Release Of Free Bases Research Articles

The improvement of the dissolution rate of ziprasidone free base from solid oral formulations.

This work aims at increasing solubility and dissolution rate of ziprasidone free base-Biopharmaceutics Classifaction System (BCS) class II compound. The authors describe a practical approach to amorphization and highlight problems that may occur during the development of formulations containing amorphous ziprasidone, which was obtained by grinding in high-energy planetary ball mills or cryogenic mills. The release of ziprasidone free base from the developed formulations was compared to the reference drug product containing crystalline ziprasidone hydrochloride-Zeldox® hard gelatin capsules. All preparations were investigated using compendial tests (USP apparatuses II and IV) as well as novel, biorelevant dissolution tests. The novel test methods simulate additional elements of mechanical and hydrodynamic stresses, which have an impact on solid oral dosage forms, especially during gastric emptying. This step may prove to be particularly important for many formulations of BCS class II drugs that are often characterized by narrow absorption window, such as ziprasidone. The dissolution rate of the developed ziprasidone free base preparations was found to be comparable or even higher than in the case of the reference formulation containing ziprasidone hydrochloride, whose water solubility is about 400 times higher than its free base.

Identification of the C4′-Oxidized Abasic Site as the Most Abundant 2-Deoxyribose Lesion in Radiation-Damaged DNA Using a Novel HPLC-Based Approach

A novel analytical high-performance liquid chromatography (HPLC)-based method of quantification of the yields of C4'-oxidized abasic sites, 1, in oxidatively damaged DNA has been elaborated. This new approach is based on efficient conversion of 1 into N-substituted 5-methylene-Δ(3)-pyrrolin-2-ones, 2, upon treatment of damaged DNA with primary amines in neutral or slightly acidic solutions with subsequent quantification of 2 by HPLC. The absolute and relative radiation-chemical yields of 1 in irradiated DNA solutions were re-evaluated using this method. The yields were compared with those of other 2-deoxyribose degradation products including 5-methylene-2(5H)-furanone, malondialdehyde, and furfural resulting from the C1', C4' and C5'-oxidations, respectively. The yield of free base release (FBR) determined in the same systems was employed as an internal measure of the total oxidative damage to the 2-deoxyribose moiety. Application of this technique identifies 1 as the most abundant sugar lesion in double-stranded (ds) DNA irradiated under air in solution (36% FBR). In single-stranded (ss) DNA this product is second by abundance (33% FBR) after 2-deoxyribonolactones (C1'-oxidation; 43% FBR). The production of nucleoside-5'-aldehydes (C5'-oxidation; 14% and 5% FBR in dsDNA and ssDNA, respectively) is in the third place. Taken together with the parallel reaction channel that converts C4'-radicals into malondialdehyde and 3'-phosphoglycolates, our results identify the C4'-oxidation as a prevalent pathway of oxidative damage to the sugar-phosphate backbone (50% or more of all 2-deoxyribose damages) in indirectly damaged DNA.

DNA Damage by the Direct Effect of Ionizing Radiation: Products Produced by Two Sequential One-Electron Oxidations

It has long been assumed that the population of radicals trapped in irradiated DNA (that is, the radicals escaping recombination) would quantitatively account for the lesions observed in DNA. Recent results indicate that this is not the case. The yield of DNA lesions exceed the yield of trappable radicals. To account for a portion of this shortfall, it is thought that some of the initially formed 2'-deoxyribose radicals undergo a second oxidation by nearby base cation radicals to form 2'-carbocations. The carbocations react to give strand breaks and free base release. Schemes are presented to account for the major oxidation products observed including 8-oxoGua, 8-oxoAde, 5-OHMeUra, and free base release. Theoretical calculations were performed to ascertain the likelihood of the second oxidation step in these reaction pathways actually occurring, and to account for base sequence dependence and various levels of hydration.

