Formation Of Nucleotides Research Articles

One-pot synthesis of non-canonical ribonucleosides and their precursors from aldehydes and ammonia under prebiotic Earth conditions

The formation of polymers that can hold gene information and work as catalysts is a crucial step for the origin of life. The discovery of catalytic RNA (i.e., ribozyme) supports the hypothesis that RNA might have served these functions at the early stage of life on the Earth. Given this, the spontaneous formation of RNA monomers (i.e., ribonucleotides) and their polymerization on Hadean Earth are essential steps for the origin of life. Previous experiments have investigated the chemical reactions that allow the formation of ribonucleotides and their components. These works have revealed the required molecules to form biological ribonucleotides (i.e., canonical ribonucleotides). Based on geochemical perspectives, abundantly available reactive molecules spontaneously react with each other to provide abundant products. Aldehydes and ammonia are reactive molecules assumed to have been present in considerable amounts on Hadean Earth. However, little is understood about whether or not nucleotides and their components were formed from these molecules under prebiotic conditions. We investigated the incubation products of alkaline aqueous solutions of aldehydes and ammonia. The product solution contained sugars (including ribose), various imidazole derivatives, and ribosyl imidazole (i.e., imidazole ribonucleoside). Ribosyl imidazole is formed via ribosyl amine, which reveals a new reaction pathway for prebiotic ribonucleoside synthesis. The imidazole ribonucleoside was then phosphorylated to imidazole ribonucleotide via a simple dry-down reaction with phosphate. Borate ion improved the reaction yields of these nucleosides and nucleotides. Because all the reactants were available on prebiotic Earth and the reactions progressed spontaneously, imidazole ribonucleotides could have accumulated in prebiotic environments. The experimental simplicity of the present reaction suggests that imidazoles were more abundant than canonical nucleobases on the prebiotic Earth. This further implies that prebiotic oligonucleotides contained imidazole bases in addition to the canonical nucleobases. The improvement of the reaction yields by borate indicates that borate-rich environments were conducive places for the formation and accumulation of non-canonical nucleosides and nucleotides. Such environments could have facilitated the formation of primordial ribonucleic acids on Hadean Earth.

RETRACTION: Shrinkable Nanotubes for Duplex Formation of Short Nucleotides.

N. Kameta, H. Akiyama, "Shrinkable Nanotubes for Duplex Formation of Short Nucleotides," Small 14, no. 34 (2018): 1801967, https://doi.org/10.1002/smll.201801967. The above article, published online on 18 July 2018 in Wiley Online Library (wileyonlinelibrary.com), has been retracted by agreement between the authors, Naohiro Kameta and Haruhisa Akiyama; the journal Editor-in-Chief, Neville Compton; and Wiley-VCH GmbH, Weinheim. The retraction has been agreed upon following an investigation into concerns raised by National Institute of Advanced Industrial Science and Technology (AIST), and also requested by all authors due to image falsification in electron microscopy images. The TEM images of Figures 2a and 2c, and SEM images of Figures S1a and S1b (Supporting Information), where the first author falsificated incorrect scale bars; all affecting the interpretation of the data and research results presented.

Light-Assisted Formation of Nucleosides and Nucleotides from Formamide in the Presence of Cerium Phosphate.

The abiotic formation of nucleotides from small, simple molecules is of large interest in the context of elucidating the origin of life scenario. In what follows, it is shown that nucleosides and nucleotides can be formed from formamide in a one-pot reaction utilizing the mineral cerium phosphate (CePO4) as a photocatalyst, a catalyst and a reactant that supplies the necessary phosphate groups. While the most abundant RNA/DNA building blocks were thymidine and thymidine monophosphate, considerable yields of other building blocks such as cytidine, cytidine monophosphate, and adenosine cyclic monophosphate were found. Comparing the yield of nucleosides and nucleotides under light conditions to that in the dark suggests that in the presence of cerium phosphate, light promotes the formation of nucleobases, whereas the formation of nucleotides from nucleosides take place even in the absence of light. The scenario described herein is considerably simpler than other scenarios involving several steps and several reactants. Therefore, by virtue of the principle of Occam's razor, it should be of large interest for the community.

