Four-generation Chinese Family Research Articles

Spastin accumulation and motor neuron defects caused by a novel SPAST splice site mutation

BackgroundHereditary spastic paraplegia (HSP) is a rare genetically heterogeneous neurodegenerative disorder. The most common type of HSP is caused by pathogenic variants in the SPAST gene. Various hypotheses regarding the pathogenic mechanisms of HSP-SPAST have been proposed. However, a single hypothesis may not be sufficient to explain HSP-SPAST.ObjectiveTo determine the causative gene of autosomal dominant HSP-SPAST in a pure pedigree and to study its underlying pathogenic mechanism.MethodsA four-generation Chinese family was investigated. Genetic testing was performed for the causative gene, and a splice site variant was identified. In vivo and in vitro experiments were conducted separately. Western blotting and immunofluorescence were performed after transient transfection of cells with the wild-type (WT) or mutated plasmid. The developmental expression pattern of zebrafish spasts was assessed via whole-mount in situ hybridization. The designed guide RNA (gRNA) and an antisense oligo spast-MO were microinjected into Tg(hb9:GFP) zebrafish embryos, spinal cord motor neurons were observed, and a swimming behavioral analysis was conducted.ResultsA novel heterozygous intron variant, c.1004 + 5G > A, was identified in a pure HSP-SPAST pedigree and shown to cosegregate with the disease phenotypes. This intron splice site variant skipped exon 6, causing a frameshift mutation that resulted in a premature termination codon. In vitro, the truncated protein was evenly distributed throughout the cytoplasm, formed filamentous accumulations around the nucleus, and colocalized with microtubules. Truncated proteins diffusing in the cytoplasm appeared denser. No abnormal microtubule structures were observed, and the expression levels of α-tubulin remained unchanged. In vivo, zebrafish larvae with this mutation displayed axon pathfinding defects, impaired outgrowth, and axon loss. Furthermore, spast-MO larvae exhibited unusual behavioral preferences and increased acceleration.ConclusionThe adverse effects of premature stop codon mutations in SPAST result in insufficient levels of functional protein, and the potential toxicity arising from the intracellular accumulation of spastin serves as a contributing factor to HSP-SPAST.

A novel cataract-related mutation R10P in γA-crystallin increases susceptibility to thermal shock and ultraviolet radiation of γA-crystallin

Congenital cataract is one of the most common causes of childhood blindness, typically resulting from genetic mutations. Over a hundred gene mutations associated with congenital cataract have been identified, with approximately half occurring in the Crystallin genes. In this study, we identified a novel γA-crystallin pathogenic mutation (c. 29G > C, p. Arg10Pro (R10P)), from a four-generation Chinese family with congenital cataract, and investigated its potential molecular mechanisms underlying congenital cataracts. We compared the protein structure and stability of purified the wild type (WT) and R10P under physiological conditions and environmental stresses (UV irradiation, pH imbalance, heat shock, and chemical denaturation) using spectroscopic experiments, SEC analysis, and the UNcle protein analysis system. The results demonstrate that γA-R10P has no significant impact on the structure of γA-crystallin on normal condition. However, it is more sensitive to UV irradiation at high concentrations and prone to aggregation at high temperatures. Therefore, our study reveals the crucial role of the conserved site mutation R10P in maintaining protein structure and stability, providing new insights into the mechanisms of cataract formation.

A novel variant in the keratin 12 gene in a four-generation Chinese family with high myopia.

High myopia is a major cause of visual impairment, and genetic factors play crucial roles in the pathogenesis. We performed this study to identify candidate genes for the development of high myopia in a four-generation Chinese family with myopia. All family members with myopia and 100 healthy participants were included in this study. Data were obtained on demographics, disease history, and ocular examination results. We performed whole exome sequencing of the genomic DNA and Sanger sequencing to verify the variants. Functional analyses of the variant were performed using software programmes. Nine of thirteen family members were found to have high myopia, amongst which two members were also diagnosed keratoconus. A missense variant in the keratin 12 gene (KRT12, p.Val410Gly) was detected in all high myopia cases but not in other family members without high myopia or the controls. The variant was predicted to be benign by online software programmes. However, modelling of the three-dimensional structure of the protein clearly revealed conformational changes caused by the mutation. A missense mutation in the KRT12 gene was identified in this Chinese family, which may be associated with the pathogenesis of high myopia.

Abnormal function of EPHA2/p.R957P mutant in congenital cataract.