Factors Affecting the Yields of C1′ and C5′ Oxidation Products in Radiation-Damaged DNA: The Indirect Effect

This study reports the effects of denaturation and deoxygenation on radiation-induced formation of 2-deoxyribonolactone (2-dL) and 5'-aldehyde (5'-Ald) lesions in highly polymerized DNA. The radiation-chemical yields of 2-dL were determined through quantification of its dephosphorylation product 5-methylenefuranone (5MF). The formation of 5'-Ald was monitored qualitatively through the release of furfural (Fur) under the same conditions. The yields of 2-dL were found to be 7.3 ± 0.3 nmol J(-1), or about 18% of the yield of free base release measured in the same samples. Denaturation increased the efficiency of 2-dL formation approximately twofold while deoxygenation resulted in a fourfold decrease. The release of Fur is about twofold lower than that of 5MF in aerated native DNA samples and is further reduced by denaturation of the DNA. Unlike 5MF, the formation of Fur requires the presence of molecular oxygen, which is consistent with peroxyl radical-mediated oxidation of C5' radicals into 5'-Ald. In contrast, the existence of an oxygen-independent pathway of 2-dL formation suggests that C1' sugar radicals can also be oxidized by radiation-produced oxidizing intermediates such as electron-loss centers on guanines.

One-Electron Oxidation of DNA by Ionizing Radiation: Competition between Base-to-Base Hole-Transfer and Hole-Trapping

The distance of hole migration through DNA determines the degree to which radiation-induced lesions are clustered. It is the degree of clustering that confers to ionizing radiation its high toxicity. The migration distance is governed by a competition between hole transfer and irreversible trapping reactions. An important type of trapping is reactions that lead to the formation of deoxyribose radicals, which are precursors to free base release (fbr). Using HPLC, fbr was measured in X-irradiated films of d(CGCGCGCGCG)(2) and d(CGCGAATTCGCG)(2) as well as three genomic DNAs: M. luteus, calf thymus, and C. perfringens. The level of DNA hydration was varied from Gamma = 2.5 to 22 mol waters/mol nucleotide. The chemical yields of each base, G(base), were measured and used to calculate the modification factor, M(base). This factor compensates for differences in the GC/AT ratio, providing a measure of the degree to which a given base influences its own release. In the DNA oligomers, M(Gua) > M(Cyt), a result ascribed to the previously observed end effect in short oligomers. In the highly polymerized genomic DNA, we found that M(Cyt) > M(Gua) and that M(Thy) is consistently the smallest of the M factors. For these same DNA films, the yields of total DNA trapped radicals, G(tot)(fr), were measured using EPR spectroscopy. The yield of deoxyribose radicals was calculated using G(dRib)(fr) = approximately 0.11 x G(tot)(fr). Comparing G(dRib)(fr) with total fbr, we found that only about half of the fbr is accounted for by deoxyribose radical intermediates. We conclude that for a hole on cytosine, Cyt(*+), base-to-base hole transfer competes with irreversible trapping by the deoxyribose. In the case of a hole on thymine, Thy(*+), base-to-base hole transfer competes with irreversible trapping by methyl deprotonation. Close proximity of Gua protects the deoxyribose of Cyt but sensitizes the deoxyribose of Thy.

Direct Damage to the Backbone of DNA Oligomers Is Influenced by the OH Moiety at Strand Ends, by the Type of Base, and by Context

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.

Mechanisms of Strand Break Formation in DNA due to the Direct Effect of Ionizing Radiation: The Dependency of Free Base Release on the Length of Alternating CG Oligodeoxynucleotides

The question of how NA base sequence influences the yield of DNA strand breaks produced by the direct effect of ionizing radiation was investigated in a series of oligodeoxynucleotides of the form (d(CG)(n))(2) and (d(GC)(n))(2). The yields of free base release from X-irradiated DNA films containing 2.5 waters/nucleotide were measured by HPLC as a function of oligomer length. For (d(CG)(n))(2), the ratio of the Gua yield to Cyt yield, R, was relatively constant at 2.4-2.5 for n = 2-4 and it decreased to 1.2 as n increased from 5 to 10. When Gua was moved to the 5' end, for example going from d(CG)(5) to d(GC)(5), R dropped from 1.9 +/- 0.1 to 1.1 +/- 0.1. These effects are poorly described if the chemistry at the oligomer ends is assumed to be independent of the remainder of the oligomer. A mathematical model incorporating charge transfer through the base stack was derived to explain these effects. In addition, EPR was used to measure the yield of trapped-deoxyribose radicals at 4 K following X-irradiation at 4 K. The yield of free base release was substantially greater, by 50-100 nmol/J, than the yield of trapped-deoxyribose radicals. Therefore, a large fraction of free base release stems from a nonradical intermediate. For this intermediate, a deoxyribose carbocation formed by two one-electron oxidations is proposed. This reaction pathway requires that the hole (electron loss site) transfers through the base stack and, upon encountering a deoxyribose hole, oxidizes that site to form a deoxyribose carbocation. This reaction mechanism provides a consistent way of explaining both the absence of trapped radical intermediates and the unusual dependence of free base release on oligomer length.

