy could be detected by cell free (cf)DNA screening as well. There were 775 singleton pregnancies referred for cytogenetic testing due to an increased NT (≥3.0 mm). Chromosome aberrations were investigated using karyotyping or chromosomal microarray analysis (CMA). Karyotyping had been chosen for foetal cytogenetic testing by 446 patients, and CMA by 329 patients. Common aneuploidies (trisomies 21, 18, 13 and sex aneuploidies) were detected in 2.2% (99/446) and 1.8% (59/329) cases, respectively. In 329 with CMA testing, clinically significant copy number variations (CNVs) other than common aneuploidies were detected in 2.7% cases; among these, five had a pathogenic microscopic CNV, which could have been detected by karyotyping. There were four cases (1.2%) having a pathogenic submicroscopic CNV, which could have been missed by karyotyping. The total CMA detection rate (23.4%) was not statistically different from that (24.2%) by karyotyping (p > .05). The percentage of chromosomal aberrations, which cfDNA screening would miss in patients with increased NT in the first trimester, might be the same as in those with normal NT.Impact statementWhat is already known about this topic? First trimester NT is a powerful marker for screening for common aneuploidies. cfDNA screening is more accurate than any standard screening with NT. The need of NT in the era of prenatal screening using cfDNA is debated.What does this study add? An increased NT did not identify any additional aneuploidies that were detected by cfDNA screening.What are the implications of these findings for clinical practice and/or further research? The percentage of chromosomal aberrations which cfDNA screening would miss in patients with increased NT might be the same as in those with normal NT.

Personalized antibodies for gastroesophageal adenocarcinoma (PANGEA): A phase II precision medicine trial (NCT02213289).

TPS198 Background: Targeted therapies (tx) in GEA have had limited efficacy despite recognition of numerous ‘targetable’ molecular events. This may be due to the molecular heterogeneity (MH) that exists between patients (pts), within the primary tumor (PT), between PT and synchronous metastatic lesions (MLs), and in lesions over time. Current biomarker profiling (BP) is performed on one site, usually the PT, yet this fails to capture the MH of GEA, with likely major clinical implications. Classic trial designs are challenged by MH, low frequency oncogenic drivers, and scarcity of tissue. There is need for novel trial designs and BP technologies that address these concerns, provide tx algorithms for pts with multiple aberrations, and have access to several txs. Methods: This phase IIa, open-label, non-randomized ‘platform trial’ enrolls pts with newly diagnosed metastatic GEA or recurrent disease after curative-intent surgery. Baseline tumor BP is performed on PT/ML along with circulating free (cf)DNA. Pts receive first line (1L) mFOLFOX6 + biologic tx based on BP of the ML using a prioritized tx algorithm (HER2+: trastuzumab; MET+: none; FGFR2+: none; EGFR+: ABT806; MSI-H: nivolumab; ‘RAS-like’: ramucirumab). MET/FGFR2 arms (~10% of all pts) are tx’d with cytotoxics only and followed for natural outcome until/if tx becomes available on study. At first progression (PD1), pts undergo biopsy of growing ML and change to 2L FOLFIRI + biologic agent as assigned in 1L tx. Upon results of PD1 biopsy, pts change to a new biologic tx if the molecular category evolves. At PD2, pts change to 3L FOLTAX + biologic as determined after PD1, and switch biologic tx from PD2 biopsy result. All PD1/PD2 tumor/cfDNA samples undergo BP to assess evolution and resistance mechanisms. Co-primary endpoints: safety, feasibility, and overall survival (OS) of this personalized treatment strategy (excluding MET/FGFR2) compared to historical controls (HR 0.66). Secondary endpoints include rate of baseline MH between PT and ML leading to new treatment assignment; utility of cfDNA; overall progression-free survival (PFS)/response rate (RR); OS/PFS/RR in each targetable group. Since 8/2015, 38 of 68 planned pts have been accrued. Clinical trial information: NCT02213289.