To identify genetic defects in a Chinese family with congenital posterior polar cataracts and assess the pathogenicity. A four-generation Chinese family affected with autosomal dominant congenital cataract was recruited. Nineteen individuals took part in this study including 5 affected and 14 unaffected individuals. Sanger sequencing targeted hot-spot regions of 27 congenital cataract-causing genes for variant discovery. The pathogenicity of the variant was evaluated by the guidelines of American College of Medical Genetics and InterVar software. Confocal microscopy was applied to detect the subcellular localization of fluorescence-labeled ephrin type-A receptor 2 (EPHA2). Co-immunoprecipitation assay was implemented to estimate the interaction between EphA2 and other lens membrane proteins. The mRNA and protein expression were analyzed by reverse transcription-polymerase chain reaction (qRT-PCR) and Western blotting assay, respectively. The cell migration was analyzed by wound healing assay. Zebrafish model was generated by ectopic expression of human EPHA2/p.R957P mutant to demonstrate whether the mutant could cause lens opacity in vivo. A novel missense and pathogenic variant c.2870G>C was identified in the sterile alpha motif (SAM) domain of EPHA2. Functional studies demonstrated the variant's impact: reduced EPHA2 protein expression, altered subcellular localization, and disrupted interactions with other lens membrane proteins. This mutant notably enhanced human lens epithelial cell migration, and induced a central cloudy region and roughness in zebrafish lenses with ectopic expression of human EPHA2/p.R957P mutant under differential interference contrast (DIC) optics. Novel pathogenic c.2870G>C variant of EPHA2 in a Chinese congenital cataract family contributes to disease pathogenesis.

Variant in EZR leads to defects in lens development

ABSTRACT Background Congenital cataract is a common cause of blindness. Genetic factors always play important role. Material and Methods This study identified a novel missense variant (c.1412C>T (p.P471L)) in the EZR gene in a four-generation Chinese family with nuclear cataract by linkage analysis and whole-exome sequencing. A knockout study in zebrafish using transcription activator-like effector nucleases was carried out to gain insight into candidate gene function. Results Conservative and functional prediction suggests that the P-to-L substitution may impair the function of the human ezrin protein. Histology showed developmental delays in the ezrin-mutated zebrafish, manifesting as multilayered lens epithelial cells. Immunohistochemistry revealed abnormal proliferation patterns in mutant fish. Conclusions The study suggests that ezrin may be involved in the enucleation and differentiation of lens epithelial cells.

A novel intronic TCOF1 pathogenic variant in a Chinese family with Treacher Collins syndrome

BackgroundTreacher Collins syndrome (TCS; OMIM 154500) is a craniofacial developmental disorder.MethodsTo investigate the genetic features of a four-generation Chinese family with TCS, clinical examinations, hearing tests, computed tomography, whole-exome sequencing (WES), Sanger sequencing, reverse transcription (RT)-PCR, and the Minigene assay were performed.ResultsThe probands, an 11-year-old male and his cousin exhibited typical clinical manifestations of TCS including conductive hearing loss, downward slanting palpebral fissures, and mandibular hypoplasia. Computed tomography revealed bilateral fusion of the anterior and posterior stapedial crura and malformation of the long crura of the incus. WES of both patients revealed a novel heterozygous intronic variant, i.e., c.4342 + 5_4342 + 8delGTGA (NM_001371623.1) in TCOF1. Minigene expression analysis revealed that the c.4342 + 5_4342 + 8delGTGA variant in TCOF1 caused a partial deletion of exon 24 (c.4115_4342del: p.Gly1373_Arg1448del), which was predicted to yield a truncated protein. The deletion was further confirmed via RT-PCR and sequencing of DNA from proband blood cells. A heterozygous variant in the POLR1C gene (NM_203290; exon6; c.525delG) was found almost co-segregated with the TCOF1 pathogenic variant.ConclusionsIn conclusion, we identified a heterozygous TCOF1 splicing variant c.4342 + 5_4342 + 8delGTGA (splicing) in a Chinese TSC family with ossicular chain malformations and facial anomalies. Our findings broadened the spectrum of TCS variants and will facilitate diagnostics and prognostic predictions.