Multiplicity of DNA Single-Strand Breaks Produced in pUC18 Exposed to the Direct Effects of Ionizing Radiation

The transition of plasmid DNA from a supercoiled to an open circle conformation, as detected by gel electrophoresis, affords an extraordinarily sensitive method for detecting single-strand breaks (SSBs), one measure of deoxyribose damage. To determine the yield of SSBs, G(ssb), by this method, it is commonly assumed that Poisson statistics apply such that, on average, one SSB occurs per supercoiled plasmid lost. For the direct effect, at a large enough plasmid size, this assumption may be invalid. In this report, the assumption that one SSB occurs per pUC18 plasmid (2686 bp) is tested by measuring free base release (fbr), which is also a measure of deoxyribose damage in films prepared under controlled relative humidity so as to produce known levels of DNA hydration. The level of DNA hydration, Gamma, is expressed in mol water/mol nucleotide. The yield of free base release, G(fbr), was measured by HPLC after exposure of the films to 70 kV X rays and subsequent dissolution in water. It is well known that damage in deoxyribose leads to SSBs and free base release. Based on known mechanisms, there exists a close correspondence between free base release and SSBs, i.e., G(fbr) congruent with G(ssb). Following this assumption, the SSB multiplicity, m(ssb), was determined, where m(ssb) was defined as the mean number of SSBs per supercoiled plasmid lost. The yield of lost supercoil was determined previously (S. Purkayastha et al., J. Phys. Chem. B 110, 26286-26291, 2006). We found that m(ssb) = 1.4 +/- 0.2 at Gamma = 2.5 and m(ssb) = 2.8 +/- 0.5 to 3.1 +/- 0.5 at Gamma = 22.5, indicating that the assumption of one SSB per lost supercoil is not likely to hold for a 2686-bp plasmid exposed to the direct effect. In addition, an increase in G(fbr), upon stepping from Gamma = 2.5 to Gamma = 22.5, was paralleled by an increase in the yield of trapped deoxyribose radicals, G(dRib)(fr), also measured previously. As a consequence, the shortfall between SSBs and trapped radicals, G(diff) = G(ssb) - G(dRib)(fr), remained relatively constant at 90-110 nmol/J. The lack of change between the two extremes of hydration is in keeping with the suggestion that non-radical species, such as doubly oxidized deoxyribose, are responsible for the shortfall.

GC/MS methods to quantify the 2-deoxypentos-4-ulose and 3'-phosphoglycolate pathways of 4' oxidation of 2-deoxyribose in DNA: application to DNA damage produced by gamma radiation and bleomycin.