Abstract LB-039: Translational research in a phase I proof-of-concept study supports that DCC-2618 is a pan-KIT inhibitor

Abstract Background: DCC-2618 is a potent switch control inhibitor of KIT and PDGFRα kinases maintains potent inhibition of mutant forms across all exon regions in preclinical models. Gastrointestinal stromal tumor (GIST) is an important disease to achieve a proof-of-concept due to the heterogeneity of resistance mutations in KIT which emerge on treatment with approved KIT inhibitors. In later lines of therapy resistance mechanisms independent of the KIT gene have also been described. Methods: The ongoing phase 1, PK-guided dose escalation study of DCC-2618 given orally BID [28-day cycle] tested doses from 20 mg to 200 mg in patients (pts) with advanced solid tumors including GIST (NCT02571036). We report preliminary longitudinal results of plasma cell free (cf) DNA sequencing by Guardant 360 collected throughout the study and levels of circulating tumor cells (CTCs) based on a viral telomerase promoter-driven GFP expression assay. Results: To date, 24 out of 31 enrolled pts had metastatic KITm GIST refractory to standard therapy. A high, total mean exposure of DCC-2618 and its active metabolite was achieved at 100 and 150 mg BID, affording steady state Cmax &amp;gt;5 µM in Cycle 1. Starting with 50 mg BID dose level, concentrations of total drug exceeding IC90 of the most resistant mutations to DCC-2618 were achieved. Next-generation sequencing of plasma cfDNA revealed a total of 40 KIT mutations in 16 of 18 GIST pts at baseline. DCC-2618 led to rapid decrease and/or clearance of the heterogeneous array of KIT mutations from plasma cfDNA including exons 9, 11, 13, 14, 17, and 18. Independent of suppressed KIT mutation burden, longitudinal monitoring of cfDNA revealed changes in non-KIT oncogenic mutations which may contribute to heterogenous mechanisms of resistance. KIT mutation burden will be correlated with metabolic response assessment by PET scans and exposure to DCC-2618. CTCs have been detected in blood from all GIST patients at baseline using a non-biased assay capable of identifying sarcoma cells. Preliminary result show that CTCs with immunofluorescent detection of KIT or PDGFRα, corresponding to their respective mutational status, show 1 of 3 patterns when compared to radiologic response: most pts show relatively stable low levels at stable disease (SD), a minority of pts with prolonged SD a decline in CTCs and 2 pts with progressive disease had significant increase in KIT positive CTCs. Conclusions: DCC-2618 and its active metabolite achieved high plasma concentrations sufficient to inhibit the most resistant KIT mutations at well-tolerated exposures. Monitoring of cfDNA KIT mutation frequency demonstrates rapid clearance of a broad spectrum of KIT mutations in this heavily pretreated GIST patient population and suggests candidate resistance genes that are independent of KIT. Our data provide a first signal that CTC monitoring might represent a potential marker for tumor control in KIT mutant GIST. Citation Format: Filip Janku, Albi Razak, Michael Gordon, David Brooks, Daniel Flynn, Anu Gupta, Michael Kaufman, Cynthia Leary, Bryan Smith, Deb Westwood, Neeta Somaiah, Elena Helman, Eric Gerstenberger, Oliver Rosen, Suzanne George. Translational research in a phase I proof-of-concept study supports that DCC-2618 is a pan-KIT inhibitor [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr LB-039. doi:10.1158/1538-7445.AM2017-LB-039

Abstract 4950: The emergence of ESR1 mutations is associated with aromatase inhibitor and fulvestrant therapy

