Form Of Cis Research Articles

Whole-cell biocatalyzed organic solvent-free conversion of dill oil to cis-(-)-dihydrocarvone rich aromatic hydrosol: Chemical and aroma profiling

Biotechnologically produced flavours and fragrances are labeled as ‘natural’ and in great demand. In the current study, Fusarium equiseti was utilized as the whole-cell biocatalyst for the selective transformation of S-(+)-carvone in the dill oil to cis-(-)-dihydrocarvone [cis-(-)-DHC]. In an optimized condition (pH 5–6, dill oil 1.0 g/L and incubation period 24 h) F. equiseti produced S-(+)-carvone metabolites, dominated by cis-(-)-DHC (92–96% through gas chromatography-mass spectrometry or GC-MS) in nearly quantitative conversion (~99%). In the next step, distillation of the whole culture isolated the product in the form of cis-(-)-DHC rich (0.33 g/L) hydrosol; thus eliminating the use of organic solvent for the extraction and reducing the solvent soluble off-odour in the product. Detailed sensory analysis demonstrated the uniqueness of hydrosol aroma in reference to the dill oil and characterized it as sweet, minty, fresh, spicy and herbal. Headspace-GC-MS analysis supported by the odour activity value and sensory profile showed cis-(-)-DHC as the key odorant in the produced hydrosol. The developed bioconversion technique was novel in terms of its high selectivity towards cis-(-)-DHC and organic solvent-free downstream processing, producing a unique aromatic hydrosol.

Pathogen Inducible cis-acting Elements of Synthetic Promoters in Plants-review

Synthetic pathogen inducible promoters are used for the improvement and application of transgenic techniques in research and to increase agriculture production. The promoter contains specific cis-regulatory elements (W box, GCC box, Box S and D box) which induce anti pathogen molecular cascades. Insertion of dimerized form of cis acting elements at upstream region of promoter in promoter probe vector drives the expression of resistance gene or reporter gene. The expression indicates that synthetic promoters are responded to fungal elicitors. Expression of resistance restrict to infection sites which boost disease resistance in plants.

Supramolecular Assemblies of cis,cis,cis‐1,2,4,5‐Cyclohexanetetracarboxylic Acid with Various Aza‐Donors

AbstractA hydrated form of cis,cis,cis‐1,2,4,5‐cyclohexanetetracarboxylic acid and its molecular complexes with various aza‐donors, trans‐1,2‐bis(4‐pyridyl)ethene (a), trans‐1,2‐bis(2‐pyridyl)ethene (b), 2,2′‐bipyridine (c), trans‐1,2‐bis(4‐pyridyl)ethane (d), 1,10‐phenanthroline (e), 4,7‐phenanthroline (f) and phenazine (g) were prepared by slow‐evaporation of the corresponding solutions at ambient conditions. The structural analysis of the complexes reveals the elegant arrangement of the molecules in the crystal lattices in terms of the hydrogen bonds formed between the co‐crystallized ligands. Amongst, co‐crystals with 1,10‐phenanthroline yielded a host‐guest assembly, while the rest formed different types of sheet structures, either stacked or pillared.

Low-temperature equilibriums in solutions of isocyanide-phosphine complexes of palladium(II) chloride

cis-[PdCl2(CNR)(PPh3)] [R = Cy, t-Bu, C(Me)2CH2C(Me)3] have been synthesized via the interaction of [(PPh3)ClPd(μ-Cl)2PdCl(PPh3)] with isocyanide in CH2Cl2 at room temperature with 90–98% yield and characterized by means of mass spectrometry as well as 1H, 13C{1H, 31P}, and 31P{1H} NMR spectroscopy. The complexes structure in the solid phase has been elucidated by means of X-ray diffraction analysis. Dynamic processes in the solutions of the complexes in CDCl3 and CD2Cl2 at temperature of–95 to 60°С have been studied by means of 1H and 31P NMR spectroscopy. It has been found that the studied compounds existed exclusively in the cis-[PdCl2(CNR)(PPh3)] form in the solutions. In the case of cis-[PdCl2(CNCy)(PPh3)] in CH2Cl2, the conformational transitions of the equilibrium forms (the transition of the substituent in the cyclohexyl cycle between the equatorial and axial positions) are slowed down, the equatorial conformer prevailing in the solution (2: 1 at–95°С). Quantum-chemical simulation (DFT) has revealed that the standard Gibbs energy of the conformational transition from the axial form of cis-[PdCl2(CNCy)(PPh3)] into the equatorial one in the CH2Cl2 solution at 178 K equals–2.5 kJ/mol, being in agreement with the experimental data.