Effect of microwave combined with ultrasonic pretreatment on the flavor of composite stewed soup‐stock

AbstractIn order to increase the content of flavoring components and nutrients in the stock, effects of microwave (MW) combined with ultrasonic pretreatment on water‐soluble proteins, flavor nucleotides, volatile gas constituents and sensory evaluation in the stewed stock were explored. The results showed that, compared with the control group (CK), MW, and ultrasonic (US) pretreatment could significantly promote the degradation of nucleotides and form a large number of 5′‐flavor nucleotides. The combined treatment of MW and US promoted protein hydrolysis and increased the content of water‐soluble protein. The microwave combined ultrasonication pretreated stew stock had the brightest color and the overall sensory score was better than that of the CK. In addition, GC–MS analysis showed that a total of 49 volatile substances were detected in the stock samples. After microwave combined ultrasonication pretreatment, the relative contents of aldehydes and alcohols in the stock increased significantly. The sensor response value of the electronic nose was the highest, indicating that the intensity of flavor characteristics increased. Therefore, MW combined with ultrasonic pretreatment can effectively promote the formation and dissolution of nutrients, and increase the content of flavorful nucleotides and volatile gases.Practical applicationThis study provides a novel processing method for traditional stewed stock. Ultrasonic combined with MW treatment can quickly degrade the protein in the raw material and dissolve it into the stock. At the same time, it promotes the formation of flavor nucleotides and accelerates the Maillard reaction to produce more flavor substances. The technology has the advantages of short processing time, environmental protection and safety. It can be used as a potential pretreatment technology to regulate the flavor of stock‐soup.

A Prebiotic Genetic Nucleotide as an Early Darwinian Ancestor for Pre-RNA Evolution.

Prebiotic genetic nucleotides (PGNs) often outcompete canonical alphabets in the formation of nucleotides and subsequent RNA oligomerization under early Earth conditions. This indicates that the early genetic code might have been dominated by pre-RNA that contained PGNs for information transfer and catalysis. Despite this, deciphering pre-RNAs' capacity to acquire function and delineating their evolutionary transition to a canonical RNA World has remained under-researched in the origins of life (OoL) field. We report the synthesis of a prebiotically relevant nucleotide (BaTP) containing the noncanonical nucleobase barbituric acid. We demonstrate the first instance of its enzymatic incorporation into an RNA, using a T7 RNA polymerase. BaTP's incorporation into baby spinach aptamer allowed it to retain its overall secondary structure and function. Finally, we also demonstrate faithful transfer of information from the pre-RNA-containing BaTP to DNA, using a high-fidelity RNA-dependent DNA polymerase, alluding to how selection pressures and complexities could have ensued during the molecular evolution of the early genetic code.

Comparative Analysis of Bioelectrocatalytic Cytochrome P450 3A4 Systems

This article describes the approaches developed by the authors with the aim to increase the efficiency of electro enzymatic reactions catalyzed by cytochrome P450 3A4. A comparative analysis of cytochrome P450 3A4 systems was carried out during the formation of the functional complexes hemoprotein-flavin nucleotides as low-molecular models of NAD(P)H-dependent cytochrome P450 reductase. The formation of a productive enzyme-substrate complex before the stage ofaccepting electrons from the modified electrode was studied from the electocatalytic viewpoint. Incorporation of the enzyme into nanopores of different nature on the electrode (2D-3D transition) was also studied. The results on the electrochemical reduction of bactosomes as the functionally active models of the microsomal monooxygenase system are also considered. The electrochemical and electrocatalytic parameters of cytochrome P450 3A4 were compared for different models of the electrocatalytic generation of metabolites.