Abstract Introduction: In recent studies, constitutively active recurrent ESR1 ligand binding mutations (LBD) were found in about 20% of metastatic (met) HR+ breast cancers ( BRCAs) and rarely in primary HR+ cancers. In our previous work, we analyzed clinical tissue samples and detected an association between the number of prior endocrine treatments and the prevalence of these mutations, suggesting the emergence of the ESR1 mutations under the selective pressure of endocrine treatment. More recently, the LBD ESR1 mutations were successfully detected in plasma cell free (cf)DNA in patients with met HR+ disease. The presence of mutant ESR1 cfDNA was found to be prognostic. Here we sought to study the association between endocrine treatments in the adjuvant (adj) and met settings and the prevalence of cfDNA ESR1 and PIK3CA mutations in patients with met HR+ BRCA. Methods: Plasma samples and detailed clinical data were collected from patients with met BRCA through the Collection of Specimens and Clinical Data program of the Breast Oncology Center at the Dana Farber Cancer Institute. Droplet Digital PCR was used for the detection of the most common ESR1 LBD mutations (E380Q, Y537C, Y537N, Y537S and D538G) and the 3 most common PIK3CA mutations (E542K, E545K and H1047R) in cfDNA. Fisher’s Exact Test was used for statistical analysis. Results: Plasma samples were collected from 155 patients with met BRCA. ESR1 mutations were found in 30.1% of the patients with HR+/HER2- negative disease (34/113). PIK3CA mutations were detected in 31.8% of patients with HR+/HER2- disease. The majority of the patients had either newly diagnosed met disease or progressive met disease at the time of the blood draw. 14 patients had stable met disease and among these patients, only 1 of these patients was found to have an ESR1 mutation and no PIK3CA mutations were detected. The majority of patients with ESR1 mutations (88%) and PIK3CA mutations (75%) had progressive disease. Patients that received an aromatase inhibitor (AI) either in the adj or met setting had a higher prevalence of ESR1 mutations compared to patients that had no AI treatment, regardless of whether or not they received tamoxifen (TAM) (prevalence was 32% for adj AI only, 40.4% AI in met only, No AI and no TAM 7.1% and TAM but no AI 6.7%). In addition fulvestrant treatment in the met setting was significantly associated with ESR1 mutations (odds ratio 3.38, p-value&amp;lt;0.01). Conversely, we did not detect any significant associations between endocrine treatments in the adj or met settings and PIK3CA mutations. Conclusions: Analysis of cfDNA can successfully detect ESR1 and PIK3CA mutations in newly diagnosed or progressive met BRCA patients and the emergence of the ESR1 mutations is associated with AI and fulvestrant treatment. These results support the serial monitoring of ESR1 mutations in cfDNA in met disease and highlight the need to study new agents to target these mutations. Citation Format: Yanan Kuang, Bilal Siddiqui, Jiani Hu, William T. Barry, Nancy U. Lin, Nikhil Wagle, Paul Kirschmeier, Pasi A. Jänne, Cloud Paweletz, Ian Krop, Eric P. Winer, Myles Brown, Rinath Jeselsohn. The emergence of ESR1 mutations is associated with aromatase inhibitor and fulvestrant therapy [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 4950. doi:10.1158/1538-7445.AM2017-4950

Evaluation of tumor and circulating cell free (cf) DNA mutations in women with hormone refractory metastatic breast cancer (MBC) enrolled in a phase I study of Z-endoxifen (MC093C).