Genetic investigation in a four-generation Chinese family with congenital fibrosis of extraocular muscles and keratoconus

Here, we have reported the genetic and clinical characteristics of four generations of a family patient from China with congenital fibrosis of extraocular muscles 1 (CFEOM1) and keratoconus (KC). The history of diseases, clinical observations, and blood samples of all family members were collected. A total of 100 healthy participants were recruited as normal controls. The whole exome sequencing of the genomic DNA and polymerase chain reaction were performed on samples obtained from the controls and their family members to verify the gene variants. The functional analyses of the variants were performed by using different software. Two single nucleotide polymorphisms were detected in the proband and other patients in his families, including a heterozygous missense variation, g.39726207C > T (c.2860C > T, p.R954W, rs121912585), in the third highly conserved coiled-coil domain of KIF21A, and a heterozygous missense variant, g.30664732A > C (c.136A > C, p.S46R, rs200111443) in TGFBR2. The variant p.R954W in KIF21A was predicted to be pathogenic using software, whereas p.S46R in TGFBR2 was predicted to be of uncertain significance (VUS). Thus, KC might have occurred in the proband and his daughter because of a combination of genetic mutations and involuntary eye rubbing induced by CFEOM1. This is the first case of concomitant KC in a family having CFEOM1. Thus, the study provides new information about patients with KC having CFEOM1. Furthermore, the study suggests that attention should be paid to the early detection and diagnosis of KC in patients with CFEOM1.

A dominant variant in apoptosis-related gene XKR8 is relevant to hereditary auditory neuropathy

BackgroundAuditory neuropathy is an unusual type of hearing loss. At least 40% of patients with this disease have underlying genetic causes. However, in many hereditary auditory neuropathy cases, etiology remains undetermined.MethodsWe collected data and blood samples from a four-generation Chinese family. After excluding relevant variants in known deafness-related genes, exome sequencing was conducted. Candidate genes were verified by pedigree segregation, transcript/protein expression in the mouse cochlea, and plasmid expression studies in HEK 293T cells. Moreover, a mutant mouse model was generated and underwent hearing evaluations; protein localization in the inner ear was also assessed.ResultsThe clinical features of the family were diagnosed as auditory neuropathy. A novel variant c.710G > A (p.W237X) in apoptosis-related gene XKR8 was identified. Genotyping of 16 family members confirmed the segregation of this variant with the deafness phenotype. Both XKR8 mRNA and XKR8 protein were expressed in the mouse inner ear, predominantly in regions of spiral ganglion neurons; Moreover, this nonsense variant impaired the surface localization of XKR8 in cells. Transgenic mutant mice exhibited late-onset auditory neuropathy, and their altered XKR8 protein localization in the inner ear confirmed the damaging effects of this variant.ConclusionsWe identified a variant in the XKR8 gene that is relevant to auditory neuropathy. The essential role of XKR8 in inner ear development and neural homeostasis should be explored.

A Novel PAX6 Frameshift Mutation Identified in a Large Chinese Family with Congenital Aniridia

Congenital aniridia is a rare autosomal dominant congenital ocular disorder. Genetic studies suggest that heterozygous mutations in the developmental regulator PAX6 gene or the related regulatory regions leading to haploinsufficiency are the main cause of congenital aniridia. In this study, the clinical characteristics and pathogenic mutation of a four-generation Chinese family with congenital aniridia were investigated. All members recruited in this study underwent comprehensive ophthalmic examinations. Targeted gene capture sequencing and Sanger sequencing were performed to screen and confirm the candidate pathogenicity gene and its mutation. A multiple alignment of homologous sequences covering the identified mutation from different species was investigated, and the mutant protein structure was predicted using Swiss-Model. Additionally, the prediction of pathogenicity was analyzed using the ACMG Guidelines. Thirteen patients in this pedigree were diagnosed with congenital aniridia. A novel heterozygous frameshift mutation (c.391_398dupATACCAAG, p.Ser133Argfs*8) in exon 7 of the PAX6 gene was identified in all affected individuals in the family. This study demonstrates that this frameshift mutation of the PAX6 gene might be the causative genetic defect of congenital aniridia in this family. This mutation is predicted to cause the premature truncation of the PAX6 protein, leading to the functional haploinsufficiency of PAX6, which may be the major molecular mechanism underlying the aniridia phenotype. To the best of our knowledge, this is the first report of a novel pathogenic PAX6 gene variant c.391_398dupATACCAAG(p.Ser133Argfs*8) identified in a Chinese family with congenital aniridia.

Identification and functional characterization of a novel truncating splicing variant in COL4A5 gene causes X-linked Alport syndrome with astigmatism.

Identification and functional characterization of a novel truncating splicing variant in COL4A5 gene causes X-linked Alport syndrome with astigmatism.

