FOXL2 Mutation Research Articles

The molecular landscape of 227 adult granulosa cell tumors of the ovary: Insights into the progression from primary to recurrence

Adult granulosa cell tumors (AGCTs) of the ovary are characterized by their propensity for late recurrences and are primarily managed surgically due to the limited efficacy of systemic treatment. The FOXL2 p.C134W somatic mutation has been identified in ∼95% of AGCT cases, and TERT promoter alterations have been linked to worse overall survival. This study highlights the potential prognostic significance of FOXO1 mutations, suggesting that they may be associated with poorer overall survival and shorter time to recurrence. A total of 183 primary AGCTs and 44 recurrences without corresponding primary tumors were analyzed. The primary AGCTs were categorized into three groups: 77 non-recurrent tumors, 18 tumors which later recurred (including 9 cases with matched primary-recurrence pairs), and 88 tumors with unknown recurrence status. Targeted next-generation sequencing was conducted on 786 cancer-related genes to investigate their genetic profile. The study aimed to identify the molecular alterations associated with AGCT pathogenesis and recurrence rate, comparing primary vs. recurrent tumors, and primary-recurrent vs. primary non-recurrent cases. Our findings confirmed the high prevalence (99%) of the FOXL2 p.C134W mutation in AGCTs. Secondary truncating FOXL2 mutations were observed in 5% of cases. Two cases with typical AGCT morphology were FOXL2 wild-type, harboring mutations in KRAS or KMT2D instead, suggesting alternative genetic pathways. TERT promoter mutations were found in 43% of cases, more frequently in recurrences. Other recurrent mutations detected in the cohort included KMT2D (10%), FOXO1 (7%), CHEK2 (5%), TP53 (3.5%), PIK3CA (3.5%), and AKT1 (3%). Two recurrent, FOXL2-mutated cases also carried DICER1 mutations. One tumor exhibited MSI-High status and a TMB of 19 mut/Mb. Our results indicate the need for further investigation into the role of FOXO1 as a potential prognostic marker in AGCTs.

A molecular and immunohistochemical study of 37 cases of ovarian Sertoli-Leydig cell tumor.

This study provides an analysis of 37 ovarian Sertoli-Leydig cell tumors (SLCT), focusing on their morphological, immunohistochemical, and molecular features. The cohort was comprised of 9 well-differentiated, 25 moderately differentiated, and 3 poorly differentiated tumors. The immunohistochemical analysis was performed with 28 markers, including diagnostic markers and markers with possible predictive significance. The results showed high expression of sex cord markers (FOXL2, SF1, inhibin A, CD99, calretinin, ER, PR, AR), and variable expression of other markers such as CKAE1/3 (83%), CAIX (14%), and MUC4 (1%). Loss of PTEN expression was present in 14% of cases, and CTLA4 expression was seen in 43% of cases. All tumors were MMR proficient and HER2 and PD-L1 negative. The molecular analysis showed DICER1 mutations in 54.5% of cases, and a FOXL2 mutation in 6% of tumors. In addition, we detected 2 cases with TERT promoter mutation. RNA NGS sequencing identified significant differences in mRNA expression between DICER1MUT and DICER1WT tumors. The DICER1WT tumors showed increased expression of PRKCA, HNF1A, LDLR, and MAP2K5. On the contrary, the DICER1MUT cases showed increased expression of CDK6, NOTCH2, and FGFR2. The results of our study show that SLCTs exhibit distinct molecular features based on their degree of differentiation. We have confirmed that DICER1 mutations are characteristic of moderately and poorly differentiated SLCTs, while well-differentiated SLCTs may represent a distinct entity. DICER1MUT and DICER1WT tumors showed different mRNA expression profiles. The FOXL2 mutation is less common in these tumors and is mutually exclusive with the DICER1 mutation.

