Fluorescence Quantitative PCR Detection Research Articles

A Fast and Sensitive One-Tube SARS-CoV-2 Detection Platform Based on RTX-PCR and Pyrococcus furiosus Argonaute.

Since SARS-CoV-2 is a highly transmissible virus, alternative reliable, fast, and cost-effective methods are still needed to prevent virus spread that can be applied in the laboratory and for point-of-care testing. Reverse transcription real-time fluorescence quantitative PCR (RT-qPCR) is currently the gold criteria for detecting RNA viruses, which requires reverse transcriptase to reverse transcribe viral RNA into cDNA, and fluorescence quantitative PCR detection was subsequently performed. The frequently used reverse transcriptase is thermolabile; the detection process is composed of two steps: the reverse transcription reaction at a relatively low temperature, and the qPCR performed at a relatively high temperature, moreover, the RNA to be detected needs to pretreated if they had advanced structure. Here, we develop a fast and sensitive one-tube SARS-CoV-2 detection platform based on Ultra-fast RTX-PCR and Pyrococcus furiosus Argonaute-mediated Nucleic acid Detection (PAND) technology (URPAND). URPAND was achieved ultra-fast RTX-PCR process based on a thermostable RTX (exo-) with both reverse transcriptase and DNA polymerase activity. The URPAND can be completed RT-PCR and PAND to detect nucleic acid in one tube within 30 min. This method can specifically detect SARS-CoV-2 with a low detection limit of 100 copies/mL. The diagnostic results of clinical samples with one-tube URPAND displayed 100% consistence with RT-qPCR test. Moreover, URPAND was also applied to identify SARS-CoV-2 D614G mutant due to its single-nucleotide specificity. The URPAND platform is rapid, accurate, tube closed, one-tube, easy-to-operate and free of large instruments, which provides a new strategy to the detection of SARS-CoV-2 and other RNA viruses.

Pathogen identification and epidemic factor analysis of yellow catfish, Pelteobagrus fulvidraco, red lower jaw disease

Since 2020, another type of epidemic disease, ‘red lower jaw disease’ (RLJD), has broken out in yellow catfish Pelteobagrus fulvidraco every spring in China, causing large-scale deaths and significant economic losses. This new disease has the characteristics of strong infectivity, high mortality and a single host. To prevent and control RLJD, epidemiological investigation, transmission electron microscopy (TEM), virome sequencing, Koch's rule verification and epidemic factor investigation were studied in this article. The clinical symptoms of diseased yellow catfish were pale gill filaments, hyperaemia and swelling of the spleen and kidney. TEM results revealed that a large number of 35–40 nm spherical virus particles without envelope structure were found in the cytoplasm of spleen cells. The liver, spleen and kidney of the diseased fish had serious lesions. After virome sequencing, the calicivirus reads in the unique virus reads accounted for 99.5% of the unique virus reads in the diseased fish, which provided a relevant reference value for identifying the pathogen of RLJD. The full-length sequence of yellow catfish calicivirus (YCCV) obtained at 7405 bp, including the RNA-helicase domain, RdRp-1 domain and d1iqqa domain. At the same time, both PCR and TaqMan fluorescence quantitative PCR detection method of YCCV were established. Through the artificial infection test, YCCV was verified as the pathogen for RLJD. It was also found that YCCV mainly harmed the fish within 1 year, whereas the fish above 2 years had good resistance. The water temperature of the RLJD outbreak was mainly concentrated at 18 °C–24 °C. In the current study, after YCCV was verified as the pathogen of RLJD, epidemic factors including fish age and water temperature were studied, to the best of our knowledge, for the first time to provide a relevant theoretical basis for the pathogenic mechanism and prevention and control measures of yellow catfish RLJD.