DNA oxidation plays a substantive role in the pathophysiology of human diseases, such as cancer. While the chemistry of nucleobase lesions has dominated studies of DNA damage, there is growing evidence that the oxidation of 2-deoxyribose in DNA plays a critical role in the genetic toxicology of oxidative stress. As part of an effort to define the spectrum of 2-deoxyribose oxidation products arising in vitro and in vivo, we now describe methods for quantifying products arising from 4' oxidation of 2-deoxyribose in DNA. The chemistry of 4' oxidation partitions between either of two pathways to form either a 2-deoxypentos-4-ulose abasic site (oxAB) or a strand break comprised of a 3'-phosphoglycolate (3PG) residue and a 5'-phosphate, with the release of either malondialdehyde and free base or a base propenal. Highly sensitive gas chromatography/mass spectrometry (GC/MS) methods were developed to quantify both lesions. The abasic site was converted to a 3'-phosphoro-3-pyridazinylmethylate derivative by treatment of the damaged DNA with hydrazine, which was released from DNA as 3-hydroxymethylpyridazine (HMP) by enzymatic hydrolysis. Similarly, 3PG was released as 2-phosphoglycolic acid (PG) by enzymatic hydrolysis. Following HPLC prepurification, both PG and HMP were silylated and quantified by GC/MS, with limits of detection of 100 and 200 fmol and sensitivities of 2 and 4 lesions per 10(6) nucleotides (nt) in 250 microg of DNA, respectively. Following validation of the methods with oligodeoxynucleotides containing the two lesions, the methods were applied to DNA damage produced by bleomycin and gamma radiation. As expected for an agent known to produce only 4' oxidation of DNA, the quantities of 3PG and oxAB accounted for all 2-deoxyribose oxidation events, as indicated by slopes of 0.8 and 0.3, respectively, in plots of the lesion frequency against total 2-deoxyribose oxidation events, with the latter determined by a plasmid-nicking assay. 3PG residues and oxAB were produced at the rate of 32 and 12 lesions per 10(6) nt per microM, respectively. For gamma radiation, on the other hand, 4' oxidation was found to comprise only 13% of 2-deoxyribose oxidation chemistry, with 3% oxAB (4 per 10(6) nt per Gy) and 10% 3PG (13 per 10(6) nt per Gy).

Mechanisms of Direct Radiation Damage in DNA, Based on a Study of the Yields of Base Damage, Deoxyribose Damage, and Trapped Radicals in d(GCACGCGTGC)2

Dose-response curves were measured for the formation of direct-type DNA products in X-irradiated d(GCACGCGTGC)(2)prepared as dry films and as crystalline powders. Damage to deoxyribose (dRib) was assessed by HPLC measurements of strand break products containing 3' or 5' terminal phosphate and free base release. Base damage was measured using GC/ MS after acid hydrolysis and trimethylsilylation. The yield of trappable radicals was measured at 4 K by EPR of films X-irradiated at 4 K. With exception of those used for EPR, all samples were X-irradiated at room temperature. There was no measurable difference between working under oxygen or under nitrogen. The chemical yields (in units of nmol/J) for trapped radicals, free base release, 8-oxoGua, 8-oxoAde, diHUra and diHThy were G(total)(fr) = 618 +/- 60, G(fbr) = 93 +/- 8, G(8-oxoGua) = 111 +/- 62, G(8-oxoAde) = 4 +/- 3, G(diHUra) = 127 +/- 160, and G(diHThy) = 39 +/- 60, respectively. The yields were determined and the dose-response curves explained by a mechanistic model consisting of three reaction pathways: (1) trappable-radical single-track, (2) trappable-radical multiple-track, and (3) molecular. If the base content is projected from the decamer's GC:AT ratio of 4:1 to a ratio of 1:1, the percentage of the total measured damage (349 nmol/J) would partition as follows: 20 +/- 16% 8-oxoGua, 3 +/- 3% 8-oxoAde, 28 +/- 46% diHThy, 23 +/- 32% diHUra, and 27 +/- 17% dRib damage. With a cautionary note regarding large standard deviations, the projected yield of total damage is higher in CG-rich DNA because C combined with G is more prone to damage than A combined with T, the ratio of base damage to deoxyribose damage is approximately 3:1, the yield of diHUra is comparable to the yield of diHThy, and the yield of 8-oxoAde is not negligible. While the quantity and quality of the data fall short of proving the hypothesized model, the model provides an explanation for the dose-response curves of the more prevalent end products and provides a means of measuring their chemical yields, i.e., their rate of formation at zero dose. Therefore, we believe that this comprehensive analytical approach, combined with the mechanistic model, will prove important in predicting risk due to exposure to low doses and low dose rates of ionizing radiation.

Unaltered Free Base Release from d(CGCGCG)2Produced by the Direct Effect of Ionizing Radiation at 4 K and Room Temperature