Efficient synthesis of a maghemite/gold hybrid nanoparticle system as a magnetic carrier for the transport of platinum-based metallotherapeutics.

The preparation and thorough characterization of a hybrid magnetic carrier system for the possible transport of activated platinum-based anticancer drugs, as demonstrated for cisplatin (cis-[Pt(NH3)2Cl2], CDDP), are described. The final functionalized mag/Au–LA–CDDP* system consists of maghemite/gold nanoparticles (mag/Au) coated by lipoic acid (HLA; LA stands for deprotonated form of lipoic acid) and functionalized by activated cisplatin in the form of cis-[Pt(NH3)2(H2O)2]2+ (CDDP*). The relevant techniques (XPS, EDS, ICP-MS) proved the incorporation of the platinum-containing species on the surface of the studied hybrid system. HRTEM, TEM and SEM images showed the nanoparticles as spherical with an average size of 12 nm, while their superparamagnetic feature was proven by 57Fe Mössbauer spectroscopy. In the case of mag/Au, mag/Au–HLA and mag/Au–LA–CDDP*, weaker magnetic interactions among the Fe3+ centers of maghemite, as compared to maghemite nanoparticles (mag), were detected, which can be associated with the non-covalent coating of the maghemite surface by gold. The pH and time-dependent stability of the mag/Au–LA–CDDP* system in different media, represented by acetate (pH 5.0), phosphate (pH 7.0) and carbonate (pH 9.0) buffers and connected with the release of the platinum-containing species, showed the ability of CDDP* to be released from the functionalized nanosystem.

The chiral potential of phenanthriplatin and its influence on guanine binding.

The monofunctional platinum complex cis-[Pt(NH3)2Cl(Am)]+, also known as phenanthriplatin, where Am is the N-heterocyclic base phenanthridine, has promising anticancer activity. Unlike bifunctional compounds such as cisplatin, phenanthriplatin can form only one covalent bond to DNA. Another distinguishing feature is that phenanthriplatin is chiral. Rotation about the Pt–N bond of the phenanthridine ligand racemizes the complex, and the question arises as to whether this process is sufficiently slow under physiological conditions to impact its DNA-binding properties. Here we present the results of NMR spectroscopic, X-ray crystallographic, molecular dynamics, and density functional theoretical investigations of diastereomeric phenanthriplatin analogs in order to probe the internal dynamics of phenanthriplatin. These results reveal that phenanthriplatin rapidly racemizes under physiological conditions. The information also facilitated the interpretation of the NMR spectra of small molecule models of phenanthriplatin-platinated DNA. These studies indicate, inter alia, that one diastereomeric form of the complexes cis-[Pt(NH3)2(Am)(R-Gua)]2+, where R-Gua is 9-methyl- or 9-ethylguanine, is preferred over the other, the origin of which stems from an intramolecular interaction between the carbonyl oxygen of the platinated guanine base and a cis-coordinated ammine. The relevance of this finding to the DNA-damaging properties of phenanthriplatin and its biological activity is discussed.

Bimolecular Rate Constant and Product Branching Ratio Measurements for the Reaction of C2H with Ethene and Propene at 79 K

The reactions of the ethynyl radical (C(2)H) with ethene (C(2)H(4)) and propene (C(3)H(6)) are studied under low temperature conditions (79 K) in a pulsed Laval nozzle apparatus. Ethynyl radicals are formed by 193 nm photolysis of acetylene (C(2)H(2)) and the reactions are studied in nitrogen as a carrier gas. Reaction products are sampled and subsequently photoionized by the tunable vacuum ultraviolet radiation of the Advanced Light Source (ALS) at Lawrence Berkeley National Laboratory. The product ions are detected mass selectively and time-resolved by a quadrupole mass spectrometer. Bimolecular rate coefficients are determined under pseudo-first-order conditions, yielding values in good agreement with previous measurements. Photoionization spectra are measured by scanning the ALS photon energy while detecting the ionized reaction products. Analysis of the photoionization spectra yields-for the first time-low temperature isomer resolved product branching ratios. The reaction between C(2)H and ethene is found to proceed by H-loss and yields 100% vinylacetylene. The reaction between C(2)H and propene results in (85 ± 10)% C(4)H(4) (m/z = 52) via CH(3)-loss and (15 ± 10)% C(5)H(6) (m/z = 66) by H-loss. The C(4)H(4) channel is found to consist of 100% vinylacetylene. For the C(5)H(6) channel, analysis of the photoionization spectrum reveals that (62 ± 16)% is in the form of 4-penten-1-yne, (27 ± 8)% is in the form of cis- and trans-3-penten-1-yne and (11 ± 10)% is in the form of 2-methyl-1-buten-3-yne.