Tilapia, a good model for studying reproductive endocrinology

The Nile tilapia (Oreochromis niloticus), with a system of XX/XY sex determination, is a worldwide farmed fish with a shorter sexual maturation time than that of most cultured fish. Tilapia show a spawning cycle of approximately 14 days and can be artificially propagated in the laboratory all year round to obtain genetically all female (XX) and all male (XY) fry. Its genome sequence has been opened, and a perfect gene editing platform has been established. With a moderate body size, it is convenient for taking enough blood to measure hormone level. In recent years, using tilapia as animal model, we have confirmed that estrogen is crucial for female development because 1) mutation of star2, cyp17a1 or cyp19a1a (encoding aromatase, the key enzyme for estrogen synthesis) results in sex reversal (SR) due to estrogen deficiency in XX tilapia, while mutation of star1, cyp11a1, cyp17a2, cyp19a1b or cyp11c1 affects fertility due to abnormal androgen, cortisol and DHP levels in XY tilapia; 2) when the estrogen receptors (esr2a/esr2b) are mutated, the sex is reversed from female to male, while when the androgen receptors are mutated, the sex cannot be reversed; 3) the differentiated ovary can be transdifferentiated into functional testis by inhibition of estrogen synthesis, and the differentiated testis can be transdifferentiated into ovary by simultaneous addition of exogenous estrogen and androgen synthase inhibitor; 4) loss of male pathway genes amhy, dmrt1, gsdf causes SR with upregulation of cyp19a1a in XY tilapia. Disruption of estrogen synthesis rescues the male to female SR of amhy and gsdf but not dmrt1 mutants; 5) mutation of female pathway genes foxl2 and sf-1 causes SR with downregulation of cyp19a1a in XX tilapia; 6) the germ cell SR of foxl3 mutants fails to be rescued by estrogen treatment, indicating that estrogen determines female germ cell fate through foxl3. This review also summarized the effects of deficiency of other steroid hormones, such as androgen, DHP and cortisol, on fish reproduction. Overall, these studies demonstrate that tilapia is an excellent animal model for studying reproductive endocrinology of fish.

Detection of FOXL2 C134W Mutation Status by a Novel BaseScope In Situ Hybridization Assay is Highly Sensitive and Specific for Adult Granulosa Cell Tumors

Adult granulosa cell tumors (AGCTs) are a molecularly distinct group of malignant ovarian sex cord-stromal tumors (SCSTs) characterized by a nearly ubiquitous c.402C>G/p.C134W mutation in FOXL2 (hereafter referred to as “C134W”). In some cases, AGCT exhibits marked morphologic overlap with other SCSTs and has an identical immunophenotype, and molecular testing may be necessary to help confirm the diagnosis. However, molecular testing is time consuming, relatively expensive, and unavailable in many pathology laboratories. We describe the development and validation of an in situ hybridization (ISH) custom BaseScope assay for the detection of the FOXL2 C134W mutation. We evaluated 106 ovarian SCSTs, including 78 AGCTs, 9 juvenile granulosa cell tumors, 18 fibromas (cellular and conventional), and 1 SCST, not otherwise specified, as well as 53 epithelial ovarian tumors (42 endometrioid carcinomas and 11 carcinosarcomas) and 1 STK11 adnexal tumor for the presence or absence of FOXL2 wild-type and FOXL2 C134W RNA expression via BaseScope-ISH. Fifty-one tumors had previously undergone DNA sequencing of the FOXL2 gene. Across the entire cohort, the FOXL2 C134W probe staining was positive in 77 of 78 (98.7%) AGCTs. Two of 81 (2.5%) non-AGCTs also showed positive staining, both of which were epithelial ovarian tumors. The assay worked in tissue from blocks >20 years old. There was 100% concordance between the FOXL2 sequencing and BaseScope-ISH results. Overall, assessment of FOXL2 mutation status by custom BaseScope-ISH demonstrated 98.7% sensitivity and 97.5% specificity for the diagnosis of AGCT. BaseScope-ISH for FOXL2 C134W represents a reasonable alternative to sequencing, is quicker and less expensive, and is more easily incorporated than molecular testing into many pathology laboratories. It also has the advantage of requiring less tissue, and the neoplastic cells can be directly visualized on stained sections.