Establishment of a real-time fluorescent quantitative PCR detection method and phylogenetic analysis of BoAHV-1

BackgroundInfectious bovine rhinotracheitis (IBR), caused by Bovine alphaherpesvirus-1 (BoAHV-1), is an acute, highly contagious disease primarily characterized by respiratory tract lesions in infected cattle. Due to its severe pathological damage and extensive transmission, it results in significant economic losses in the cattle industry. Accurate detection of BoAHV-1 is of paramount importance. In this study, we developed a real-time fluorescent quantitative PCR detection method for detecting BoAHV-1 infections. Utilizing this method, we tested clinical samples and successfully identified and isolated a strain of BoAHV-1.1 from positive samples. Subsequently, we conducted a genetic evolution analysis on the isolate strain’s gC, TK, gG, gD, and gE genes.ResultsThe study developed a real-time quantitative PCR detection method using SYBR Green II, achieving a detection limit of 7.8 × 101 DNA copies/μL. Specificity and repeatability analyses demonstrated no cross-reactivity with other related pathogens, highlighting excellent repeatability. Using this method, 15 out of 86 clinical nasal swab samples from cattle were found to be positive (17.44%), which was higher than the results obtained from conventional PCR detection (13.95%, 12/86). The homology analysis and phylogenetic tree analysis of the gC, TK, gG, gD, and gE genes of the isolated strain indicate that the JL5 strain shares high homology with the BoAHV-1.1 reference strains. Amino acid sequence analysis revealed that gC, gE, and gG each had two amino acid mutations, while the TK gene had one synonymous mutation and one H to Y mutation, with no amino acid mutations observed in the gD gene. Phylogenetic tree analysis indicated that the JL5 strain belongs to the BoAHV-1.1 genotype and is closely related to American strains such as C33, C14, and C28.ConclusionsThe established real-time fluorescent quantitative PCR detection method exhibits good repeatability, specificity, and sensitivity. Furthermore, genetic evolution analysis of the isolated BoAHV-1 JL-5 strain indicates that it belongs to the BoAHV-1.1 subtype. These findings provide a foundation and data for the detection, prevention, and control Infectious Bovine Rhinotracheitis.

Establishment and Application of a Quadruplex Real-Time Reverse-Transcription Polymerase Chain Reaction Assay for Differentiation of Porcine Reproductive and Respiratory Syndrome Virus, Porcine Circovirus Type 2, Porcine Circovirus Type 3, and Streptococcus suis.

Respiratory illnesses present a significant threat to porcine health, with co-infections involving Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Streptococcus suis (SS), Porcine Circovirus Type 2 (PCV2), and Porcine Circovirus Type 3 (PCV3) acting as the primary causative agents. As a result, the precise diagnosis of PRRSV, PCV2, PCV3 and SS is of paramount importance in the prevention and control of respiratory diseases in swine. Therefore, we conducted a molecular bioinformatical analysis to concurrently detect and differentiate PRRSV, PCV2, PCV3 and SS. We selected the ORF6 gene of PRRSV, the ORF2 gene of PCV2 and PCV3, and the glutamate dehydrogenase (GDH) gene of SS as targets. Specific primers and probes were designed for each pathogen, and following meticulous optimization of reaction conditions, we established a multiple TaqMan fluorescence quantitative PCR detection method. Subsequently, we subjected this method to a comprehensive assessment, evaluating its specificity, sensitivity, and repeatability. The research results demonstrated that the established multiple TaqMan fluorescence quantitative PCR detection method displays displayed exemplary specificity, with no instances of cross-reactivity with other pathogens. The method's minimum detection concentrations for PRRSV, PCV2, PCV3, and SS were 2.80 × 101 copies/µL, 1.96 × 102 copies/µL, 2.30 × 102 copies/µL, and 1.75 × 103 copies/µL, respectively. When applied to the analysis of 30 clinical samples, the results closely mirrored those obtained through Chinese standard uniplex real-time qPCR detection method for PRRSV, as well as the general PCR methods for SS, PCV2, and PCV3. This study underscores the robust specificity, high sensitivity, and consistent stability of the multiple TaqMan fluorescence quantitative PCR detection method that we have developed. It is ideally suited to the clinical monitoring of PRRSV, PCV2, PCV3, and SS, and it carries significant importance in ongoing efforts to prevent and manage respiratory diseases in porcine populations.

Rapid detection of grass carp reovirus type 1 using RPA-based test strips combined with CRISPR Cas13a system.