Metabolomic Profiling Confirms the Key Role of Oxidative Stress in the Pathophysiology of Diamond-Blackfan Anemia

Diamond-Blackfan anemia (DBA), a rare congenital bone marrow failure syndrome, characterized by severe anemia, erythroblastopenia, and congenital malformations is mostly associated with pathogenic variants in ribosomal protein (RP) genes, which cause their haploinsufficiency. The marked heterogeneity of the disease, related to different severity of hematological and non-hematological symptoms and diverse response to treatment, even in patients harboring the same RP mutation is not fully understood. Similarly, the mechanisms responsible for the predisposition of DBA patients to cancer await elucidation. We previously showed that the formation of reactive oxygen species (ROS) exceeds the anti-oxidant capacity of DBA erythrocytes leading to their higher susceptibility to destruction. Using DBA patients' samples and CRISPR/Cas9-created Rps19- and Rpl5-haploinsufficient MEL cellular models we also showed, that excessive oxidative stress, DNA damage, and activation of DNA damage response of erythroblasts is associated with an increased production of pro-/inflammatory cytokines and induction of apoptosis and senescence. In recent years, the use of metabolomic analysis appears as a promising tool that could contribute to a better understanding of the pathophysiology of the disease and discovery of novel biochemical markers with their potential use in diagnostics and prognostication. We therefore performed targeted metabolomic analysis of serum and erythrocyte samples from DBA patients (n=26) and healthy controls (n=10) using hydrophilic interaction chromatography-mass spectrometry (HILIC-MS) where 129 metabolites were detected. Significant changes in the metabolome of DBA patients were observed, with the key deregulated metabolites involved in the antioxidant defense and energy metabolism; the reduction of amine compounds (creatinine, guanidinoacetate) and hippurate in DBA patients compared to controls was also noted. In two DBA families analyzed, the altered erythrocyte metabolism and markers of oxidative stress distinguished the patients from their asymptomatic family members with the same RP mutation. The incubation of erythrocytes from symptomatic DBA patients with antioxidant N-acetylcysteine in vitro led to normalization of ROS levels in erythrocytes. Similarly, the treatment of Rpl5- and Rps19-haploinsufficienct MEL cells with a pro-inflammatory cytokine inhibitor pomalidomide, resulted in the amelioration of oxidative DNA damage (assessed by the presence of 8-oxoguanine, 8-oxoG) and reduction of p53 activation. In addition, targeted metabolomic analysis of cellular extracts showed clear separation of Rps19- and Rpl5-haploinsufficient MEL cells from control cells with significant changes affecting the level of many carbohydrates and acylcarnitines. Elevated levels of glutathione and pentose phosphate cycle intermediates in Rps19- and Rpl5-haploinsufficient MEL cells correspond with their need to cope with increased oxidative stress. Significantly increased levels of deoxynucleotides, mainly in Rpl5-haploinsufficient MEL cells, could be related to DNA damage response (DDR) process to promote repair of ROS-mediated damaged DNA. Nucleotide formation is an energy intensive process and therefore the observed decrease in acylcarnitines could be related to increased beta oxidation and increased formation of reduced coenzymes. This result from model MEL cells is consistent with 8-oxoG foci and activation of ATM (a DDR kinase) observed in erythroblasts of DBA patients expanded in vitro. Importantly, immunoreactivity for 8-oxoG and phospho-ATM S1981 was detected also in non-erythroid bone marrow cells of two DBA patients, who recently developed myelodysplastic neoplasia (MDS). Collectively, our data support the involvement of oxidative stress and pro-/inflammatory cytokines in the pathophysiology of DBA and suggest that the treatment aiming to reduce oxidative stress and/or suppress inflammation could alleviate the severity of the disease, though additional studies are needed. The potential link between oxidative damage, inflammatory cytokines, and cancer risk in DBA also deserves further research. Grant support: The Ministry of Education, Youth and Sports of the Czech Republic (8F20005), European Union - Next Generation EU, Program EXCELES (LX22NPO5102); Internal grant of Palacky University (IGA_LF_2023_002).