Abstract 1462: Oncogenic Foxl2 is a chromatin-remodeling pioneer transcription factor in adult-type ovarian granulosa cell tumors

Abstract Background: A missense mutation in the Forkhead domain-containing FOXL2 (Foxl2 p.C134W) transcription factor is found in nearly all adult-type granulosa cell tumors, but the oncogenic mechanism of this mutation is not known. Other Forkhead family transcription factors have well-described “pioneer” activity, binding to compacted, nucleosome-bound DNA and increasing accessibility for other regulatory proteins. Objectives: To develop novel cell culture model systems and determine whether oncogenic Foxl2-C134W has pioneering activity. Methods: CRISPR/Cas9 editing was used to generate isogenic granulosa cell tumor cells lacking either the FOXL2 wild-type allele (single knock-out; SKO) or both the mutant and wild-type FOXL2 alleles (double knock-out; DKO). ATAC-Seq and endogenous Foxl2 ChIP-Seq were performed on these isogenic lines to determine the differential chromatin accessibility at Foxl2-bound regulatory regions across genotypes. ENCODE pipelines and data standards were used for analysis, and the irreproducible discovery rate was used to identify high-reliability ATAC-seq and ChIP-seq peaks. De novo motifs were identified with STREME. Promoter capture HiC was performed using a bespoke genome-wide hybrid capture probe set, and CHiCAGO was used to identify significant HiC interactions. Results: Endogenous ChIP-seq of Foxl2-C134W from the SKO cell line identified 1147 high-confidence peaks. De novo motif discovery identified the canonical Foxl2 binding motif (TGTTTACATT, P = 1.4 x 10-7) in 44.9% of peaks, as well as a novel variant motif (TGTTTTGTCT, P = 6.7 x 10-15) in 68.5% of peaks. Median chromatin accessibility at Foxl2-C134W peak regions, as measured by ATAC-seq, was significantly decreased in the DKO cells compared to either SKO or parental cell lines (P < 2 x 10-16 for both comparisons). No difference was observed between SKO and parental cell lines (P = 0.19). Decreased chromatin accessibility at Foxl2-C134W ChIP-seq peaks in the DKO cells was driven by peaks containing the novel variant Foxl2 binding motif. Promoter capture HiC identified promoter-enhancer interactions lost in the DKO cell line involving several genes, including HUNK, NOVA1, andSFRP2 (adjusted P < 0.05). Conclusion: Foxl2-C134W exhibits “pioneering” activity, increasing chromatin accessibility at key gene regulatory elements with associated re-programming of promoter-enhancer interactions. The oncogenic mechanism of Foxl2-C134W in granulosa cell tumors may involve changes in DNA binding specificity, re-directing this pioneering function to sites containing a novel variant Foxl2 binding motif. Citation Format: Veena Vuttaradhi, Eleonora Khlebus, Thomas Welte, Namrata Khurana, Barrett Lawson, Robert Tyler Hillman. Oncogenic Foxl2 is a chromatin-remodeling pioneer transcription factor in adult-type ovarian granulosa cell tumors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 1462.

Abstract 453: Targeting FOXL2C402Gvulnerabilities in adult type ovarian granulosa cell tumors