Due to the existence of grass carp reovirus (GCRV), grass carp hemorrhagic disease occurs frequently, and its high pathogenicity and infectivity are great challenges to the aquaculture industry. As a highly pathogenic pathogen, the outbreak of hemorrhagic disease often causes tremendous economic losses. Therefore, it is important to rapidly and accurately detect GCRV on site to control timely. In this study, recombinant enzyme amplification (RPA) combined with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas13a system was employed to establish a method to detect the vp7 gene of grass carp reovirus type 1. This method can be adopted for judging the results by collecting fluorescence signal, ultraviolet excitation visual fluorescence and test strip. Combined with the RPA amplification experiment, the detection limit of the RPA-CRISPR method can reach 7.2 × 101 copies/μL of vp7 gene per reaction, and the detection process can be completed within 1 h. In addition, this method had no cross-reaction with the other 11 common aquatic pathogens. Then, the performance of the RPA-CRISPR/Cas13a detection method was evaluated by comparing it with the real-time fluorescence quantitative PCR detection method of clinical samples. The results of RPA-CRISPR/Cas13a detection were shown to be in consistence with the results obtained from the real-time fluorescence quantitative PCR detection. The coincidence rate of this method with 26 GCRV clinical samples was 92.31%. In summary, this method has high sensitivity, specificity and on-site practicability for detecting GCRV type 1, and has great application potential in on-site GCRV monitoring.

Low-energy LED red light inhibits the NF-κB pathway and promotes hPDLSCs proliferation and osteogenesis in a TNF-α environment in vitro.

There are few studies on the effect of low-energy LED red light on periodontal tissue regeneration in an inflammatory environment. In this study, Cell Counting Kit-8(CCK-8) assays were used to detect the effects of TNF-α at three different concentrations (0, 10ng/ml, and 20ng/ml) on the proliferation of human periodontal ligament stem cells (hPDLSCs), and 10ng/ml was selected as the subsequent experimental stimulation concentration. CCK-8 assays were used to detect the effect of LED red light with energy density of 1J/ cm2, 3J/ cm2, and 5J/cm2 on the proliferation of hPDLSCs. The promotion effect of energy density of 5J/cm2 on the proliferation of hPDLSCS was the most obvious (p < 0.05). Set CON group, ODM group, ODM + 10ng/ml TNF-α group, and ODM + 10ng/ml TNF-α + 5J/ cm2 LED red light group. Alkaline phosphatase staining and activity detection, alizarin red staining and calcium nodules quantitative detection of osteoblast differentiation products, real-time fluorescence quantitative PCR detection of osteoblast gene expression (Runx2, Col-I, OPN, OCN). The results showed that ODM showed the strongest osteoblast ability, followed by ODM + 10ng/ml TNF-α + 5J/ cm2 LED red light group. The osteoblast ability of ODM + 10ng/ml TNF-α was decreased, but was not found in CON group. Western blot was used to detect the expression of NF-κB pathway protein and osteoblast-related proteins (Runx2, Col-I, OPN, OCN) after addition of PDTC inhibitor. The results showed that the expression of p-IκBα was increased and the expression of IκBα was decreased (p < 0.05). The expression of osteoblast protein increased after the addition of inhibitor (p < 0.05). Therefore, in an inflammatory environment constructed by 10ng/ml TNF-α, 5J/cm2 LED red light can upregulate the proliferation and osteogenesis of hPDLSCs by inhibiting NF-κB signaling pathway.

Establishment and Application of Real-Time Fluorescence Quantitative PCR Detection Technology for Metschnikowia bicuspidata Disease in Eriocheir sinensis.

Metschnikowia bicuspidata causes a "milky disease" in Chinese mitten crab, Eriocheir sinensis, which inflicts significant damage on the breeding industry, but there are no effective drugs for this disease. Precise detection technologies and clarification of transmission routes are now essential to prevent its occurrence. A real-time fluorescent quantitative PCR (qPCR) detection method targeting the mitochondrial cytochrome c oxidase subunit VIA (COX6A) of M. bicuspidata was developed and its sensitivity, specificity, repeatability, and application effectiveness evaluated. There was a robust linear relationship between the qPCR threshold cycle value (Ct) and copy number of the standard with a wide dynamic range. The standard curve had a correlation coefficient (R2) of 0.996, amplification efficiency of 103.092%, and a lower limit of detection sensitivity of 7.6 × 101 copies/µL. The COX6A-qPCR method exhibited high specificity for the detection of M. bicuspidata, with no cross-reactivity. The intra- and inter-group variation coefficients were <1% and 2%, respectively. The qPCR exhibited superior sensitivity compared to existing detection methods, with a positivity rate of 76.67%. The M. bicuspidata content ranged from 1.0 × 101-2.7 × 106 copies/µL. The COX6A-qPCR detection technology exhibited high sensitivity, strong specificity, and excellent repeatability, enabling the accurate quantification of M. bicuspidata.