Phytochemical and biological characterization of aqueous extract of Vassobia breviflora on proliferation and viability of melanoma cells: involvement of purinergic pathway

ABSTRACT Vassobia breviflora belongs to the Solanaceae family, possessing biological activity against tumor cells and is a promising alternative for therapy. The aim of this investigation was to determine the phytochemical properties V. breviflora using ESI-ToF-MS. The cytotoxic effects of this extract were examined in B16-F10 melanoma cells and the relationship if any to purinergic signaling was involved. The antioxidant activity of total phenols, (2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS) was analyzed, as well as production of reactive oxygen species (ROS) and nitric oxide (NO) was determined. Genotoxicity was assessed by DNA damage assay. Subsequently, the structural bioactive compounds were docked against purinoceptors P2X7 and P2Y1 receptors. The bioactive compounds found in V. breviflora were N-methyl-(2S,4 R)-trans-4-hydroxy-L-proline, calystegine B, 12-O-benzoyl- tenacigenin A and bungoside B. In vitro cytotoxicity was demonstrated at concentration ranges of 0.1–10 mg/ml, and plasmid DNA breaks only at the concentration of 10 mg/ml. V. breviflora extracts affected hydrolysis by ectoenzymes, such as ectonucleoside triphosphate diphosphohydrolase (E-NTPDase) and ectoadenosine deaminase (E-ADA) which control levels of degradation and formation of nucleosides and nucleotides. In the presence of substrates ATP, ADP, AMP and adenosine, the activities of E-NTPDase, 5´-NT or E-ADA were significantly modulated by V. breviflora. N-methyl-(2S,4 R)-trans-4-hydroxy-L-proline presented higher binding affinity (according to receptor-ligand complex estimated binding affinity as evidenced by ∆G values) to bind to both P2X7 and P2Y1purinergic receptors. Our results suggest a putative interaction of V. breviflora bioactive compounds with growth inhibitory potential in B16-F10 melanoma and suggest that may be considered as promising compounds in melanoma and cancer treatment

CaCO3 Polymorphs as Mineral Catalysts for Prebiotic Phosphorylation of Uridine

AbstractEstablishing plausible routes for the abiotic formation of nucleotides is a challenging problem because the phosphorylation of organic molecules is thermodynamically unfavorable in water, and because common phosphorous‐containing minerals such as apatite are highly insoluble. Reactions of reduced phases such as the meteoritic mineral schreibersite with ammonia containing solutions can form stable amino‐derivatives of phosphates/phosphite, and carbonate‐rich lakes have been suggested as environments where phosphate species and organic molecules could accumulate in significant abundances, thus promoting an ideal environment for abiotic phosphorylation. This work reports the catalytic properties of three CaCO3 polymorphs—calcite, aragonite, and vaterite—on diamidophosphate (DAP)‐induced phosphorylation of the uridine nucleoside during a 24‐hr dry‐down reaction. It is shown that the phosphorylation reaction is accelerated in solutions containing CaCO3 compared to those with no mineral present. For un‐buffered solutions with no mineral present, the primary products formed are uridine monophosphates (UMPs), with yields making up 22.3 ± 3.9% of the total detected species, while solutions containing calcite and aragonite formed primarily UMP dimers (yields of 15.3 ± 1.1% and 14.8 ± 1.3%, respectively). Vaterite showed a strong preference for forming cyclic UMP (cUMP) (26.3 ± 0.3% yield), and no higher order polymers were observed using any carbonate mineral. Reactions containing CaSO4·2H2O (gypsum) showed a preference for forming cUMP, though not as strong as vaterite, while those containing CaCl2 (calcium chloride) and CaWO4 (scheelite) did not yield any phosphorylated products other than UMPs. These results suggest that CaCO3 minerals could have played an important role in facilitating prebiotic phosphorylation in aqueous environments that undergo drying cycles.