Abstract Background: Nearly all adult-type granulosa cell tumors of the ovary (aGCTs) carry the same oncogenic mutation affecting the second winged helix domain of the Forkhead family transcription factor FOXL2 (c.C402G; p.C134W). There are no currently available therapies that exploit the high prevalence of FOXL2 mutations in this disease. Objectives: Exploit FOXL2-C402G oncogenic addiction in order to identify FDA-approved compounds with differential potency in KGN-FOXL2WT/C402G cells and isogenic KGN-FOXL2—/— cells. Methods: CRISPR/Cas9 was used to generate isogenic derivatives of KGN, a cell line derived from a recurrent aGCT. Parental cells (KGN-FOXL2WT/C402G) or isogenic cells lacking both FOXL2 alleles (KGN-FOXL2—/—) were functionally characterized and loss of Foxl2 protein was confirmed by immunoblot. Two drug libraries comprising a total of 2,416 compounds (majority FDA approved) were screened for effectiveness in KGN-FOXL2WT/C402G cells and KGN-FOXL2—/— cells. Our assay included staining with DAPI, followed by automated image analysis of each well to enumerate nuclei/cell numbers. Based on Fraction Affected (FA) statistics, compounds were ranked according to effectiveness in KGN-FOXL2WT/C402G cells. FA-area under the curve (FA-AUC) cutoff >0.1 yielded 152 drug candidates, categorized into 13 drug classes. 40 drug candidates, including the top 1-4 hits in each drug class were chosen for further validation. Validation rate in the confirmatory screen was at 95%. A novel primary tumor organoid culture system for aGCT was developed and validated using whole exome sequencing and immunophenotype. Selected candidate compounds were further investigated in aGCT organoid cultures from two relapsed tumors. Results: We identified classes of drugs such as the inhibitors of Bromodomain family proteins and Hydroxy-Camptothecin analogs, with enhanced activity in KGN-FOXL2WT/C402G cells relative to KGN-FOXL2—/— cells. Unexpectedly glucocorticoids as a class were found to stimulate proliferation of KGN-FOXL2WT/C402G cells whereas they lacked this activity in KGN-FOXL2—/— cells. For 36 glucocorticoids present in the screen, FA-AUC ranged from -0.3191 to -0.1342 (highest proliferation index among all test compounds) in KGN-FOXL2WT/C402G cells compared to -0.0353 to +0.1667 in KGN-FOXL2—/— cells. In recurrent aGCT organoids, the high-potency glucocorticoid dexamethasone induced cell proliferation and co-treatment with glucocorticoids increased the IC50 of paclitaxel in KGN-FOXL2WT/C402G cells from 1.43 nM to 4.04 nM. Conclusion: Mutant FOXL2 mediates a proliferative response to glucocorticoids in cultured cells and primary aGCT organoids. Paclitaxel is a standard of care chemotherapy in the treatment of aGCTs and is often administered with glucocorticoid pre-medication. The adverse effect of glucocorticoids on paclitaxel efficiency shown here should thus be taken into consideration in the clinic. Citation Format: Thomas Welte, Veena Vuttaradhi, Eleonora Khlebus, Barrett Lawson, Robert T. Hillman, Nghi Nguyen, Mary Sobieski, Reid T. Powell, Clifford Stephan. Targeting FOXL2C402Gvulnerabilities in adult type ovarian granulosa cell tumors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 453.

Multi-locus gene editing effectively knocked out cyp19a1a and foxl2 in Monopterus albus, a hermaphroditic fish

Homozygous mutant populations are typically obtained when studying gene function using gene editing. However, because of asynchronous testicular and ovarian development, it is difficult to obtain homozygous mutant offspring of hermaphrodite fish by mating males and females. The rice field eel (Monopterus albus) was the first hermaphrodite teleost to be identified. Natural sex change characteristics render M. albus a good model for studying vertebrate sex differentiation. Rice field eels are also an economically important aquaculture species in East and Southeast Asia. In this study, we established a highly efficient multi-locus gene editing method for rice field eels. We selected cyp19a1a and foxl2 for editing and targeted seven and 11 sites in the coding regions of these genes, respectively. Fertilized eggs were co-injected with the Cas9 protein and the guide RNAs of each gene. The efficiency of gene editing–induced mutations in cyp19a1a and foxl2 was approximately 100% in the microinjected embryos and adult fish tissues. In cyp19a1a mutants, serum E2 levels were decreased, and ovarian development was blocked. Only germ stem cells or oogonia were present in the gonads of the 12-month-old cyp19a1a mutant fish. These results suggest that cyp19a1a plays a key role in regulating primary gonadal development in the ovaries of rice field eels. In foxl2 mutants, cyp19a1a transcription and serum E2 levels were minimally decreased, whereas the transcription of foxl2-l, foxl3, and dmrt1 was increased. Nevertheless, the gonads of foxl2 mutant fish differentiated into ovaries, thereby indicating that foxl2 does not directly affect ovarian development in rice field eels. The multi-locus gene editing method established in this study provides an effective approach for studying gene function study and improving the genetic traits in rice field eels.

The Oncogenic FOXL2 C134W Mutation Is a Key Driver of Granulosa Cell Tumors.

A newly generated mouse model carrying a FOXL2 mutation characteristic of adult-type granulosa cell tumors shows that FOXL2 C134W shifts the transcriptome towards a signature of granulosa cell cancer and drives tumorigenesis.