Establishment of a Fluorescence Quantitative PCR Assay in Detection of Listeria monocytogenes based on Internal Reference

Background: Listeria monocytogenes is the only pathogenic bacterium of Listeria that causes disease to humans. The Dairy products, meat and other foods have been proved to be the transmission carriers of Listeria monocytogenes, endangering human health. Therefore, it is necessary to establish a fast, sensitive and specific fluorescent quantitative PCR method for detecting Listeria monocytogenes in milk based on internal reference. Methods: According to the genome sequence of Listeria monocytogenes published in Genbank, we screened specific target gene Hly gene, designed specific primers and probes, optimized the reaction system and added internal reference (IAC) to the system. This IAC was detected by TaqMan probes labeled with different fluorophore. 25-100 CFU/25 g artificially contaminated sample was added to evaluate the performance of reaction system. Result: The assay was could be used reliably for detection of Listeria monocytogeneswith a sensitivity of 10-3ng/uL. For the 10-fold dilutions bacteria DNA extracted by cooking water,the lowest detection limit was 4 x 102cfu/mL. But for the plasmid with hly, the lowest detection limit can reach 104 cfu/mL. The standard curve of hly and hly-IAC was established and the quantification was linear between Ct and template copy number (r2=0.999). While the initial sample amount of artificially contaminatedbacteria was 25 CFU/25 g (Fresh milk, milk powder, fermented milk), Listeria monocytogenes could be detected in 14 h. The Hly IAC fluorescent quantitative PCR detection method established in this study,and added internalreference tothe system, can accurately detect Listeria monocytogenesin fresh milk.At the same time, real-time monitoring of the PCR reaction process ensures the reliability of the results, which is suitable for rapid detection of large batches of samples.

Genome-Wide Identification and Characterization of Bovine Fibroblast Growth Factor (FGF) Gene and Its Expression during Adipocyte Differentiation.

Fibroblast growth factor (FGF) family genes are a class of polypeptide factors with similar structures that play an important role in regulating cell proliferation and differentiation, nutritional metabolism, and neural activity. In previous studies, the FGF gene has been widely studied and analyzed in many species. However, the systematic study of the FGF gene in cattle has not been reported. In this study, 22 FGF genes distributed on 15 chromosomes were identified in the Bos taurus genome and clustered into seven subfamilies according to phylogenetic analysis and conservative domains. Collinear analysis showed that the bovine FGF gene family was homologous to Bos grunniens, Bos indicus, Hybrid-Bos taurus, Bubalus bubalis, and Hybrid-Bos indicus, and tandem replication and fragment replication were the key driving forces for the expansion of the gene family. Tissue expression profiling showed that bovine FGF genes were commonly expressed in different tissues, with FGF1, FGF5, FGF10, FGF12, FGF16, FGF17, and FGF20 being highly expressed in adipose tissue. In addition, real-time fluorescence quantitative PCR (qRT-PCR) detection showed that some FGF genes were differentially expressed before and after adipocyte differentiation, indicating their diverse role in the formation of lipid droplets. This study made a comprehensive exploration of the bovine FGF family and laid a foundation for further study on the potential function in the regulation of bovine adipogenic differentiation.