Unaltered free base release in d(CGCGCG)2 exposed to X rays at 4 K or room temperature was measured by HPLC. Samples were prepared either as films hydrated to a level of Gamma = 2.5 mol water/mol nucleotide or as polycrystalline with Gamma approximately 7.5 mol water/mol nucleotide. X irradiation of films at 4 K, followed by annealing to room temperature, resulted in yields for cytosine and guanine of G(Cyt) = 0.036 +/- 0.001 micromol/J and G(Gua) = 0.090 +/- 0.002 micromol/J. Irradiation of films at room temperature gave similar yields. The yields for polycrystalline d(CGCGCG)2 X-irradiated at room temperature were G(Cyt) = 0.035 +/- 0.005 micromol/J and G(Gua) = 0.077 +/- 0.023 micromol/J. The total free base release yield, G(fbr), was 0.124 +/- 0.008 micromol/J for films and 0.112 +/- 0.028 micromol/J for polycrystalline samples. G(fbr) is believed to be a good estimate of total strand break yield. The yields of total free radicals trapped [G(Sigmafr)] by the d(CGCGCG)2 films at 4 K were measured by EPR. The measured value, G(Sigmafr) = 0.450 +/- 0.005 micromol/J, was used to calculate the yield of trappable sugar radicals, giving G(sugar)(fr) = 0.04-0.07 micromol/J. We found that (1) guanine release exceeded cytosine release by more than twofold, (2) G(sugar)(fr) cannot account for more than half of the free base release, and (3) G(fbr), G(Cyt) and G(Gua) were independent of the sample temperature during irradiation. Finding (1) suggests that base and or sequence influences sugar damage, and finding (2) is consistent with our working hypothesis that an important pathway to strand break formation entails two one-electron oxidations at the same sugar site.

Electron paramagnetic resonance evidence for a C3' sugar radical in crystalline d(CTCTCGAGAG) X-irradiated at 4 K.

Debije, M. G. and Bernhard, W. A. Electron Paramagnetic Resonance Evidence for a C3' Sugar Radical in Crystalline d(CTCTCGAGAG) X-Irradiated at 4 K. Radiat. Res. 155, 687-692 (2001). A neutral sugar radical formed by the net loss of hydrogen from C3' has been identified in crystalline DNA X-irradiated at 4 K. Crystals of duplex d(CTCTCGAGAG), known to be of B conformation, were studied using electron paramagnetic resonance (EPR) spectroscopy. The C3' radical was identified by using information from dose saturation, power saturation, thermal annealing, and spectrum simulation. The yield of the C3' radical, G(C3'), is 0.03 +/- 0.01 micromol/J, and its concentration does not appear to saturate up to at least 100 kGy. In the region in which total radical concentration increases linearly with dose, the C3' radical makes up about 4.5% of the total radical population trapped in the oligodeoxynucleotide crystal at 4 K. Based on free base release measured in other oligodeoxynucleotides, we suggest that in d(CTCTCGAGAG) the C3' radical is responsible for about one-third of the strand breakage events.

Neutral Alkoxysilanes from Silica

Silica (SiO2) is found to react readily with ethylene glycol (EGH2) to form neutral glycoxysilanes in the presence of catalytic amounts of high-boiling organic amines, such as triethylenetetramine (TETA), trishydroxymethyleneaminomethane [H2NC(CH2OH)3, THAMH3], and triethanolamine [N(CH2CH2OH)3, TEAH3]. Kinetic studies show that these amines offer similar catalytic efficiencies although their pKb values differ by 3 orders of magnitude. In addition, silica dissolution is found to be pseudo-zero order in silica. These kinetic data can be explained by a rate-limiting step involving release of free base from an intermediate pentacoordinated silicate coincident with the formation of a tetraalkoxysilane. The products from these reactions were characterized by 1H, 13C, and 29Si solution and solid-state NMR, thermal gravimetric analysis, and mass spectroscopy. Depending on the type and amount of base used, different products form: either neutral tetraalkoxysilanes, such as Si(OCH2CH2OH)4 and its soluble oligomer...

Peroxy radical oxidation of thymidine.