Molecular assessment of testicular adult granulosa cell tumor demonstrates significant differences when compared to ovarian counterparts

Testicular adult granulosa cell tumor (AGCT) is a rare type of sex-cord stromal tumor that affects patients of a wide age range and has the potential for late metastasis. In the testis, the diagnosis of AGCTs often requires the exclusion of other more common types of sex-cord stromal tumors. Immunohistochemistry is of limited utility, being used mostly to confirm sex-cord lineage and to exclude other entities when morphology is not typical. Unlike ovarian AGCTs, which are molecularly homogeneous and harbor a specific activating FOXL2 mutation (c.7558C > T p.C134W) in >90% of cases, the molecular characteristics of testicular AGCTs remain largely unknown. In the current study, we analyzed 13 testicular AGCTs diagnosed at multiple institutions using massively parallel DNA sequencing to evaluate single nucleotide variants, copy number alterations, and structural variants. In all, 10/13 cases were sequenced successfully. Notably, the FOXL2 c.7558C > T (p.C134W) mutation was identified in only a single case (1/10, 10%). The remaining cases were molecularly heterogeneous, with largely nonrecurrent genetic variants. Putative driver events in individual cases included a well-characterized gain-of-function NRAS mutation, as well as inactivation of ATM and TP53, among others. The only highly recurrent finding was single copy loss of 22q (7/10 cases, 70%). Comparatively, the frequencies of FOXL2 c.7558C > T (p.C134W) and 22q loss in 12 metastatic ovarian AGCTs identified in our database were 92% (11/12) and 42% (5/12), respectively. The results of the present study suggest that testicular AGCTs are different from their ovarian counterparts in that they appear to be molecularly heterogeneous and only rarely harbor FOXL2 mutations.

Ovarian Reserve and ART Outcomes in Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Patients With FOXL2 Mutations.

ObjectiveTo characterize the status of ovarian reserve and ART outcomes in BPES women and provide informative reference for clinical diagnosis and treatment.MethodsTwenty-one women with BPES were screened for mutations in the FOXL2 gene and underwent assisted reproductive technology (ART) treatment. Indicators for ovarian reserve and ART outcomes were compared between patients with and without FOXL2 mutations. Additionally, ART outcomes were compared among patients with different subtypes of FOXL2 mutations.ResultsA total of 13 distinct heterozygous variants in the FOXL2 gene were identified in 80.95% of BPES women, including 4 novel mutations with plausible pathogenicity (c.173_175dup, c.481C>T, c.576del and c.675_714del). Compared to non-mutation group, patients with FOXL2 mutations had elevated levels of FSH (P=0.007), decreased AMH levels (P=0.012) and less AFC (P=0.015). They also had worse ART outcomes with large amount of Gn dosage (P=0.008), fewer oocytes (P=0.001), Day3 good quality embryos (P=0.001) and good quality blastocysts (P=0.037), and a higher cancellation rate (P=0.272). High heterogeneity of ART outcomes existed in BPES patients with different FOXL2 mutation types.ConclusionsBPES patients with FOXL2 mutations had diminished ovarian reserve and adverse ART outcomes. The genotype-reproductive phenotype correlations were highly heterogeneous and cannot be generalized. Genetic counseling for fertility planning and preimplantation or prenatal genetic diagnosis to reduce offspring inheritance are recommended.

FOXL2 in adult-type granulosa cell tumour of the ovary: oncogene or tumour suppressor gene?

A recurrent mutation in FOXL2 (c.402C>G; p.C134W) is present in over 95% of adult-type granulosa cell tumours (AGCTs). In contrast, various loss-of-function mutations in FOXL2 lead to the development of blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES). BPES is characterised by an eyelid malformation often accompanied with primary ovarian insufficiency. Two recent studies suggest that FOXL2 C402G is a gain- or change-of-function mutation with altered DNA-binding specificity. Another study proposes that FOXL2 C402G is selectively targeted for degradation, inducing somatic haploinsufficiency, suggesting its role as a tumour suppressor. The latter study relies on data indicative of an FOXL2 allelic imbalance in AGCTs. Here we present RNA-seq data as genetic evidence that no real allelic imbalance is observed at the transcriptomic level in AGCTs. Additionally, there is no loss of protein expression in tumours harbouring the mutated allele. These data and other features of this mutation compared to other oncogenes and tumour suppressor genes argue strongly against FOXL2 being a tumour suppressor in this context. Given the likelihood that FOXL2 C402G is oncogenic, targeting the variant protein or its downstream consequences is the most viable path forward to identifying an effective treatment for this cancer. © 2021 The Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Cytologic features of sex cord-stromal tumors in women.