1043 Background: In estrogen receptor (ER) positive MBC, mutations (e.g. ESR1), identified from tumor biopsies or cfDNA, confer resistance. The concordance between mutations observed in tumor and cfDNA and the implications for response to Z-endoxifen, a potent anti-estrogen, are unknown. Methods: We previously conducted a phase I trial of Z-endoxifen in endocrine refractory, ER positive MBC. Seven dose levels were considered ranging from 20 to 160 mg/day followed by expansion cohorts (EC) of 40, 80, and 100 mg/day. Pretreatment blood samples (all pts) and fresh tumor biopsies (EC) were collected prospectively. Tumor and cfDNA were evaluated by targeted NGS. Results: 41 pts (38 evaluable) were enrolled. Prior endocrine therapy included aromatase inhibitors (37/38, 97%), fulvestrant (22/38, 58%) and tamoxifen (26/38, 68%). Substantial endoxifen exposure without DLTs at doses above 80 mg/day led to a halt in dose escalation and opening of the EC. Overall clinical benefit (stable &gt; 6 months [7 pts.] or partial response by RECIST criteria [3 pts.]) rate was 26.3% (95%CI: 13.4-43.1%). cfDNA was obtained from 36 pts and mutations were identified in 13 (36%) including ESR1 [ Y537N or D538G] (5), PIK3CA [ H1047R or E542K] (8), TP53 [ K132R, R248Q, R267Q, or H179Y] (4), AKT ( Q79K) (1), and KRAS ( G12D) (1). In 5 pts with cf ESR1 mutations, 4 had additional cfDNA mutations including PIK3CA (3), and TP53 (1). PFS was shorter in pts with cfDNA mutations relative to those without (median: 61 vs.132 days; log-rank p = 0.021). Discordance was observed between tumor and cfDNA mutations where 3/7 PIK3CA tumor mutations were detected by cfDNA, 1/2 TP53 tumor mutations were detected by cfDNA, and 0/1 AKT tumor mutations were detected by cfDNA. Conversely, 2 pts had cfDNA mutations (either ESR1, TP53 or AKT) undetected in tumor. Conclusions: The absence of cfDNA mutations in patients with endocrine resistant, MBC treated with Z-Endoxifen was associated with significantly longer PFS. Given the discordance between tumor and cfDNA sequence data, future studies must determine which approach maximizes prognosis and prediction of benefit for estrogen-targeted therapy. Clinical trial information: NCT01327781.

The Angiosarcoma Project: Generating the genomic landscape of a rare cancer through a direct-to-patient initiative.

1519 Background: Angiosarcoma (AS) is a rare soft tissue sarcoma, with an incidence of 300/yr and a 5-year DSS of 30%. The low incidence has impeded large-scale research efforts that may lead to improved clinical outcomes. To address this, we launched a nationwide study, which seeks to empower patients (pts) to accelerate research by sharing their samples and clinical information remotely. Methods: With pts and advocacy groups we developed a website to allow AS pts to participate across the US. Pts are mailed a saliva and blood draw kit for germline and cell free (cf) DNA analysis. We then obtain medical records and stored tumor samples. Whole exome sequencing will be performed on tumor, cfDNA and saliva samples. Transcriptome analysis will be performed on tumor samples. A clinically annotated genomic database will be generated and shared widely to identify genomic drivers and mechanisms of response and resistance to therapies. Study updates will be shared with pts regularly. Results: We conducted a 3-week pilot study to test the feasibility of enrolling geographically dispersed AS pts through a direct-to-patient (DTP) approach. Through social media, we identified 100+ pts willing to participate, 90 within the first day of outreach. We enrolled 15 pts from 10 states to test our ability to remotely obtain pt reported data, online consent, and samples. The average age of pts is 48, ranging 23-71 yrs. Primary locations of AS are breast 6 pts (40%), cardiac 4 pts (27%), scalp 2 pts (13%), liver 1 pt (6%), bladder 1 pt (6%), forehead 1 pt (6%). 9 pts (60%) reported being disease free, 4 pts (27%) reported having AS spread to lung, lymph, bone, and hip. Requests for medical records and tissue samples are underway, and initial saliva samples have been received. We are now opening this study to all AS pts in the USA. Conclusions: A DTP approach enabled rapid identification of an initial cohort of AS pts willing to share tumors, saliva, blood and medical records. We were able to obtain detailed clinical experiences and samples to perform genomic analysis. This study serves as proof of principle that DTP genomics efforts can democratize cancer research for exceedingly rare cancers, which to date have been disproportionately understudied.