A novel Nance-Horan syndrome mutation identified by next-generation sequencing in a Chinese family

To identify the disease-causing mutation in a four-generation Chinese family diagnosed with Nance-Horan syndrome (NHS). A Chinese family, including four affected patients and four healthy siblings, was recruited. All family members received ophthalmic examinations with medical histories provided. Targeted next-generation sequencing approach was conducted on the two affected males to screen for their disease-causing mutations. Two male family members diagnosed with NHS manifested bilateral congenital cataracts microcornea, strabismus and subtle facial and dental abnormalities, while female carriers presented posterior Y-sutural cataracts. A novel frameshift mutation (c.3916_3919del) in the NHS gene was identified. This deletion was predicted to alter the reading frame and generate a premature termination codon after a new reading frame. The study discovers a new frameshift mutation in a Chinese family with NHS. The findings broaden the spectrum of NHS mutations that can cause NHS in Chinese patients.

Identification of a novel CNV at the EYA4 gene in a Chinese family with autosomal dominant nonsyndromic hearing loss

BackgroundHereditary hearing loss is a heterogeneous class of disorders that exhibits various patterns of inheritance and involves many genes. Variants in the EYA4 gene in DFNA10 are known to lead to postlingual, progressive, autosomal dominant nonsyndromic hereditary hearing loss.Patients and methodsWe collected a four-generation Chinese family with autosomal-dominant nonsyndromic hearing loss (ADNSHL). We applied targeted next-generation sequencing (TNGS) in three patients of this pedigree and whole-genome sequencing (WGS) in the proband. The intrafamilial cosegregation of the variant and the deafness phenotype were confirmed by PCR, gap-PCR and Sanger sequencing.ResultsA novel CNV deletion at 6q23 in exons 8–11 of the EYA4 gene with a 10 bp insertion was identified by TNGS and WGS and segregated with the ADNSHL phenotypes.ConclusionsOur results expanded the variant spectrum and genotype‒phenotype correlation of the EYA4 gene and autosomal dominant nonsyndromic hereditary hearing loss in Chinese Han individuals. WGS is an accurate and effective method for verifying the genomic features of CNVs.

A novel variation in RANBP2 associated with infection-triggered familial acute necrotizing encephalopathy

Acute necrotizing encephalopathy (ANE) is a rapidly progressive encephalopathy occurring in otherwise healthy children after common viral infections. The condition presents as a spectrum of symptoms ranging from infections to seizures and coma, with the potential to cause long-term neurocognitive impairment or death. Familial and recurrent ANE is referred to as ANE1. A four-generation Chinese family with ANE1 was recruited for genetic analysis. A novel missense variation, c.9041A > G, p.(Glu3014Gly) in RANBP2 was identified in this family. This study is the first to identify a novel variation in RANBP2 in a Chinese family with ANE1.

A novel gene ZNF862 causes hereditary gingival fibromatosis.

Hereditary gingival fibromatosis (HGF) is the most common genetic form of gingival fibromatosis which is featured as a localized or generalized overgrowth of gingivae. Currently two genes (SOS1 and REST), as well as four loci (2p22.1, 2p23.3-p22.3, 5q13-q22, and 11p15), have been identified as associated with HGF in a dominant inheritance pattern. Here, we report 13 individuals with autosomal-dominant HGF from a four-generation Chinese family. Whole-exome sequencing followed by further genetic co-segregation analysis was performed for the family members across three generations. A novel heterozygous missense mutation (c.2812G > A) in zinc finger protein 862 gene (ZNF862) was identified, and it is absent among the population as per the Genome Aggregation Database. The functional study supports a biological role of ZNF862 for increasing the profibrotic factors particularly COL1A1 synthesis and hence resulting in HGF. Here, for the first time we identify the physiological role of ZNF862 for the association with the HGF.

Clinical and Functional Characterization of a Novel Mutation in AVPR2 Causing Nephrogenic Diabetes Insipidus in a Four-Generation Chinese Family.