Gynecologic sex cord-stromal tumors (SCSTs) arise from sex cords of the embryonic gonad and may display malignant behavior. We describe the cytomorphologic features of SCSTs in females, including adult and juvenile granulosa cell tumors (AGCTs and JGCTs), Sertoli-Leydig cell tumors (SLCTs), and steroid cell tumors (SCTs). We retrieved available cytology slides from females with a histologic diagnosis of sex cord-stromal tumor between 2009 and 2020 from institutional archives and reviewed their cytoarchitectural features. There were 25, 2, 2, and 1 cytology specimens from 19, 2, 2, and 1 patients (aged 7-90 years, median 57 years) with AGCT, JGCT, SLCT, and SCT, respectively. Features common to all SCSTs included 3-dimensional groups, rosettes, rare papillary fragments, abundant single cells and naked nuclei. Rosettes and a streaming appearance of cell groups were only seen in AGCTs, which also rarely featured eosinophilic hyaline globules and metachromatic stroma. AGCTs exhibited high nuclear:cytoplasmic (N:C) ratios, with mild nuclear pleomorphism, uniform nuclei with finely granular chromatin, nuclear grooves and small nucleoli; in contrast, other SCSTs lacked rosettes and nuclear grooves and had generally lower N:C ratios, greater nuclear pleomorphism, coarse chromatin and more abundant cytoplasm. Mitotic figures, necrosis, and inflammation were rarely identified. AGCTs show cytomorphologic features that are distinct from those of other SCSTs. Careful evaluation of the cytological features and ancillary studies (eg, immunochemistry for FOXL2, inhibin and calretinin, or sequencing for FOXL2 mutations) can aid in the accurate diagnosis of these tumors.

An alternative miRISC targets a cancer‐associated coding sequence mutation in FOXL2

An alternative miRISC targets a cancer‐associated coding sequence mutation in FOXL2

FOXL2 mutation is prevalent in metastatic adult granulosa cell tumors and is associated with improved survival

<h3>Objectives:</h3> Adult granulosa cell tumors (AGCT) of the ovary represent less than 5% of all ovarian tumors. Despite having a favorable prognosis, nearly one-third of women with this diagnosis will recur, and therapeutic options are limited. We aim to describe a molecular profile of AGCT to improve prognostication and elucidate actionable molecular targets. <h3>Methods:</h3> AGCT samples were analyzed using a combination of next-generation sequencing (NGS), immunohistochemistry (IHC) and whole transcriptome sequencing (NovaSeq) (Caris Life Sciences, Phoenix, AZ). PD-L1 expression was tested by SP-142 (Ventana; positive cut-off ≥1%). Microsatellite instability (MSI) was tested by fragment analysis, IHC and NGS. Tumor mutational burden (TMB) was measured by counting all somatic mutations per tumor (TMB-high cut-off ≥10 mutations per MB). Immune cell fraction was calculated by QuantiSeq (Finotello 2019, Genome Medicine). Gene Set Enrichment Analysis (GSEA) was used to determine enrichment of cancer hallmark pathways (Broad Institute). Survival analyses were performed using the Kaplan-Meier estimate. <h3>Results:</h3> Of the 319 patients, the median age was 55, and most patients had metastatic disease (82.4 %). A majority of the tumors carried FOXL2 mutations (83.6%), of which 90% demonstrated a <i>C134W</i> missense mutation. Patients with FOXL2 mutations were significantly older (56 versus 47 years, p=0.003) and more likely to have metastatic disease than patients with wild-type FOXL2 (p=0.045). Other frequent mutations included KMT2D (14%) and PIK3CA (8%) mutations. There were no pathogenic <i>BRCA1</i> or <i>BRCA2</i> mutations identified in this cohort; however, a <i>BRCA2</i> mutation variant of unknown significance was noted in three tumors. Pathway analyses demonstrated that alterations in chromatin remodeling were significantly more common in tumors with FOXL2 mutations compared to wild-type status (16.1% versus 9.7%, p<0.05), as were alterations in the PI3K pathway (13.9% versus 0%, p<0.05). There was a low frequency of PD-L1 high expression (2.7%), and there were no tumors with high TMB or MSI. Patients with tumors with FOXL2 mutations had improved overall survival compared to patients with wild-type FOXL2 tumors (HR 2.07, CI 1.01-4.25, p=0.043). KMT2D and PI3KCA mutations were not associated with differences in overall survival when compared to wild-type tumors. Copy number alterations in the genes GPHN, HOOK3, SPEN, CAMTA1 and BCL2L11 were associated with survival differences in patients treated with bevacizumab. <h3>Conclusions:</h3> A majority of AGCT carry FOXL2 mutations. The next most common mutations were KMT2D, PIK3CA, and alterations in chromatin remodeling. In this cohort of patients, the FOXL2 mutation was associated with improved overall survival. Copy number alterations in specific genes were associated with differences in survival in patients treated with bevacizumab. These results support molecular profiling of AGCT to improve prognostication for these patients. These findings provide groundwork to direct further investigation into novel treatment strategies and targeted agents in AGCT.