Abstract OT2-01-20: Phase IIB study of neoadjuvant panitumumab combined with carboplatin and paclitaxel (PaCT) for anthracycline-resistant triple-negative breast cancer (TNBC)

Abstract BACKGROUND: Approximately 50% of patients with TNBC treatedwithstandardtaxane/anthracycline-based neoadjuvant chemotherapy (NACT)have chemo-insensitive disease (CID), i.e., residual disease burden (RCB)-II/III at the time of surgery, and 40-80% of patients develop recurrence within 3 years. Recent developments in molecular profiling have identified subsets of TNBC with distinct, targetable molecular features. We developed a clinical trial to identify and characterize CID (ARTEMIS: A Randomized, TNBC-Enrolling trial to confirm Molecular profiling Improves Survival). In ARTEMIS, patients with localized TNBC will undergo a pretreatment biopsy, then begin anthracycline-based NACT. During NACT, we use molecular profiling and response assessment to identify CID and allocate patients to alternative therapies to overcome CID. Epidermal growth factor receptor (EGFR) is overexpressed in 25-30% of TNBC. In preclinical studies, suppression of EGFR signaling has shown efficacy in controlling cancers through suppression of the stem cell population, enhanced apoptosis via MAPK/PI3K signaling, and modulation of epithelial-mesenchymal transition (EMT). Moreover, in a phase II trial of triple negative inflammatory breast cancer, neoadjuvant PaCT yielded significantly higher pathologic complete response (pCR) rates than historic control. Taken together, we hypothesize that using PaCT to suppress EGFR in TNBC will enhance the pCR rate. OBJECTIVES: Primary objective: determine pCR and RCB-0/I rates in TNBC patients with CID given PaCT. Secondary objective: determine the benefit of using baseline genomic signatures to develop an alternative second phase of NACT. TRIAL DESIGN AND STATISTICAL METHODS: Patients with &amp;gt;10% volume reduction for non-CID or &amp;lt;80% for CID will enroll in a biomarker-guided, experimental, nonrandomized phase II study and be given PaCT (panitumumab 2.5 mg/kg, carboplatin AUC 5, paclitaxel 80 mg/m2). Because pCR rates in pts with CID with additional cycles of taxane-based therapy are low (∼5%), a 20% response rate (RCB-0 or RCB-I) will be considered clinically meaningful. A two-stage Gehan-type design will be employed. If at least 1 of 14 patients responds, 23 more patients will be added, for a total of 37 patients. This design has a 49% chance of terminating after the first stage if the true response rate is 0.05, 23% if the rate is 0.10, 10% if the rate is 0.15, and 4% if the rate is 0.20. If accrual continues to the second stage and 37 patients are enrolled, the 95% confidence interval for a 0.20 response rate will be 0.10 to 0.35. BRIEF ELIGIBILITY CRITERIA: Inclusion: localized TNBC; enrolled in ARTEMIS trial; adequate organ, bone marrow, and cardiac parameters; Exclusion: pregnant or lactating, known or suspected metastasis. CORRELATIVE SCIENCE: Circulating tumor cells (CTCs) and cell free (cf) DNA in baseline and subsequent blood samples, EGFR expression (immunohistochemistry), stem cell/EMT/apoptosis marker changes in tissue and CTCs, PD-L1 glycosylation for EGFR sensitivity. Citation Format: Lim B, Helgason T, Hess KR, Piwnica-Worms H, Yang W, Adrada BE, Rauch GM, Gilcrease M, Symmans FW, Huo L, Mittendorf EA, Thompson A, Stacy M-TL, Debu T, Ueno NT. Phase IIB study of neoadjuvant panitumumab combined with carboplatin and paclitaxel (PaCT) for anthracycline-resistant triple-negative breast cancer (TNBC) [abstract]. In: Proceedings of the 2016 San Antonio Breast Cancer Symposium; 2016 Dec 6-10; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2017;77(4 Suppl):Abstract nr OT2-01-20.

Sequencing cell free DNA in patients receiving selective internal radiation therapy for colorectal liver metastases.