Background: Congenital nephrogenic diabetes insipidus (CNDI) is a rare inherited disease that is caused by mutations in arginine vasopressin receptor 2 (AVPR2) or aquaporin 2 (AQP2). Functional analysis of the mutated receptor is necessary to verify the impact of the mutation on receptor function and suggest some possible therapeutic strategies for specific functional defects.Methods: Family history and clinical information were collected. Whole-exome sequencing and sanger sequencing were performed to determine the potential genetic cause of diabetes insipidus. The identified variant was classified according to the American College of Medical Genetics (ACMG) criteria. Bioinformatic analysis was performed to predict the function of the identified variation. Moreover, wild-type and mutated AVPR2 vectors were constructed and transfection to HEK-293T cells. Immunofluorescence experiments were performed to investigate the expression and localization of the mutated protein and cAMP parameter assays were used to measure its activity in response to AVP.Results: The heights of the adult members affected with polyuria and polydipsia were normal, but all affected children had growth retardation. Next-generation sequencing identified a novel mutation in AVPR2 gene (c.530T > A) in this family. Bioinformatic analysis indicated that the mutation in AVPR2 changed the hydropathic characteristic of the protein and was probably deleterious. Although immunofluorescence showed that the mutated AVPR2 was normally expressed in the cell surface, the intracellular cAMP concentration stimulated by AVP was significantly lower in cells transfected with mutated AVPR2 than cells transfected with wild-type AVPR2. Based on the ACMG criteria, the novel c.530T > A variant of the AVPR2 gene was likely pathogenic and the affected family members were diagnosed as CNDI. After the confirmation of the diagnosis, the proband was treated with compound amiloride hydrochloride and rhGH, the symptoms of polyuria, polydipsia and growth retardation were all improved.Conclusion: These findings suggested that the novel mutation in AVPR2 (c.530T > A) was a true disease-causing variant with mild effects, which could be classified as a type III mutant receptor. Moreover, investigations of the function of growth hormone axis could be important for the pediatric CNDI patients with extreme short stature, and rhGH treatment might improve the final adult heights in these patients.

Whole-exome sequencing identification of a recurrent CRYBB2 variant in a four-generation Chinese family with congenital nuclear cataracts.

Congenital cataracts is the most common cause of visual impairment and blindness in children. Although there have been extensive studies into the pathogenesis of congenital cataracts, the pathogenic mechanism underlying the recurrent variant CRYBB2:c.62T>A(p.I21N) has not been previously reported. Thus, the present study aimed to use whole-exome sequencing (WES) to identify potential genetic variants and investigate how they may have induced the occurrence of cataracts in a four-generation Chinese family with congenital nuclear cataracts. The medical history of this family was recorded and WES was conducted for one proband. Sanger sequencing was used to verify the presence of the putative variant in all participants. PolyPhen-2, SIFT and ProtScale were used to analyze the effect of the identified variants on protein function and hydrophobicity, and Pymol was used to show the structure of the wild-type (Wt) and mutant β-crystallin B2 (CRYBB2) protein. Full-length Wt-CRYBB2 or mutant-CRYBB2 (I21N-CRYBB2) were fused to green fluorescent protein (GFP), and the recombinant plasmids were transfected into HeLa cells. Reverse transcription-quantitative PCR and western blotting were used to detect the expression levels of CRYBB2 mRNA and protein. Immunofluorescence and flow cytometry analyses were used to detect protein localization and apoptosis, respectively. A recurrent variant CRYBB2:c.62T>A(p.I21N) was identified in a four-generation Chinese family with congenital nuclear cataracts. Multiple-sequence alignment of CRYBB2 demonstrated that codon 21 was highly conserved. Pymol revealed that the structure of the I21N-CRYBB2 protein was distinct from that of Wt-CRYBB2. PolyPhen-2 predicted that it had a variant provean score 1.0, suggesting it was ‘probably damaging’, and SIFT predicted it had a variant provean score of -5.113, indicating it was ‘deleterious’. ProtScale indicated that the hydrophobicity of the mutation site was significantly reduced. The protein expression levels of the I21N-CRYBB2 were decreased compared with the Wt-CRYBB2. Immunofluorescence analysis revealed that the variant I21N-CRYBB2 protein tended to accumulate around the nucleus, and flow cytometry analysis indicated that it increased cell apoptosis. Furthermore, I21N-CRYBB2 induced the activation of the unfolded protein response (UPR). In conclusion, a pathogenic variant of CRYBB2:c.62T>A(p.I21N) was identified via WES in a four-generation Chinese family with congenital nuclear cataracts. Through biological analysis, it was found that the variant induced abnormal protein aggregation, activated the UPR and triggered excessive cell apoptosis, which may lead to the occurrence of congenital nuclear cataracts in this family.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

A novel missense mutation in SMPX causes a rare form of X-linked postlingual sensorineural hearing loss in a Chinese family.