Distribution and removal of antibiotic resistance genes in a landfill leachate treatment process

ABSTRACT Domestic waste landfills have been regarded as the main source of antibiotic resistance genes (ARGs) which are considered to be emerging environmental contaminants. Fluorescent quantitative PCR detection was used to determine the occurrence and abundance of ARGs in a landfill leachate treatment system. Fourteen ARGs were detected initially in the leachate influents. The most abundant ARGs were IntI1, followed by sulI, sulII, sulIII, tetC and tetW. The abundance of ARGs increased in the biological treatment unit and then decreased in the effluent of ultrafiltration membrane treatment. The absolute abundance of ARGs in effluent was 1.05–1.94 orders of magnitude lower than that in influent. There was a very significant strong correlation between various ARGs and heavy metals, especially Zn, Pb, Cu, Cd and As, indicating that there may be obvious co-selection between heavy metals and ARGs. Although the leachate treatment process could effectively reduce the abundance of ARGs, its effect on reducing the number of species of ARGs was relatively limited, which may have potential environmental health risks to the urban sewage plant receiving leachate effluent and the final receiving water body.

Bioinformatics Analysis of Disease Resistance Gene PR1 and Its Genetic Transformation in Soybeans and Cultivation of Multi-resistant Materials

In agricultural production, a single insect-resistant and disease-resistant variety can no longer meet the demand. In this study, the expression vector pCAMBIA-3301-PR1 containing the disease-resistant gene PR1 was constructed by means of genetic engineering, and the PR1 gene was genetically transformed to contain the PR1 gene through the pollen tube method. In CryAb-8Like transgenic high-generation T7 receptor soybean, a new material that is resistant to insects and diseases is obtained. For T2 transformed plants, routine PCR detection, Southern Blot hybridization, fluorescence quantitative PCR detection, indoor and outdoor pest resistance identification and indoor disease resistance identification were performed. The results showed that there were 9 positive plants in the routine PCR test of T2 generation. In Southern Blot hybridization, both PR1 and CryAb-8Like genes are integrated in soybeans in the form of single copies. Fluorescence quantitative PCR showed that the expression levels of PR1 and CryAb-8Like genes are different in different tissues. The average expression levels of PR1 gene in plant roots, stems, and leaves are 2.88, 1.54, and 5.26, respectively. CryAb-8Like genes are found in roots, stems, and leaves. The average expression levels were 1.36, 1.39, and 4.25, respectively. The insectivorous rate of the CryAb-8Like gene in outdoor plants with positive insect resistance identification was 3.78%. The disc partition method was used indoors for pest resistance identification, and the bud length of transformed plants increased significantly. The average mortality rate of untransformed plants in indoor disease resistance identification was as high as 56.66%, and the average mortality rate of plants transformed with PR1 gene was 10.00%, and disease resistance was significantly improved. Therefore, a new material with resistance to diseases and insects is obtained.

Development of a Quantitative PCR Method for Specific and Quantitative Detection of Enterocytospora artemiae, a Microsporidian Parasite of Chinese Grass Shrimp (Palaemonetes sinensis)

Enterocytospora artemiae (EAM) mainly parasitizes the hepatopancreas of Palaemonetes sinensis. Serious infection leads to hepatopancreatic lesions, which greatly reduce the vitality of P. sinensis. Currently, EAM is detected via conventional PCR methods. However, conventional PCR has low sensitivity and cannot be used for accurate quantitative detection of EAM or its parasitic activity in host tissues. In this study, we designed a pair of specific primers based on the sequence of the ribosomal protein S9 gene (RPS9; GenBank accession number: MZ420734) to establish and optimize a SYBR Green I real-time fluorescent quantitative PCR detection method for EAM. Only EAM appeared as a bright and single target band, whereas other microorganisms did not, indicating that the primer for RPS9 had high specificity. This method displayed optimum amplification effects at an annealing temperature of 55°C, and the melting curve of the product produced a single peak. The established method showed a good linear relationship from 2.2 × 108 to 2.2 × 101 copies/μL. The relationship between the number of cycle thresholds (Ct) and the logarithm of the initial template amount (x) conformed to Ct = −3.281 log x + 36.543 (R2 = 0.998). Amplification efficiency was 101.737%, and the lower limit of detection sensitivity was 2.2 × 101 copies/μL. Good intra- and inter-group repeatability was observed within the linear range. The sensitivity of this method was more than 200 times higher than that of nested PCR. Thus, detection data obtained using this method may be useful as a technical reference for rapid and accurate identification of EAM infection and for the prevention and control of EAM during P. sinensis breeding.

Colonization Characteristics of Poplar Fungal Disease Biocontrol Bacteria N6-34 and the Inhibitory Effect on Pathogenic Fungi by Real-Time Fluorescence Quantitative PCR Detection.