Effects of flash-boil shucking on biochemical, sensorial and ultrastructural properties of Yesso Scallop (Mizuhopecten yessoensis) adductor muscle during refrigeration

Abstract Scallop adductor muscle has great popularity for raw consumption in Japan, but conventionally shucking live scallops with high vitality by knife requires skill and is time-consuming. Flash-boil shucking is a convenient shucking method in sushi restaurants for live scallops. However, the effects of this treatment on the quality of its main edible part, the adductor muscle, are not clear. This study was conducted to investigate the impact of flash-boil shucking on the quality of raw-edible scallop adductor muscle, focusing on flavor-enhancing components and ultrastructure. Thermal treatment could contribute to the formation of flavor-enhancing nucleotides in the external layer of the adductor muscle. Adenosine monophosphate content increased with the boiling time, which significantly increased to 1.47±0.42 µmol/g in the 30 s-boiled group compared with 0.38±0.13 µmol/g in the control group (p<0.05). The rapid adenosine monophosphate accumulation after boiling resulted in a faster accumulation of inosine and hypoxanthine during subsequent refrigeration, which could bring bitterness to aquatic products. Flash-boil shucking had no discernible effect on the proportion of free amino acids relevant to the flavor of scallop adductor muscle, despite the possibility of a reduction in total free amino acids. The external layer of the scallop adductor muscle could be hardened after flash-boil shucking. At the ultrastructural level, muscle fibers tend to aggregate transversely and contract longitudinally depending on the heating time. Flash-boil shucking is ideal for consuming the raw-edible scallop adductor muscle promptly. Flash-boil shucking treatment is recommended for households, restaurants, and small factories for treating scallops with high vitality.

Genetic Diversity and Identification of MC1R SNPs Association with Colors in Iraqi Local Ducks

The aim of the study was to reveal the variation in the polymorphisms of Melancortin 1 receptor (MC1R) gene and relationship of SNP with colors in Iraqi local duck, in addition to identifying some of molecular characteristics of this gene and identifying the differences in the amino acids of MC1R gene and their differences between the white and gray local duck lines, two local duck lines were selected with 14 white and 14 gray birds, was chosen a region with size 515 bp MC1R gene, where designed the primer of; (Forward primer 5’-, GCTCTTCATGCTGCTGATGG -3, and Reverse primer 5’-, GGCAGGTGACGATGAGGATG -3) by relying on the reference copy under the accession number KU234624.1, the results with PCR technique and electrophoresis proved success of amplification process and fragment was 515 bp. After analyzing sequence of nitrogenous bases for the studied fragment for MC1R gene, two changes were observed in nitrogenous bases, which is known as single nucleotide formation (SNP). The two sites for studied fragment recorded with accession numbers for our study are LC480442.55G> A and LC480443.328C> T. It was observed that the first change site did not lead to any change in the amino acid (valine) at the 126th site of peptide chain of MC1R gene, while the second site resulted in an occurrence change in the amino acid arginine to cysteine at position 217 of peptide chain of the gene. The results showed, it was found that sites of changes in nitrogenous bases were found in both white and gray lines of local ducks, while the study did not show any correlation between these sites with the color of ducks. The results of some molecular tests of the MC1R gene showed that rate of change of nitrogenous bases and the genetic variation for studied frgament is very small when comparing the haplotypes and phylogenetic tree of the animals in this study, and the animals from other countries such as China, it was observed that local ducks possess same nucleotide sequence, which means possibility of dependence origin of local duck of Chinese ducks. The fragments obtained in this study for MC1R gene were recorded at global gene bank sites in NCBI, EMBL and DDBJ under independent accession numbers for our Iraqi local animals which LC480442, LC480443, LC480444, and LC480445.

The Coevolution of Biomolecules and Prebiotic Information Systems in the Origin of Life: A Visualization Model for Assembling the First Gene.