The peroxy radical (ROO) is unique among reactive oxygen species implicated in the production of DNA damage in that it possesses an extremely long half-life (order of seconds) and is predicted to have a relatively greater chemical selectivity in its reactions relative to other radical intermediates. Yet no product studies of the reactions of ROO with bases, nucleosides, or DNA have appeared, and thus no meaningful predictions can be made regarding its potential involvement in the production of DNA base damage and the mutagenic process. We report here on the reaction products formed by peroxy radical with thymidine, major target of oxidative base damage. ROO reacts with thymine to yield predominantly 5-Me oxidation products. The highly mutagenic 5-(hydroperoxymethyl)-2'-deoxyuridine, 5-formyl-2'-deoxyuridine, and 5-(hydroxymethyl)-2'-deoxyuridine are produced by peroxy radical oxidation. In contrast, 5Me oxidation products are minor products of thymidine oxidation by OH, which yields predominantly saturated derivatives via addition to the 5,6 double bound. A plausible mechanistic scheme for the formation of the base oxidation products of thymidine by peroxy radicals is presented. Attach at the deoxyribose moiety resulting in oxidative depyrimidination is also found to occur, as indicated by free base release. Phosphodiester backbone cleavage resulting in single and double strand breaks is also catalyzed by peroxy radical, as demonstrated using a plasmid nicking assay.

DNA Damage Induced via 5,6-Dihydrothymid-5-yl in Single-Stranded Oligonucleotides

5,6-Dihydrothymid-5-yl (4) is generated via Norrish type I cleavage of isopropyl ketone 7. Ketone 7 was site specifically incorporated into chemically synthesized polythymidylates and an oligonucleotide containing all four native deoxyribonucleotides. No damage is induced in oligonucleotides containing 7 upon photolysis under anaerobic conditions. In the presence of O2, strand breaks and alkaline labile lesions are formed at the original site of 7, and at nucleotides adjacent to the 5‘-phosphate of 7. Kinetic isotope effect experiments reveal that direct strand scission at the thymidine adjacent to the 5‘-phosphate of 4 arises from C1‘ hydrogen atom abstraction. The observed KIE (∼3.9) is attributed to hydrogen atom abstraction from C1‘ by the peroxyl radical 35 derived from 4. Enzymatic end group analysis and measurement of free base release are consistent with a process involving C1‘ hydrogen atom abstraction. Cleavage experiments carried out in the presence of t-BuOH (1.05 M) and NaN3 (10 mM) indicate ...

Release of unaltered bases from polycrystalline pyrimidine DNA constituents after X-irradiation and bombardment with heavy ions

Purpose: The radiation-induced release of unaltered bases from the lyophilized pyrimidine DNA constituents TMP, dCMP, CMP and dCyd was determined quantitatively in order to study explicitly the direct radiation effect. Materials and methods: X-irradiation under an air or a nitrogen gas atmosphere and heavy ion bombardment in the beam vacuum were employed at 300 K. The release of free bases was investigated using HPLC and 1H-NMR. Dose-yield curves for free radicals of X-irradiated TMP and dCMP samples were determined by EPR spectroscopy. Results: As one of the main products, the release of unaltered bases is linear with dose up to 360 kGy for X-irradiation or 200 kGy for heavy ion bombardment. The estimation of the radiation chemical yields revealed G values of about 10 -7 mol J -1. The heavy ion bombardment and X-irradiation under nitrogen effected a lower yield for base release than that for X-irradiation under air. For X-irradiation at sufficiently high doses about one order of magnitude difference in yields between bases released and free radicals formed was found. Conclusions: Compared with related findings as described in the literature, the G values from DNA are in the same order of magnitude, but from nucleosides in frozen aqueous solutions the yields of free bases are several orders of magnitude smaller.

Development of implantable antitumor devices based on polyphosphazenes, II

Matrix devices containing the alkylating agent melphalan have been prepared in different ways and their drug release characteristics have been studied using a flow-through release system. As matrix material polyphosphazene, substituted with glycine ethyl ester, was used. Testing of devices, prepared by using methanol, the best solvent for melphalan, renders biphasic release profiles, with high initial release concentrations of melphalan. These high initial ‘first-phasers releases could be eliminated by means of flow-through elution procedures. Tetrahydrofuran (THF) is the best solvent for polyphosphazene polymers, however, its use renders matrices which are too slowly releasing. In addition, the low level of release is difficult to reproduce due to difficult quantitative handling of the melphalan suspension in THF. The use of a more hydrophobic polyphosphazene, 50% substituted with glutamic acid diethyl ester and 50% with glycine ethyl ester, reduces the high initial release levels of melphalan when methanol has been used as solvent. With melphalan methyl ester free base, very low and gradual release profiles could be obtained, due to its good solubility in THF and its poor solubility in water. Devices with these release profiles showed promising therapeutic results in leukemia L1 210 i.p tumor model in mice. For both drug contents, the extension of the median survival time was statistically significant: P < 0.05 (Wilcoxon-test, two-tailed to control devices). With respect to median survival time only, in two cases slightly better to better results were observed: in one dosage group of animals receiving a higher releasing device (0.33% w/w: P < 0.01) or in another dosage group treated with repeated injections with melphalan methyl ester (33 μg: P < 0.01), however, far both the therapeutic range is rather narrow.