Botryosphaeria dothidea is one of the most important diseases which can cause poplar canker. In our previous study, the endophytic Bacillus subtilis N6-34 screened from poplar tissue was found to be an antagonistic strain against B. dothidea. In order to ascertain the colonization rule of B. subtilis N6-34 in poplar plants, colonization of B. subtilis N6-34 labeled with a green fluorescent protein (GFP) was investigated in poplar plants and the rhizosphere soil. To confirm the inhibitory effect of the strain N6-34 on pathogenic fungi, real-time fluorescent quantitative PCR experiment with Fusarium oxysporum as the target strain was carried out. Firstly, a plasmid (pHT01-P43GFPmut3a) containing gfp gene was successfully transformed into wild B. subtilis N6-34, which has the similar characteristics with the strain N6-34 in cell growth and antifungal activity. The poplar pot experiments were carried out to examine the colonization rules and colonization quantity in poplar plants and rhizosphere soil. Observation with a confocal laser scanning microscope showed that GFP-labeled B. subtilis N6-34 (N6-34-GFP) could colonize in primary root, lateral root and adventitious root. With the extension of inoculation time, the colonization quantity of N6-34-GFP in the rhizosphere soil and poplar plants showed a trend of first increasing, then stabilizing for a period of time and then decreasing. The real-time fluorescent quantitative PCR result showed a gradual decrease in the number of F. oxysporum with increasing inoculation time. Therefore, N6-34-GFP exhibited colonization in the rhizosphere soil and different parts of poplar plants. In addition, the strain N6-34 could inhibit the growth of pathogenic fungi. The ability of B. subtilis N6-34 to colonize in the rhizosphere soil and poplar plants and to inhibit fungal growth in vitro suggest a potential application of this strain as a biological control agent.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions

BackgroundIn recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously.MethodsThe blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected.ResultsThe correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found.ConclusionWith the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Detection of microamounts of novel coronavirus residues in environment by digital PCR

<p indent="0mm">2019 novel coronaviruses (2019-nCoV) swept the world and are still at a high incidence stage. Highly sensitive and accurate nucleic acid molecular diagnostic techniques and methods have become a hot spot of global concern. 2019-nCoV is a kind of RNA virus. At present, there are many methods to detect virus RNA, including real-time fluorescence quantitative PCR (RT-PCR), colloidal gold detection, chemiluminescence detection, and so on. Colloidal gold detection and chemiluminescence detection need to use monoclonal antibodies against 2019-nCoV, but there are some problems in the preparation of 2019-nCoV monoclonal antibodies, such as long cycle, complex preparation and easy pollution. So the above two methods are not easy to be established for the detection of 2019-nCoV. The superiority of PCR technology is widely used in auxiliary medical clinical diagnosis, customs inspection and quarantine, the development of new agriculture, national defense military defense, and basic research of bioscience, and so on. However, the quantification of the target DNA fragment in RT-PCR is still relatively quantitative. Because this technique mainly depends on CT value and standard curve to quantify the target DNA in the experiment, which affects the amplification efficiency of the whole system, and the sensitivity and accuracy of the reaction system are greatly affected. Because the 2019-nCoV virus is highly contagious, the detection methodology is required to be highly sensitive, which is in line with the characteristics of digital PCR (droplet digital PCR system, referred to as ddPCR). ddPCR has the advantages of absolute quantification, high specificity, high sensitivity and strong interference ability, which can better combine molecular biology and medicine closely, and has a great advantage in the detection of 2019-nCoV. In this study, based on droplet digital PCR detection technology, the detection reagent and method were established using the principle of nested PCR. The Saliva of 333 2019-nCoV patients and their environmental samples were detected and compared with real-time PCR (RT-PCR). The linear range of the droplet digital PCR method established in this study was between 25–5 copies/µL, and minimum detection limit was 0.5 copies/µL, which was 2–3 orders of magnitude higher than that of the commercial real-time fluorescent quantitative PCR detection technology. In 333 samples, 7 were positive in 197 environmental samples, and 9 were positive in 136 human samples. The detection accuracy was 100%, and the environmental micro-virus residues that could not be detected by RT-PCR were detected. The digital PCR detection method established in this study was highly specific, and the minimum detection limit was far lower than that of RT-PCR. It is of great significance for sensitive and accurate detection of 2019-nCoV infection, early infection and environmental microvirus.