Prebiotic information systems exist in three forms: analog, hybrid, and digital. The Analog Information System (AIS), manifested early in abiogenesis, was expressed in the chiral selection, nucleotide formation, self-assembly, polymerization, encapsulation of polymers, and division of protocells. It created noncoding RNAs by polymerizing nucleotides that gave rise to the Hybrid Information System (HIS). The HIS employed different species of noncoding RNAs, such as ribozymes, pre-tRNA and tRNA, ribosomes, and functional enzymes, including bridge peptides, pre-aaRS, and aaRS (aminoacyl-tRNA synthetase). Some of these hybrid components build the translation machinery step-by-step. The HIS ushered in the Digital Information System (DIS), where tRNA molecules become molecular architects for designing mRNAs step-by-step, employing their two distinct genetic codes. First, they created codons of mRNA by the base pair interaction (anticodon–codon mapping). Secondly, each charged tRNA transferred its amino acid information to the corresponding codon (codon–amino acid mapping), facilitated by an aaRS enzyme. With the advent of encoded mRNA molecules, the first genes emerged before DNA. With the genetic memory residing in the digital sequences of mRNA, a mapping mechanism was developed between each codon and its cognate amino acid. As more and more codons ‘remembered’ their respective amino acids, this mapping system developed the genetic code in their memory bank. We compared three kinds of biological information systems with similar types of human-made computer systems.

Back Cover: Cofactor‐Driven Cascade Reactions Enable the Efficient Preparation of Sugar Nucleotides (Angew. Chem. Int. Ed. 20/2022)

Sugar nucleotides are essential glycosylation donors in carbohydrate metabolism. In their Research Article (e202115696), Liuqing Wen and co-workers developed a general strategy for the efficient preparation of rare sugar nucleotides. Complex de novo biosynthesis of rare sugar nucleotides was recognized as cascade reactions. The cascade reactions were driven toward the formation of the target sugar nucleotides through a cofactor regeneration system (CRS), thus resulting in clean conversion.

Stimuli-Responsive Nucleotide-Amino Acid Hybrid Supramolecular Hydrogels.

The ability to assemble chemically different gelator molecules into complex supramolecular hydrogels provides excellent opportunities to construct functional soft materials. Herein, we demonstrate the formation of hybrid nucleotide–amino acid supramolecular hydrogels. These are generated by the silver ion (Ag+)-triggered formation of silver–guanosine monophosphate (GMP) dimers, which undergo self-assembly through non-covalent interactions to produce nanofilaments. This process results in a concomitant pH reduction due to the abstraction of a proton from the guanine residue, which triggers the in situ gelation of a pH-sensitive amino acid, N-fluorenylmethyloxycarbonyl tyrosine (FY), to form nucleotide–amino acid hybrid hydrogels. Alterations in the supramolecular structures due to changes in the assembly process are observed, with the molar ratio of Ag:GMP:FY affecting the assembly kinetics, and the resulting supramolecular organisation and mechanical properties of the hydrogels. Higher Ag:GMP stoichiometries result in almost instantaneous gelation with non-orthogonal assembly of the gelators, while at lower molar ratios, orthogonal assembly is observed. Significantly, by increasing the pH as an external stimulus, nanofilaments comprising FY can be selectively disassembled from the hybrid hydrogels. Our results demonstrate a simple approach for the construction of multicomponent stimuli-responsive supramolecular hydrogels with adaptable network and mechanical properties.

The Incoherent Fluctuation of Folate Pools and Differential Regulation of Folate Enzymes Prioritize Nucleotide Supply in the Zebrafish Model Displaying Folate Deficiency-Induced Microphthalmia and Visual Defects.

ObjectiveCongenital eye diseases are multi-factorial and usually cannot be cured. Therefore, proper preventive strategy and understanding the pathomechanism underlying these diseases become important. Deficiency in folate, a water-soluble vitamin B, has been associated with microphthalmia, a congenital eye disease characterized by abnormally small and malformed eyes. However, the causal-link and the underlying mechanism between folate and microphthalmia remain incompletely understood.MethodsWe examined the eye size, optomotor response, intracellular folate distribution, and the expression of folate-requiring enzymes in zebrafish larvae displaying folate deficiency (FD) and ocular defects.ResultsFD caused microphthalmia and impeded visual ability in zebrafish larvae, which were rescued by folate and dNTP supplementation. Cell cycle analysis revealed cell accumulation at S-phase and sub-G1 phase. Decreased cell proliferation and increased apoptosis were found in FD larvae during embryogenesis in a developmental timing-specific manner. Lowered methylenetetrahydrofolate reductase (mthfr) expression and up-regulated methylenetetrahydrofolate dehydrogenase (NADP+-dependent)-1-like (mthfd1L) expression were found in FD larvae. Knocking-down mthfd1L expression worsened FD-induced ocular anomalies; whereas increasing mthfd1L expression provided a protective effect. 5-CH3-THF is the most sensitive folate pool, whose levels were the most significantly reduced in response to FD; whereas 10-CHO-THF levels were less affected. 5-CHO-THF is the most effective folate adduct for rescuing FD-induced microphthalmia and defective visual ability.ConclusionFD impeded nucleotides formation, impaired cell proliferation and differentiation, caused apoptosis and interfered active vitamin A production, contributing to ocular defects. The developmental timing-specific and incoherent fluctuation among folate adducts and increased expression of mthfd1L in response to FD reflect the context-dependent regulation of folate-mediated one-carbon metabolism, endowing the larvae to prioritize the essential biochemical pathways for supporting the continuous growth in response to folate depletion.