Radioprotection of DNA by Thiols: Relationship between the Net Charge on a Thiol and Its Ability to Protect DNA

Release of free bases from calf thymus DNA upon irradiation in aerated 0.1 mol dm-3NaClO4 at pH 7 has been measured by HPLC and shown to be markedly influenced by the presence of thiols during irradiation. The ability of thiols to protect DNA was shown to depend upon the net charge (Z) at pH 7 in the order WR 1065 (Z = +2) greater than cysteamine (Z = +1) greater than 2-mercaptoethanol (Z = 0) approximately equal to dithiothreitol (Z = 0) greater than GSH (Z = -1) approximately equal to 2-mercaptoethanesulfonic acid (Z = -1) approximately equal to 2-mercaptosuccinate (Z = -2). A similar dependence of protection upon net charge was found for disulfides: cystamine (Z = +2) greater than 2-mercaptoethyl disulfide (Z = 0) greater than GSSG (Z = -2). Protection by WR 1065, but not by 2-mercaptoethanol or GSH, was found to decrease significantly with increasing ionic strength. Protection by WR 1065 and GSH was not markedly dependent upon pH between pH 6 and 8. The results are explained in terms of electrostatic interaction of the thiols with DNA, leading to high concentrations of cations near DNA, which allow them to scavenge hydroxyl radicals and repair DNA radicals effectively and to low concentrations of anionic thiols near DNA, which limit their effectiveness as protectors. Poly(dG,dC) and calf thymus DNA exhibited comparable release of G and C upon changing from 0.1 to 0.7 mol dm-3 MgSO4. Since this change causes poly(dG,dC), but not calf thymus DNA, to undergo a change from the B-form to the Z-form of DNA, both forms must have a comparable susceptibility to radiation-induced base release.

Mechanism of bleomycin: evidence for 4'-ketone formation in poly(dA-dU) associated exclusively with free base release

Incubation of poly(dA-[3'-3H]dU), poly(dA-[5'-3H]dU), or poly(dA-[5'-3H]dT) under a variety of conditions with activated bleomycin resulted in the production of free nucleic acid base, base propenal, and a small amount of 3H2O. Adjustment of the terminated reaction mixture to pH 10 and incubation at 95 degrees C resulted in a time-dependent increase in 3H2O to an amount equal to the amount of free base. If the terminated reaction mixture was incubated with NaBH4 prior to the heat and alkaline treatment, the release of 3H2O was significantly inhibited. These results are consistent with the generation by activated bleomycin of a 4'-ketone yielding free base, with the exchange of the 3'- and 5'-hydrogens by enolization and with the alkaline-induced strand scission occurring from this intermediate.

Stimulation of iron(II) bleomycin activity by phosphate-containing compounds

Orthophosphate and phosphate derivatives including pyrophosphate, hexametaphosphate, ATP, ADP, and inositol hexaphosphate enhance the extent of DNA degradation by iron(II) bleomycin. These phosphate-containing compounds increase both the release of free nucleic base and that of base propenals which are DNA cleavage products, probably by enhancing the efficiency with which Fe(II) is recruited into the drug. Phosphate action occurs during drug activation prior to the attack on DNA. In addition, phosphates affect the stability of the activated drug complex, overcome the inhibition observed with high concentrations of DNA, and reduce the size of the DNA fragment necessary for reacting with the drug. Phosphate derivatives bind to iron(II) bleomycin and alter its optical spectrum. An analysis of titration data for pyrophosphate and inositol hexaphosphate indicates that each phosphate compound binds to more than one iron(II) bleomycin molecule. With ATP, ADP, and 2,3-diphosphoglycerate, only a single phosphate-containing compound binds to the ferrous drug complex. The affinity for ATP is sufficiently high as to suggest that the ternary complex formed in vitro may exist physiologically.