MicroRNA 200a inhibits liver fibrosis of schistosoma

ABSTRACT MicroRNA 200a (miR-200a) can inhibit the activation and proliferation of hepatic stellate cells (HSCs) through the transforming growth factor-β (TGF-β) signaling pathway, and improve fibrotic lesions. However, to date, there is no study exploring the role of miR-200a in schistosomiasis liver fibrosis (SLF). In this study, 64 healthy female Balb/c mice were selected and randomly divided into four groups: normal control group (non-infected schistosomiasis group), schistosomiasis model group, Lenti-NC group (lentivirus-negative control group), and Lenti-miR-200a group (lentivirus experimental group). Fluorescence quantitative PCR detection was used to measure the expression level of RNA. HE and Masson staining were used to observe the pathological changes of mouse liver tissue. Furthermore, ELISA was used to detect the serum concentrations of inflammation factors. We found that the expression level of miR-200a in liver tissues gradually decreased with the development of SLF. However, fibrosis factors (α-SMA and TGF-β2) and inflammatory cytokines (IL-4 and IFN-γ) in liver tissues and serum increased and the expression level of Colla I reached its peak in the 6th week of infection. Besides, compared with the schistosomiasis group and Lenti-NC group, the Lenti-NC group had lower levels of α-SMA, TGF-β2 and Colla I (P > 0.05). Furthermore, inflammatory cells and blue collagen fibers appeared and they increased with the development of infection in the schistosomiasis group and Lenti-NC group, but these changes reduced significantly in Lenti-miR-200a group. Our study demonstrated that upregulation of miR-200a might contribute to inhibiting schistosomiasis liver fibrosis.

Effects of miR-489 targeting on SOX4 gene on proliferation and apoptosis of human hepatocellular carcinoma cells.

Hepatocellular carcinoma is one of the most common malignant tumors found all over the globe. Despite advances in surgery and chemotherapy, the five-year survival rate of patients with hepatocellular carcinoma is still low. It is known that the proliferation of hepatocellular carcinoma cells is closely related to the occurrence, development and prognosis of hepatocellular carcinoma. The present work investigates the expression of microRNA-489 (miR-489) in human hepatocellular carcinoma cells and its effect on the biological behavior of human hepatocellular carcinoma cells. The expression of miR-489 by fluorescence quantitative PCR detection in 30 patients with hepatoblastoma of liver cancer tissues and adjacent tissues was studied. Also, the determination of hepatoblastoma in four cell lines with different metastatic potential (HR8348, HCT116, HT29 and HEPG2) and the expression of miR-489 during miR-489 simulation process was studied. MTT assay, flow cytometry and Western blot analysis were performed to know the cell proliferation to detect the changes in cell cycle, apoptosis of cells, and SOX4 gene expression respectively. RT-PCR results showed that the cells compared with pre-cancerous tissue, the expression level of miR-489 in hepatocellular carcinoma tissues than in adjacent tissue significantly decreased (P<0.05), and with liver cancer cell metastasis increased (P<0.05); analogue transfection constructed miR-489 overexpressing HEPG2 cell line by microRNA. MTT results showed that miR-489 can inhibit the proliferation of HEPG2 cells, the differences were statistically significant (P<0.05); flow cytometry results showed that miR-489 mimics was transfected into HEPG2 cells at 48 hours had no significant effect on cell cycle distribution (P > 0.05); but miR-489 expression could induce apoptosis, compared with the control group, the apoptosis of miR-489 mimics was significantly increased and the difference was statistically significant (P < 0.05). In conclusion, miR-489 can significantly inhibit the occurrence and development of hepatocellular carcinoma cells. The mechanism may be down regulated by the expression of SOX4 and inhibit cell proliferation. Further this study showed that the tumor cells SOX4 gene as a regulatory factor target the genes of miR-489 in hepatocellular carcinoma.