New Iminophosphonamide Chromium(II) Complexes as Highly Active Polymer-Free Ethylene Oligomerization Catalysts

The reactions of the deprotonated form of cis-{[(μ-N)(t-Bu)]2PN(H)(o-OMeC6H4)]2} (a) with either CrCl2(THF)2 or CrCl3(THF)3 afforded the corresponding dimeric Cr(II) and monomeric Cr(III) complexes {cis-[(μ-N)(t-Bu)]2[PN(o-MeOC6H4)]2Cr}2 (1a) and cis-[(μ-N)(t-Bu)]2[PN-2-MeOC6H4]2CrCl (2a). By replacing the ligand’s o-OMeC6H4 groups with less-crowded CH2CH2N(i-Pr)2 functionalities and reacting the deprotonated form of cis-{[(μ-N)(t-Bu)]2[PN(H)CH2CH2N(i-Pr)2)]2} (b) with CrCl2(THF)2, the dimetallic, divalent {cis-[(μ-N)(t-Bu)]2[PNCH2CH2N(i-Pr)2)]2Cr}2 (1b) was obtained in crystalline form. Upon activation with MAO, both 1a and 1b afforded highly active, polyethylene-free ethylene oligomerization catalysts. Complex 2a is instead catalytically inactive.

Vinyl Oxidative Coupling as a Synthetic Route to Catalytically Active Monovalent Chromium

Reaction of the deprotonated form of cis-{(t-Bu)N(H)P[μ-N(t-Bu)](2)PN(H)(t-Bu)} with CrCl(3)(THF)(3) afforded the trivalent cis-{(t-Bu)NP[μ-N(t-Bu)](2)PN(t-Bu)}[Li (THF)])CrCl(2) (1). Subsequent reaction with 2 equiv of vinyl Grignard (CH(2)=CH)Mg Cl gave the butadiene derivative (cis-{(t-Bu)NP[μ-N(t-Bu)](2)PN(t-Bu)}[Li(THF)])Cr(cis-η(4)-butadiene) (3) formally containing the metal in its monovalent state. The presence of the monovalent state was thereafter confirmed by DFT calculations. The coordination of the butadiene unit appears to be rather robust since reaction with Me(3)P afforded cleavage of the dimeric ligand core but not its displacement. The reaction formed the new butadiene complex [(t-Bu)N-P-N(t-Bu)]Cr(cis-η(4)-butadiene)PMe(3) (4) containing a regular NPN monoanion. In agreement with the presence of monovalent chromium, complexes 3 and 4 act as single-component self-activating catalysts for selective ethylene trimerization and dimerization, respectively.

Urinary cytology for the detection of urothelial carcinoma of the bladder—a flawed adjunct to cystoscopy?

ObjectivesTo test the sensitivity of urinary cytology at a tertiary academic institution and to assess the impact of pathologist' experience on detection of urothelial carcinoma of the bladder (UCB). Materials and methodsBetween April 1999 and September 2008, 8,574 cytology specimens were evaluated. There were 882 consecutive patients (612 males, 270 females) who underwent bladder biopsy or transurethral resection of bladder tumor for UCB. Sensitivity rates of prior urinary cytology were determined. We tested the influence of experience of pathologist on sensitivity. ResultsUrinary cytology detected 237 out of 503 UCB (overall sensitivity 47.1%). Cytology after bladder washing resulted in higher sensitivity than in voided urine (50.4% vs. 36.2%; P = 0.008). Sensitivity rates significantly increased by UCB stage; 30.6% in pTa (n = 245), 60.5% in patients with any form of CIS (n = 119), 62.9% in pT1 (n = 89), and 69.6% in ≥pT2 (n = 46; P < 0.001). Similarly, higher sensitivity was observed with increasing grade, ranging from 16.7% in low (n = 108) to 62.2% in high grade tumors (n = 283; P < 0.001). No statistically significant difference between more and less experienced investigators was observed. ConclusionsSensitivity rates of urinary cytology at our institution are not superior to those reported in the literature. Cytology missed many high grade cancers, pointing to inherent methodological limitations of urinary cytology. A higher experience level of the pathologist was not significantly associated with higher sensitivity rates. Urinary cytology represents a flawed adjunct to cystoscopy with limited potential of improvement even in the hands of experienced pathologists.