Utility of FOXL2 mutation testing in differential diagnosis of adult granulosa cell tumour

Background: Adult granulosa cell tumour (AGCT) is a low-grade malignant sex cord-stromal tumour accounting for approximately 5% of malignant ovarian tumours, with a peak incidence occurring at 50–55 years. The majority of cases demonstrate distinctive clinical and morphologic features, and up to 97% of AGCT cases carry a recurrent, somatic missense mutation in codon 134 of the transcription factor, FOXL2 (C134W). Whilst FOXL2 mutation testing may not be required in cases with classic morphology and immunophenotype (inhibin, calretinin, CD99 positive), FOXL2 mutation testing aids diagnosis in problematic cases. The differential diagnosis may include other sex cord-stromal tumours, such as cellular fibroma, thecoma, and juvenile granulosa cell tumour, all of which have a very low rate of FOXL2 mutation. Whilst immunohistochemistry is useful in confirming sex cord-stromal tumour type, immunophenotype does not distinguish between tumours within this category. Aims: We explore the histologic spectrum of AGCT and other sex cord-stromal tumours; and correlate the findings with FOXL2 mutation testing. Methods: FOXL2 mutation testing was performed initially using targeted PCR and Sanger sequencing (Hudson Institute) or subsequently by next-generation sequencing using the Illumina Trusight Tumour 26 kit (Austin Health). Results: Cases discussed comprise three AGCTs confirmed with FOXL2 mutation: two with atypical pathological features (1 luteinised, 1 extensively necrotic), and one with atypical clinical behaviour; and two cases of sex cord-stromal tumour where absence of FOXL2 mutation supported diagnosis (cellular fibromas).

Large Ovarian Follicle Cyst: Benign Mimic of Cystic Adult Granulosa Cell Tumor.

While most ovarian follicle cysts are <8 cm in greatest dimension, much larger follicle cysts (up to 18.5 cm) have been reported. To our knowledge, the FOXL2 mutation status of such cases has not been documented in the literature. Here, we report the features of a 14 cm ovarian cyst with no FOXL2 mutation detected by targeted next-generation sequencing. While adult granulosa cell tumor was the chief entity in our differential diagnosis, the absence of convincing nuclear grooves, lack of architectural variability, presence of a theca layer, and absence of FOXL2 mutation were consistent with a diagnosis of ovarian follicle cyst.

FOXL2 and TERT promoter mutation detection in circulating tumor DNA of adult granulosa cell tumors as biomarker for disease monitoring