Laboratory diagnosis of the etiology of viral infectious diseases

It must grow the awareness that contagious have never been far away from mankind. and the threats have always been next to us. Taking the laboratory detections of severe acute respiratmy syndrome coronavirus 2 (SARS-CoV-Z) as an example, this article mainly introduces the advantages and limitations of the I'eaJ-time fluorescent quantitative PCR and serological antibody detection teehnnlogy that 11an been used for laboratory detections of the etiology of Viral infectious diseases. It is hoped that the intmduetion will be helpful to the clinical diagnosis of viral infectious diseases, espet'ially COVID~19.

LncRNA LOC101927514 regulates PM2.5-driven inflammation in human bronchial epithelial cells through binding p-STAT3 protein

Long-term exposure to fine particulate matter (PM2.5) may cause or exacerbate many diseases, including respiratory inflammation. However, the full mechanism is not yet fully understood. The newly discovered long chain non-coding RNA, though unable to encode proteins, regulates multiple life activities and participates in the development of inflammation. In this study, we set up a cell inflammation model by using normal bronchial 16HBE cells exposed to PM2.5. High-throughput sequencing, as well as real-time fluorescent quantitative PCR detection and validation, was performed on the inflamed cells to evaluate the expression level of long chain noncoding RNA that helped us to identify the LncRNA LOC101927514. Inhibiting LncRNA LOC101927514 expression by RNAi, reflected in a reduction in inflammation, is driven by PM2.5. In addition, we identify LncRNA LOC101927514 to be located within the nucleus and binds to STAT3, altering the inflammatory state of the cells and IL6 and IL8 release. This study identifies that LncRNA LOC101927514 is a new potential target for future treatment of the inflammatory response activated by PM2.5 in the respiratory system.

Maternal Blood Milk Saliva Sample Selection and the Transmission of Hepatitis B Virus Infectious Research

Background: Hepatitis B is an infectious disease, which is a main way of vertical transmission of infectious HBV between mother and infant. Hepatitis B virus infection is always a hot topic of social concern, especially in China. The paper studies hepatitis B virus in maternal blood, breast milk, saliva of hepatitis B virus infection model (HBV-M) in Hefei city, Anhui province, PRC. HBV-DNA load and related data in Hefei city are used for risk assessment of the transmission of hepatitis B virus to provide evidence for evidence-based medicine and scientific guidance of infant feeding patterns. Methods: On the principle of informed consent, inpatient hepatitis B maternal blood 695, breast milk, saliva 614,169 copies were used as the object of analysis, using the ELISA method for the detection of HBV-M, using real-time fluorescence quantitative PCR detection of HBV-DNA load. We analyze HBsAg in saliva, milk, the positive rate of HBV-DNA and HBV-M in serum, saliva, milk, and explore the positive rate of HBV-DNA and serum HBV-DNA load correlation. Results: At the age of 18 - 44 years old perinatal women, HBV-DNA positive rates of maternal serum, breast milk, saliva were 157 cases in A group HBsAg, HBeAg positive: 99.36%, 88.06%, 96.77%; in 312 cases in group B, HBeAb HBsAg, HBcAb positive: 17.63%, 2.93%, 54.67%; 69 cases in C group HBsAg, HBcAb positive: 63.77%, 27.27%, 28.57%; D group of 71 patients with simple HBcAb positive: 12.68%, 3.13%, 0%; E group and 86 cases in control group HBVM: 1.16%, 0%, 0%. According to the serum and milk testing of Group A and Group B, HBV-DNA chi-square is χ2 = 237.45, P ; there is a significant difference in serum and saliva; HBV-DNA chi-square χ2 = 289.49, P Conclusion: 1) HBV-DNA load high maternal blood, breast milk, saliva are potentially persistent hepatitis B virus infection risk, especially infectious blood. 2) Of maternal milk, saliva and blood HBV-DNA HBV-DNA load were positively correlated (r = 0.96; P ing, breast milk and saliva HBV-DNA positive rates were increased and infectivity enhanced. 3) Maternal blood, breast milk, saliva specimens for any HBV-DNA ≥ 1000 copies/ml are not breastfeeding. 4) The mother who carries the hepatitis B virus cannot do maternal infant feeding, and deep kiss intimate contact, in order to prevent blood, saliva and other ways of infection of hepatitis B virus. 5) Saliva testing is instead of milk inspection, because saliva is easier;</sp