8-Hydroxyquinoline Monomer, Water Adducts, and Dimer. Environmental Influences on Structure, Spectroscopic Properties, and Relative Stability of Cis and Trans Conformers

The low fluorescence quantum yield of 8-hydroxyquinoline cannot be correctly interpreted without knowing the form that such a compound assumes in different environments. The commonly accepted emission-quenching excited-state proton transfer can follow different reaction paths if 8-hydroxyquinoline is dimeric or monomeric or if it exists in the form of cis and trans conformers; in this light, the knowledge of the compound form in a particular environment is basic. We have performed a spectroscopic and computational investigation aimed at the determination of the form of 8-hydroxyquinoline in different solvents. UV-vis, fluorescence, and IR spectral features have been assigned by ab initio computations based on the density functional theory and time-dependent density functional theory; the density functional theory and MP2 computations have been applied to the determination of the relative stability of the dimeric and monomeric cis and trans forms of 8-hydroxyquinoline in different solvents. Molecular dynamics computations have been used to determine the compound behavior in water solutions. According to our results, 8-hydroxyquinoline shows a clear preference for the cis conformation (as dimer or monomer), but, in water solutions, a small fraction of the trans conformation is also present.

Internal versus Terminal Metalation of Double‐Helical Oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.

ESE-ENDOR Study and DFT Calculations on Oxovanadium Compounds: Effect of Axial Anionic Ligands on the 51V Nuclear Quadrupolar Coupling Constant

High-frequency electron spin echo-electron nuclear double resonance (ESE-ENDOR) spectroscopy is applied to oxovanadium VO 2 + complexes of Hcapca in the form of trans-[VOX(capca)] and to H 2 capcah in the form of cis-[VOX(Hcapcah)], where X = Cl - or SCN - . Nuclear quadrupolar coupling constants (nqcc), which are unobtainable by conventional continuous-wave electron paramagnetic resonance (CW-EPR), were measured and reported in terms of P | | (P | | = 3e 2 qQ/84 for I = 7/2). P | | values for trans-[VOCl(capca)] and trans-[VOSCN-(capca)] were calculated to be -0.18 and -0.21 MHz, respectively. In the cases of cis-[VOCl(Hcapcah)] and cis-[VOSCN(Hcapcah), P | | values were calculated to be -0.35 and -0.45 MHz, respectively. The experimental results are supported by DFT calculations of quadrupolar and hyperfine couplings for various oxovanadium compounds, including the cis and trans complexes studied by ESE-ENDOR. The charged ligands, coordinated axially trans to the oxo bond, reduce the electric field gradient along the V=O bond, thereby decreasing the observed magnitude of the nuclear quadrupolar coupling constants relative to those of the comparable cis compounds. This experimental finding is confirmed by quantum mechanical calculations. Although the absolute values of quadrupolar splittings cannot be calculated with acceptable accuracy, the observed experimental trends are very well reproduced. Thus, the complementary use of DFT and pulsed-ENDOR is a promising methodology for the study of biologically relevant vanadyl compounds.

Proteasomes Regulate Erythropoietin Receptor and Signal Transducer and Activator of Transcription 5 (STAT5) Activation: POSSIBLE INVOLVEMENT OF THE UBIQUITINATED CIS PROTEIN

Cis is an Src homology 2 domain-containing protein, which binds to the erythropoietin receptor and decreases erythropoietin-stimulated cell proliferation. We show that Cis associates with the second tyrosine residue of the intracellular domain of the erythropoietin receptor (Tyr401). Two forms of Cis with molecular masses of 32 and 37 kDa were detected, and we demonstrate that the 37-kDa protein resulted from post-translational modifications of the 32-kDa form. Anti-ubiquitin antibodies recognized the 37-kDa form of Cis and the proteasome inhibitors N-acetyl-leucyl-leucyl-norleucinal and lactacystin inhibited its degradation, showing that the 37-kDa form of Cis is a ubiquitinated protein, which seems to be rapidly degraded by the proteasome. In erythropoietin-stimulated UT-7 cells, the activation of the erythropoietin receptor and signal transducer and activator of transcription 5 (STAT5) was transient and returned to basal levels after 30-60 min of erythropoietin stimulation. In contrast, these proteins remained strongly phosphorylated, and STAT5 remained activated for at least 120 min in the presence of proteasome inhibitors. These experiments demonstrate that the proteasomes are involved in the down-regulation of the erythropoietin receptor activation signals. Because the proteasome inhibitors induced the accumulation of both the ubiquitinated form of Cis and the Cis-erythropoietin receptor complexes, our results suggest that the ubiquitinated form of Cis could be involved in the proteasome-mediated inactivation of the erythropoietin receptor.