BackgroundX-linked deafness-4 (DFNX4) caused by the functional loss of the SMPX gene is one form of nonsyndromic hearing loss with postlingual onset. This study aimed to investigate the cause of X-linked inherited sensorineural nonsyndromic hearing loss in a four-generation Chinese family and to explain the reason for extremely different hearing phenotypes between the proband and other family members.MethodsWhole-exome sequencing (WES) and co-segregation analysis were used to identify the pathogenic variants. Furthermore, methylation differences among the androgen receptor genes were utilized to investigate whether the severe phenotype of the proband is related to X-chromosome inactivation (Xi).ResultsWe described in detail the clinical characteristics of the family and identified a novel missense mutation (c.262C>G: p.Gln88Glu) in SMPX by WES. This variant was co-segregated with the postlingual hearing loss phenotype and was absent in 300 normal controls. Also, we found that the proband, a 4-year-old female, carries two new compound heterozygous mutations (c.9259G>A: p.Val3087Ile and c.8576G>A: p.Arg2859His) in the USH2A gene, but to date without any other symptoms except profound sensorineural hearing loss. Additionally, analysis of X-chromosome inactivation indicated moderate skewing in the proband, which is probably related to the heterogeneity of clinical characteristics.ConclusionsThis is the first study to report a missense mutation of SMPX in a Chinese family. Our findings have enriched the mutation and phenotypic spectrum of the SMPX gene.

Identification and functional analysis of a novel missense mutation in GJA8, p.Ala69Thr

BackgroundTo explore the molecular genetic cause of a four-generation autosomal dominant congenital cataract family in China.MethodsTargeted region sequencing was performed to screen for the potential mutation, and Sanger sequencing was used to confirm the mutation. The homology model was constructed to identify the protein structural change, PolyPhen-2 and Provean were used to predict the mutation impact. Functional and cellular analysis of the wild and mutant GJA8 were performed in DF-1 cells by western blotting, dye uptake assay, immunofluorescence, Annexin V-FITC staining.ResultsA novel heterozygous mutation (c.205G > A; p.Ala69Thr) was identified within GJA8, which cosegregated with congenital cataract phenotype in this family. Bioinformatics analysis showed the mutation was located in a highly conserved region, and the mutation was predicted to be pathogenic. Function analysis indicated that the mutation inhibited GJA8 hemichannel activity, reduced cell tolerance to oxidative stress, changed the protein distribution pattern and inhibited the cell growth.ConclusionsWe have identified a novel missense mutation in GJA8 (c.205G > A, p.Ala69Thr) in a four-generation Chinese family and our results will further broaden the gene mutation spectrum of GJA8.

A novel mutation of LIM2 causes autosomal dominant membranous cataract in a Chinese family.

To identify mutations in the genes of a four-generation Chinese family with congenital membranous cataracts and investigate the morphologic changes and possible functional damage underlying the role of the mutant gene. Whole exome analysis of thirteen members of a four-generation pedigree affected with congenital membranous cataracts was performed; co-segregation analysis of identified variants was validated by Sanger sequencing. All members underwent detailed physical and complete eye examinations. The physical changes caused by the mutation were analyzed in silico through homology modeling. The lens fiber block from a patient was observed under a scanning electron microscope (SEM). Cell membrane proteins and cytoplasmic proteins from the human lenses donated by one patient with cataract in this family and from the dislocated lens resulted from the penetrating ocular trauma of a patient unrelated with this family were extracted, and the expression and localization of MP20 and Cx46 were detected by Western blot (WB) assay in these proteins. A novel LIM2 heterozygous mutation (c.388C>T, p.R130C) was identified with congenital membranous cataracts inherited by an autosomal dominant (AD) pattern. Nystagmus and amblyopia were observed in all patients of this family, and exotropia and long axial length were observed in most patients. A/B ultrasound scan and ultrasound biomicroscopy revealed obvious thin crystalline lenses from 1.7 to 2.7 mm in central thickness in all cataract eyes. The bioinformatic analysis showed that the mutation was deleterious to the physiological function of LIM2-encoded MP20. Furthermore, by SEM, ultrastructure of the cataract nucleus showed that lens fiber cells (LFCs) remained morphologic characteristics of immature fiber cells, including flap cell surface with straight edges and lacking normal ball-and-socket joint boundaries, which implied that the differentiation of LFCs might be inhibited. Accumulation of MP20 and Cx46 in the cytoplasm was observed in the cytoplasm of the LFCs in human cataract lens. We identify a novel heterozygous LIM2 (c.388C>T, p.R130C) mutation inherited by an AD pattern. This LIM2 mutation causes the abnormal sub-localization of MP20 and Cx46 in LFCs resulting in membranous cataracts.