646 Background: Tumour heterogeneity is a key determinants of cancer resistance. Serial sampling of cell free (cf)DNA may detect evolving somatic mutations. Monitoring cancers after therapies e.g. selective internal radiation therapy (SIRT) require new biomarkers as RECIST imaging was developed to assess response to chemotherapy and may not reflect tumour changes due to new therapeutic strategies. The utility of cfDNA to detect recurrence and predict response is emerging. The objective of this study was to sequence serial cfDNA samples from patients with liver predominant metastatic disease receiving SIRT, and explore the feasibility of using this method to detect evolution of somatic mutations after high dose radiation. Methods: A prospective imaging biomarker study was performed in patients with colorectal liver metastases (CRLM) receiving SIRT. Plasma was extracted and frozen within 4 hours at 3 time points: baseline, 4 and 10 weeks after SIRT. Ion Torrent Amplicon sequencing was performed using cancer hotspot panel v.2. Sequencing of primary tumours was obtained by pyrosequencing. Results: Twenty-four patients with CRLM were recruited from March – Dec 2015, and 18 had cfDNA extracted for sequencing at a minimum of two time points. Ion Torrent amplicon sequencing of baseline cfDNA showed high concordance with formalin-fixed paraffin-embedded (FFPE) tumour samples. Serial cfDNA sequencing in a patient with partial response by imaging, detected 22% KRAS G12C mutation at baseline, which decreased to 1.5% by 4 weeks, then was undetectable 10 weeks after SIRT. Sequencing of another patient’s cfDNA revealed persistence of KRAS G13D and a truncating APCmutation at both 4 and 10 weeks after SIRT, consistent with the patient’s progressive disease. Conclusions: Cell-free DNA is emerging as a biomarker in colorectal cancer. Our measurements of mutational status in baseline cfDNA and FFPE samples show high concordance. This study reports that serial cfDNA sequencing detects changes in mutational status and specific mutations following high dose radiation to the liver. This adds to the evidence of cfDNA as a tool to detect evolution of somatic mutations following therapy.

Detection and Monitoring of BRAF and NRAS Mutant Clones in Myeloma Patients By Digital PCR of Circulating DNA