Synthesis and X-ray Crystallographic Characterization of (μ-(Diphenylphosphino)phenyl-C2,P)palladium Bromide. A Novel Tetranuclear Metalated Compound

The synthesis and crystal structure of a tetranuclear palladium cluster, [Pd(PC)Br]4 (PC) = [P(C6H4)Ph2]-), is described. Cleavage of this cluster with phosphines yields the mononuclear species Pd(PC)Br(P) in the form of cis and trans isomers. An equilibrium between mono- and tetranuclear species is observed for P = PCBr.

Photoregulated-metal binding with an azobenzene-capped calix[4]arene

Abstract The photoresponsive calix[4]arene(1), which is modified with an azobenzene moiety on the lower rim of the calix, has been prepared. Photoisomerization of 1 was performed with photoirradiation by a 500W-Xe lamp using a Corning 7 –37 filter. The liquid-liquid extraction of various ions by 1 in the form of both cis and trans isomers using picrate counter ion has been studied. Calixarene 1 shows a higher binding ability to the metal cations examined in the trans form than for cis isomer and exhibits over twice the binding ability, except for Cu2 + and Al3 +, compared to the non-modified calix[4]arene (2), which has same structure on the upper rim of the calix.

Agostic Pd ⋯ H+⋯ NHR2and apical Pd ⋯ NHR2interactions: the synthesis and structures of [PdIICl2(H[9]aneN3)]+, the PdII–PdIIdimer [(H[9]aneN3)Cl2Pd–PdCl2(H[9]aneN3)]2+, and [Pd(Me3[9]aneN3)(NCMe)2]2+

Long-range agostic Pd ⋯ H+⋯ NHR2 interactions are observed in the crystal structure of the protonated form of cis-[PdIICl2([9]aneN3)], while a direct apical Pd ⋯ NHR2 interaction is observed in the purple complex [Pd(Me3[9]aneN3)(NCMe)2](PF6)2.

Incorporation of redox-active cations into tungsten oxide coatings on electrodes: Enhancement of coating stability and electrocatalytic activity

The electrochemical deposition of tungsten oxide onto the surface of glassy carbon electrodes produces a coating which exhibits significant cation exchange behavior. Catalysts such as the protonated form of cobalt meso-tetrakis(4-pyridyl)porphyrin (CoTPyP) or cis-[Ru(6,6′−Cl 2bpy) 2(OH 2) 2] 2+ are efficiently bound to the oxide coatings where they serve to catalyze the reduction of O 2 or various oxidation reactions respectively. The combination of the reduced tungsten oxide (hydrogen tungsten bronze) with CoTPyP leads to the reduction of O 2 to H 2O 2 and subsequently to H 2O under conditions where CoTPyP alone produces only a two-electron reduction of O 2.

Complete space-like hypersurfaces of a de Sitter space with constant mean curvature

Let Mf(c) be an m-dimensional connected semi-Riemannian manifold ofindex sand of constant curvature c, which is calledan indefinitespace form ofindex s or simply a space form according as s>0 or s=0. An m-dimensional space form of constant curvature cis only denoted by Mm(c). The study of hypersurfaces with constant mean curvature of Mn+＼c) was initiatedby Nomizu and Smyth [13], who proved some excellent results. Itis seen that a complete space-like hypersurface of a Minkowski space

Excretion kinetics of the DNA adducts of cis-diamminedichloroplatinum(II) formed in vitro in rat urine

The main adduct of cis-diamminedichloroplatinum(II) (cis-Pt) with DNA, cis-[Pt(NH3)2(dGpdG)], was administered i.p. to rats. Urine was collected daily for 4 days. The adduct was purified by a weak cation exchanger and quantitated by HPLC with UV detection. The recovery of the adduct was 30.0 +/- 7.0% (mean +/- SEM). The main reason for the low recovery was the chemical instability of cis-[Pt(NH3)2 (dGpdG)] in urine as shown in an in vitro incubation. Adjusted for this instability the recovery in urine was greater than 70% of the dose. When cis-Pt-DNA (the molar ratio of cis-Pt to nucleotide = 1:50) was administered i.p. to rats only 1.25 +/- 0.23% of platinum was excreted in urine in the form of cis-[Pt(NH3)2(dGpdG)] and cis-[Pt(NH3)2(dApdG)] during the first 4 days. If the removal of the cis-Pt-DNA adducts from human tissues is to be followed, their possible slow excretion and chemical instability in urine needs to be considered.