ObjectiveAdult granulosa cell tumors (aGCTs) represent a rare, hormonally active subtype of ovarian cancer that has a tendency to relapse late and repeatedly. Current serum hormone markers are inaccurate in reflecting tumor burden in a subset of aGCT patients, indicating the need for a novel biomarker. We investigated the presence of circulating tumor DNA (ctDNA) harboring a FOXL2 or TERT promoter mutation in serial plasma samples of aGCT patients to determine its clinical value for monitoring disease. MethodsIn a national multicenter study, plasma samples (n = 110) were prospectively collected from 21 patients with primary (n = 3) or recurrent (n = 18) aGCT harboring a FOXL2 402C > G and/or TERT (C228T or C250T) promoter mutation. Circulating cell-free DNA was extracted and assessed for ctDNA containing one of either mutations using droplet digital PCR (ddPCR). Fractional abundance of FOXL2 mutant and TERT mutant ctDNA was correlated with clinical parameters. ResultsFOXL2 mutant ctDNA was found in plasma of 11 out of 14 patients (78.6%) with aGCT with a confirmed FOXL2 mutation. TERT C228T or TERT C250T mutant ctDNA was detected in plasma of 4 of 10 (40%) and 1 of 2 patients, respectively. Both FOXL2 mutant ctDNA and TERT promoter mutant ctDNA levels correlated with disease progression and treatment response in the majority of patients. ConclusionsFOXL2 mutant ctDNA was present in the majority of aGCT patients and TERT promoter mutant ctDNA has been identified in a smaller subset of patients. Both FOXL2 and TERT mutant ctDNA detection may have clinical value in disease monitoring.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Germline sexual fate is determined by the antagonistic action of dmrt1 and foxl3/foxl2 in tilapia.

Germline sexual fate has long been believed to be determined by the somatic environment, but this idea is challenged by recent studies of foxl3 mutants in medaka. Here, we demonstrate that the sexual fate of tilapia germline is determined by the antagonistic interaction of dmrt1 and foxl3, which are transcriptionally repressed in male and female germ cells, respectively. Loss of dmrt1 rescued the germ cell sex reversal in foxl3Δ7/Δ7 XX fish, and loss of foxl3 partially rescued germ cell sex reversal but not somatic cell fate in dmrt1Δ5/Δ5 XY fish. Interestingly, germ cells lost sexual plasticity in dmrt1Δ5/Δ5 XY and foxl3Δ7/Δ7 XX single mutants, as aromatase inhibitor (AI) and estrogen treatment failed to rescue the respective phenotypes. However, recovery of germ cell sexual plasticity was observed in dmrt1/foxl3 double mutants. Importantly, mutation of somatic cell-specific foxl2 resulted in testicular development in foxl3Δ7/Δ7 or dmrt1Δ5/Δ5 mutants. Our findings demonstrate that sexual plasticity of germ cells relies on the presence of both dmrt1 and foxl3. The existence of dmrt1 and foxl3 allows environmental factors to influence the sex fate decision in vertebrates.

Adult-type granulosa cell tumor of the ovary: a FOXL2-centric disease.

Adult‐type granulosa cell tumors (aGCTs) account for 90% of malignant ovarian sex cord‐stromal tumors and 2–5% of all ovarian cancers. These tumors are usually diagnosed at an early stage and are treated with surgery. However, one‐third of patients relapse between 4 and 8 years after initial diagnosis, and there are currently no effective treatments other than surgery for these relapsed patients. As the majority of aGCTs (>95%) harbor a somatic mutation in FOXL2 (c.C402G; p.C134W), the aim of this study was to identify genetic mutations besides FOXL2 C402G in aGCTs that could explain the clinical diversity of this disease. Whole‐genome sequencing of 10 aGCTs and their matched normal blood was performed to identify somatic mutations. From this analysis, a custom amplicon‐based panel was designed to sequence 39 genes of interest in a validation cohort of 83 aGCTs collected internationally. KMT2D inactivating mutations were present in 10 of 93 aGCTs (10.8%), and the frequency of these mutations was similar between primary and recurrent aGCTs. Inactivating mutations, including a splice site mutation in candidate tumor suppressor WNK2 and nonsense mutations in PIK3R1 and NLRC5, were identified at a low frequency in our cohort. Missense mutations were identified in cell cycle‐related genes TP53, CDKN2D, and CDK1. From these data, we conclude that aGCTs are comparatively a homogeneous group of tumors that arise from a limited set of genetic events and are characterized by the FOXL2 C402G mutation. Secondary mutations occur in a subset of patients but do not explain the diverse clinical behavior of this disease. As the FOXL2 C402G mutation remains the main driver of this disease, progress in the development of therapeutics for aGCT would likely come from understanding the functional consequences of the FOXL2 C402G mutation.