Abstract Introduction Targeted mutation specific therapy is a promising approach in cancer therapy. However, an obstacle for this approach is the vast heterogeneity of the clonal composition and development. Tumor biopsies represent only a snapshot of the situation. Furthermore, monitoring of the clonal development is difficult because biopsies may not be representative for the whole tumor and availability of repeat biopsies is limited. To meet these difficulties we have established and optimized a method based on Digital PCR (dPCR) for analyses of circulating cell free (cf)DNA from sequential samples of serum and plasma from patients with multiple myeloma. Methods We investigated 19 patients for the BRAF V600E mutation. Nine were previously confirmed as mutation positive in bone marrow biopsies/purfied plasma cells by two independent methods (PCR/immunohistochemistry/whole exome sequencing) whereas 10 were mutation negative (Rustad et al Blood Cancer J 2015). Two patients with NRAS Q61K mutation detected in serial bone marrow samples were also included. In total, 67 serum and 21 EDTA-plasma samples were analyzed. Blood samples were taken, processed and frozen at -800 C within 1,5 hour. The samples were stored for a median of 5 years (range 0-23) before DNA isolation and analysis. Mutation detection by dPCR was performed using a droplet-based system and validated primer/probe-sets (BioRad). In-house validation and optimization of the assay was carried out using cancer cell lines OH2 and HT29 with NRAS Q61 and BRAF V600E mutations respectively. The limit of detection was 1-3 copies of mutated DNA per reaction and no false positives were detected. The threshold of positivity was set to 1 droplet per sample. Experiments were performed in accordance with the Minimum Information for Publication of Digital PCR Experiments (dMIQE) guidelines (Huggett et al Clin Chem 2013). Results BRAF or NRAS mutated cfDNA was detected in all patients with a confirmed mutation in tumor tissue, and in none of the mutation-negative controls (p = 0.000003, Fisher's exact test). When looking only at tumor tissue and blood samples obtained at the same time, mutation positivity was confirmed in the blood of 9/10 patients (p = 0.00012). Furthermore, there was a positive correlation between the percentage of mutated plasma cells in bone marrow biopsies and the concentration of mutated cfDNA (Spearman correlation R = 0.63, p = 0.025). Serial samples were analyzed from 5 patients and provided information about 3 different aspects: 1. Patients 1 (figure), 2 and 3, had large clones (50-100 %) of BRAF or NRAS mutated cells in diagnostic and relapse bone marrow samples. Mutated cfDNA correlated closely to M-protein levels in these patients as demonstrated in the figure. A corollary of the figure is that the BRAF mutated clone produces M protein and is sensitive to MP. 2. Patient 4 developed a pelvic extra medullary plasmacytoma with 75-100% BRAF mutation positive cells (immunohistochemistry), however, time-matched serum samples showed only a modest peak with 23 mutated copies/ml. 3. Patient 5 had a moderately sized BRAF V600E mutated clone of 50-75 % at diagnosis, which, according to serum levels, persisted through the disease course. However, two months prior to death, the patient rapidly deteriorated and became refractory to treatment. BM aspirate showed 95 % plasma cells with plasmablastic morphology. A serum sample contained &gt; 600 ng/ml of cfDNA, 10-100 fold more than any other sample in our study, and was highly positive for BRAF V600E mutation (59 000 copies/ml). The patient clearly had expansion of an aggressive BRAF mutated clone that could easily be detected by serum analysis. Conclusions This study demonstrates that mutations such as BRAF V600E and NRAS Q61K can be reliably detected and monitored in sequential serum or plasma samples from myeloma patients. Quantitative mutation analysis compared to M protein in sequential samples provided significant information with clinical relevance. The great advantage of this approach is the easy access to blood samples compared to bone marrow aspirate/biopsy. This will facilitate studies of clonal development during treatment and detection of druggable mutations. Figure 1. Co-variation of M-protein and circulating BRAF V600E mutated DNA in patient 1. Figure 1. Co-variation of M-protein and circulating BRAF V600E mutated DNA in patient 1. Disclosures Waage: Celgene: Research Funding; Amgen: Research Funding; Janssen: Research Funding.

Abstract 3973: Comparison of different highly sensitive miRNA array platforms for the investigation of circulating cell-free microRNAs in blood

Abstract Introduction: Circulating free (cf) microRNAs hold great promises in early detection and prognosis of human diseases such as cancer. However due to the very low amount of cf miRNA in plasma and serum, highly informative miRNAs are lost. Thus, there is an urgent need for highly efficient, sensitive, cost efficient technologies to measure low abundant miRNA in a quantitative manner. Previously, we have successfully measured and validated miRNA profiles of early onset breast cancer cases, healthy controls and breast cancer patients who had developed breast cancer metastasis during follow-up by applying TaqMan Low density arrays. We established and validated miRNA signatures for the early detection of early stage breast cancer, and prognosis and early detection of breast cancer metastasis. However more sensitive microarray platforms with highly dynamic ranges could even improve identified diagnostic signatures especially in respect of early detection of diseases and relapse. Here, we compared the sensitivity of the previously applied array platform TaqMan Low density array (TLDA) with Toray innovative 3D-Gene microarray technology by measuring plasma cf miRNA profiles of 40 individuals (10 healthy controls, 10 early stage breast cancer, 20 metastatic breast cancer patients). Experimental Procedures: Plasma samples were processed within 2 h after blood collection. EDTA blood was centrifuged for 15 min at 1200 g and the supernatant centrifuged again at 12.000 g for 10 min in order to remove any cell debris. Cf RNA was isolated from plasma. Cf miRNA profiles of plasma samples of 40 individuals (10 healthy controls, 10 early stage breast cancer, 20 metastatic breast cancer patients) were investigated A: via TaqMan low density arrays (TLDA) and B: via 3D-Gene microarray technology. Expression profiles between both array types and between cases, early stage breast cancer and metastatic breast cancer patients were compared. In addition selected miRNAs were measured with single TaqMan assays. These results were compared with the array based results. Conclusion: The result will be of importance for all scientists who intend to develop and improve diagnostic miRNA panels. Based on our results recommendations for a microarray platform for the investigation of cf miRNA will be given. Citation Format: Melanie Maierthaler, Eric Mennesson, Katarina Cuk, Dharanija Madhavan, Manuela Zucknick, Isabelle Fixe, Alexandra Foucher, Markus Wallwiener, Andreas Schneeweiss, Nadia Normand, Barbara Burwinkel. Comparison of different highly sensitive miRNA array platforms for the investigation of circulating cell-free microRNAs in blood. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 3973. doi:10.1158/1538-7445.AM2015-3973