Control of pyrimidine nucleotide formation in Pseudomonas aurantiaca

The control of pyrimidine nucleotide formation in the bacterium Pseudomonas aurantiaca ATCC 33663 by pyrimidines was studied. The activities of the pyrimidine biosynthetic pathway enzymes were investigated in P. aurantiaca ATCC 33663 cells and from cells of an auxotroph lacking orotate phosphoribosyltransferase activity under selected culture conditions. All activities of the pyrimidine biosynthetic pathway enzymes in ATCC 33663 cells were depressed by uracil addition to the minimal medium when succinate served as the carbon source. In contrast, all pyrimidine biosynthetic pathway enzyme activities in ATCC 33663 cells were depressed by orotic acid supplementation to the minimal medium when glucose served as the carbon source. The orotidine 5'-monophosphate decarboxylase activity in the phosphoribosyltransferase mutant strain increased by more than sixfold in succinate-grown cells and by more than 16-fold in glucose-grown cells after pyrimidine limitation showing possible repression of the decarboxylase by a pyrimidine-related compound. Inhibition by ATP, GTP, UTP and pyrophosphate of the in vitro activity of aspartate transcarbamoylase in ATCC 33663 was observed. The findings demonstrated control at the level of pyrimidine biosynthetic enzyme synthesis and activity for the P. aurantiaca transcarbamoylase. The control of pyrimidine synthesis in P. aurantiaca seemed to differ from what has been observed previously for the regulation of pyrimidine biosynthesis in related Pseudomonas species. This investigation could prove helpful to future work studying pseudomonad taxonomic analysis as well as to those exploring antifungal and antimicrobial agents produced by P. aurantiaca.

The critical function of the plastid rRNA methyltransferase, CMAL, in ribosome biogenesis and plant development

Methylation of nucleotides in ribosomal RNAs (rRNAs) is a ubiquitous feature that occurs in all living organisms. The formation of methylated nucleotides is performed by a variety of RNA-methyltransferases. Chloroplasts of plant cells result from an endosymbiotic event and possess their own genome and ribosomes. However, enzymes responsible for rRNA methylation and the function of modified nucleotides in chloroplasts remain to be determined. Here, we identified an rRNA methyltransferase, CMAL (Chloroplast MraW-Like), in the Arabidopsis chloroplast and investigated its function. CMAL is the Arabidopsis ortholog of bacterial MraW/ RsmH proteins and accounts to the N4-methylation of C1352 in chloroplast 16S rRNA, indicating that CMAL orthologs and this methyl-modification nucleotide is conserved between bacteria and the endosymbiont-derived eukaryotic organelle. The knockout of CMAL in Arabidopsis impairs the chloroplast ribosome accumulation and accordingly reduced the efficiency of mRNA translation. Interestingly, the loss of CMAL leads not only to defects in chloroplast function, but also to abnormal leaf and root development and overall plant morphology. Further investigation showed that CMAL is involved in the plant development probably by modulating auxin derived signaling pathways. This study uncovered the important role of 16S rRNA methylation mediated by CMAL in chloroplast ribosome biogenesis and plant development.