277 Transformational care at the All Wales Adult CF Centre (AWACFC) – is ivacaftor making us fat? The impact of ivacaftor (Kalydeco®) on body composition

Background A previous study (Ramsey 2011) has shown an improvement BMI and quality of life respiratory domain for patients on ivacaftor. Some local female patients were concerned with the weight they were gaining on ivacaftor. Gender differences previously reported suggest some female patients are more satisfied with their ‘thinness' than male patients (Quittner 2002). We aimed to retrospectively review body composition, handgrip strength and quality of life in patients at baseline and after a year of ivacaftor. Method The following data was collected from the 11 patients attending the AWACFC at initiation of and one year after starting ivacaftor: BMI, body Fat percentage, Fat Free mass (FFM) FFM index (FFMI), handgrip and CF quality of life scores (CFQ). Results All 11 patients (3 male) are delF508/G551D with a mean (SD) age of 28 (13) years. PrePostChangepBMI (kg/m 2 )20.9 (2.9)22.6 (3.1)1.70.009Fat percentage22.6 (8.7)25.0 (9.3)2.40.05FFM (kg)44.1 (13.1)47.8 (14.8)3.70.04FFMI (kg/m 2 )15.9 (2.8)16.6 (3.1)0.70.007Handgrip25.7 (10.9)29.7 (12.1)4.00.12QOL respiratory63.1 (26.7)89.4 (11.0)26.30.004QOL body image75.8 (39.1)84.8 (19.4)9.00.42QOL eating82.8 (27.4)98.0 (4.5)15.20.10QOL weight72.7 (41.7)87.9 (22.5)15.20.27 Conclusion There was a significant (deemed >4 point) improvement in all domains of the CFQ with only body image, eating and weight domains not reaching statistical significance. This may be due to small numbers. Reassuringly, although there is a gain in fat percentage much of the weight gained is actually due to a significant gain in FFM reflecting improved muscle mass which is also reflected in a trend of improved handgrip strength.

Adsorption of NO on ordered mesoporous carbon and its improvement by cerium

Ordered mesoporous carbon (OMC) was synthesized through a solvent evaporation-induced self-assembly method and used for NO adsorption. The structural properties, surface chemistry, and adsorption mechanism were investigated using nitrogen sorption, X-ray diffraction, transmission electron microscopy, Fourier-transform infrared spectroscopy, X-ray photoelectron spectroscopy, and temperature programmed desorption of CO and CO2. Results showed that the ordered mesoporous structure was synthesized and remained stable after exposure to NO and O2. The NO adsorption capacity of OMC was 16.35 mg gcat−1, which was 7.5 times that of activated carbon. This finding may be due to the large surface area of OMC and the full use of its mesopores. Characterization results showed that monodentate nitrito (–O–NO) was the adsorbed species, and it originated from the adsorption of NO on the oxidized C(O) sites formed by the oxidation of active free Cf sites. In addition, cerium was introduced into OMC to further improve its NO adsorption capacity to 18.61 mg gcat−1. The redox cycle between Ce4+ and Ce3+, which can provide excess adsorbed oxygen atoms to react with Cf sites and generate C(O) sites, may be responsible for the improved adsorption capacity.