Targeting Kinetoplastid and Apicomplexan Thymidylate Biosynthesis as an Antiprotozoal Strategy.

Kinetoplastid and apicomplexan parasites comprise a group of protozoans responsible for human diseases, with a serious impact on human health and the socioeconomic growth of developing countries. Chemotherapy is the main option to control these pathogenic organisms and nucleotide metabolism is considered a promising area for the provision of antimicrobial therapeutic targets. Impairment of thymidylate (dTMP) biosynthesis severely diminishes the viability of parasitic protozoa and the absence of enzymatic activities specifically involved in the formation of dTMP (e.g. dUTPase, thymidylate synthase, dihydrofolate reductase or thymidine kinase) results in decreased deoxythymidine triphosphate (dTTP) levels and the so-called thymineless death. In this process, the ratio of deoxyuridine triphosphate (dUTP) versus dTTP in the cellular nucleotide pool has a crucial role. A high dUTP/dTTP ratio leads to uracil misincorporation into DNA, the activation of DNA repair pathways, DNA fragmentation and eventually cell death. The essential character of dTMP synthesis has stimulated interest in the identification and development of drugs that specifically block the biochemical steps involved in thymine nucleotide formation. Here, we review the available literature in relation to drug discovery studies targeting thymidylate biosynthesis in kinetoplastid (genera Trypanosoma and Leishmania) and apicomplexan (Plasmodium spp and Toxoplasma gondii) protozoans. The most relevant findings concerning novel inhibitory molecules with antiparasitic activity against these human pathogens are presented herein.

Determination of Thiopurine S-methyltransferase Activity using Reverse-Phase High-Performance Liquid Chromatography Assay with Ultraviolet Detection: Reference Values for the Indian Population

Objective: To determine thiopurine S-methyltransferase (TPMT) activity and the range of TPMT activity values for the Indian population. Methods: An isocratic reversed-phase high-performance liquid chromatography method with ultraviolet detection for the determination of TPMT activity in red blood cells was developed and validated. TPMT activity (nmol of 6-methylmercaptopurine [6-MMP]/h/ml erythrocytes) was measured based on the conversion of 6-mercaptopurine to 6-MMP with S-adenosyl-l-methionine. The stability of erythrocyte lysate at −20°C and the whole-blood specimens for TPMT activity were determined at 4°C. TPMT enzyme activity was measured in 150 patients who were not on azathioprine (AZA), and population difference in TPMT enzyme activity was evaluated. Results: The assay was linear from 1.0 to 60.14 nmol 6-MMP concentrations. The chromatogram peaks obtained were baseline separated for 6-MMP and the internal standard. The bias and precision of low-, medium-, and high-quality controls (QC) were within acceptable limits. Stock and lysate specimens were found to be stable in −20°C. The Indian populations have a considerable number of patients with low- and intermediate-TPMT activity. The wide range of TPMT activity in the study population (3.85–35.68 nmol/h/ml erythrocytes) is suggestive of high inter-individual variability in the formation of 6-thioguanine nucleotide formation, and therefore clinical efficacy and safety of AZA. Conclusion: A simple isocratic method was developed and validated for measuring TPMT activity in erythrocytes. Measuring TPMT activity before initiating AZA may help to decide the initial dose of AZA in patient management.

Structural and Energetic Compatibility: The Driving Principles of Molecular Evolution.

In this work, we provide an answer to the question formulated by Albert Eschenmoser: "How would you envisage the bridge between potentially primordial geochemistry that had been disordered and one that gradually became self-organizing?" Analysis of the free-energy profiles of some of the key reactions leading to formation of nucleotides and their oligomers shows that, whereas the first part of the pathway, up to nucleotides, is energy-driven, in the second low-energy part entropic control in the form of structural compatibility becomes more important. We suggest that the birth of modern metabolism requires structural compatibility, which is enabled by the commensurability of the thermodynamics of the synthetic steps with the stabilizing effect of those intermolecular interactions that play a key role in dictating entropic control of these reactions.