FLT3 Internal Tandem Duplication Status Research Articles

Genetic risk stratification and outcomes among treatment-naive patients with AML treated with venetoclax and azacitidine

AbstractThe European LeukemiaNet (ELN) acute myeloid leukemia (AML) genetic risk classification systems are based on response to intensive chemotherapy; their ability to discriminate outcomes in older patients treated with venetoclax-azacitidine may be suboptimal. This pooled analysis of the phase 3 VIALE-A trial (NCT02993523) and phase 1b study (NCT02203773) examined prognostic stratification according to the 2017 and 2022 ELN risk classifications and derived new molecular signatures differentiating venetoclax-azacitidine–treated patients based on overall survival (OS). Overall, 279 patients treated with venetoclax-azacitidine and 113 patients treated with placebo-azacitidine were analyzed. The ELN 2017 or 2022 prognostic criteria classified most patients as adverse-risk AML (60.2% and 72.8% for venetoclax-azacitidine and 65.5% and 75.2% for placebo-azacitidine, respectively). Although outcomes with venetoclax-azacitidine improved across all ELN risk groups compared with placebo-azacitidine, ELN classification systems poorly discriminated venetoclax-azacitidine outcomes. By applying a bioinformatic algorithm, new molecular signatures were derived differentiating OS outcomes with venetoclax-azacitidine. The mutational status of TP53, FLT3 internal tandem duplication (FLT3-ITD), NRAS, and KRAS categorized patients into higher-, intermediate-, and lower-benefit groups (52%, 25%, and 23% of patients, respectively), each associated with a distinct median OS (26.5 months [95% confidence interval (CI), 20.2-32.7]; 12.1 months [95% CI, 7.3-15.2]; and 5.5 months [95% CI, 2.8-7.6], respectively). ELN prognostic classifiers did not provide clinically meaningful risk stratification of OS outcomes in patients treated with venetoclax-azacitidine. TP53, FLT3-ITD, NRAS, and KRAS mutation status allows the classification of these patients into 3 risk groups with distinct differences in median OS. These trials were registered at www.clinicaltrials.gov as #NCT02993523 and #NCT02203773.

The Benefit of Allogeneic Transplant in 1 st Complete Remission in NPM1 Mutated AML with or without FLT3 ITD Is Restricted to Those Testing MRD Positive after Induction - an Analysis of the UK NCRI AML17 and AML19 Studies

Background While there is accumulating evidence that measurable residual disease (MRD) negative patients with intermediate risk AML may not benefit from allogeneic transplantation in 1 st complete remission (CR1-allo), many consider the presence of a FLT3 Internal Tandem Duplication (ITD) an indication for this procedure. However, the studies supporting this practice were mainly performed before the development of sensitive molecular MRD techniques (Schlenk NEJM 2008).The UK NCRI AML17 and AML19 trials studied, then incorporated, MRD by RT-qPCR into the management of patients with NPM1 mutated AML. Methods NCRI AML17 (April 2009 to December 2014) and AML19 (November 2015 to November 2020) were sequential prospective randomised trials for younger adults (18 - 60 years) with newly diagnosed AML. In AML17, decisions regarding CR1-allo were made using a validated risk score incorporating baseline factors and response to induction. In AML19, for patients with NPM1 mutated AML ( NPM1mut) the protocol recommended CR1-allo only in patients testing MRD positive in the peripheral blood (PB) post cycle 2 (PC2), regardless of other baseline risk factors such as FLT3 ITD, based on findings from AML17 (Ivey et al, NEJM 2016). Both trials were performed prior to the availability of midostaurin and FLT3 ITD MRD assays. Here we compare the outcomes of patients with NPM1mut in these trials and assess the benefit of CR1-allo according to FLT3 ITD and molecular MRD status. Time-to-event variables are analysed using the Kaplan-Meier method, and the impact of alloSCT assessed using time-dependent Cox regression and visualised with Simon-Makuch plots. Molecular relapses were included as relapse events, and alloSCT performed after molecular relapse was not considered as CR1. Results 737 patients with NPM1mutAML who achieved CR/CRi and had a valid PC2 PB MRD result were included in the analysis. 60/348 (17%) patients from AML17 and 83/389 (21%) from AML19 tested PB PC2 MRD positive. Overall, CR1-allo was performed in 20% of patients in AML17 and 25% in AML19. Of the MRD positive patients CR1-allo was performed in 16/60 (27%) in AML17 compared to 50/83 (60%) in AML19 where these patients were recommended for transplant. CR1-allo was performed in 18% and 16% of MRD negative patients in AML17 and AML19 respectively. In AML17, as previously reported (Ivey et al, NEJM 2016), patients who were MRD+ had poor outcomes, with 3-year cumulative incidence of relapse (CIR) of 84% and overall survival (OS) of 25%. These outcomes were improved in AML19, with 3y CIR 50% and 3y OS 51%. Across both trials, CR1-allo was associated with a significant survival benefit in MRD+ patients (3y OS 61% vs 24%, HR 0.42, 95%CI 0.26-0.69, p<0.001, Figure A). Patients who were MRD negative had excellent outcomes in both trials (3y CIR 33% and 24% and 3y OS 75% and 83% for AML17 and AML19 respectively). AlloSCT in CR1 provided no survival advantage for MRD- patients (HR 0.83, 95%CI 0.51-1.34, p=0.4). There were a total of 286 patients with NPM1mutFLT3 ITD mut AML with a PC2 PB MRD result across both trials. 81/286 (28%) were PB PC2 MRD+ of whom 32/81 (40%) received CR1-allo (28% in AML17 and 49% in AML19). Outcomes in these high-risk patients were improved in AML19, with 3y CIR 91% vs 68% and 3y OS 22% and 31% for AML17 and AML19 respectively. Those who received CR1-allo had improved outcomes (3y OS 45% vs 18%, HR 0.52, 95% CI 0.29-0.93, p=0.03) consistent with the overall MRD+ population. In the 70% of NPM1mutFLT3 ITD mut AML patients who achieved PB PC2 MRD-, outcomes were encouraging in both AML17 (3y CIR 37%, 3y OS 75%) and AML19 (3y CIR 27%, 3y OS 80%). CR1-allo was performed in 20% (19% in AML17, 21% in AML19), with no survival benefit for transplant (HR 0.80, 95% CI 0.37-1.72, p=0.6, Figure B). There remained no benefit when restricted to those with high (>0.5) FLT3 ITD allelic ratio (HR 0.63, 95% CI 0.2 - 2.23, p = 0.50) and there was also no evidence of an interaction between allelic ratio and benefit from transplant for MRD negative patients (p=0.86). Conclusion Molecular MRD can be used to stratify decision making concerning post remission therapy in patients with NPM1mut AML. Patients who achieve MRD negativity in the peripheral blood by the end of course 2 are at low risk of relapse and we found no evidence of benefit from allogeneic transplant in CR1, including in the subset with FLT3 ITD. This finding contrasts with MRD+ patients where there was a significant survival benefit for CR1 transplant.

The FLT3 internal tandem duplication mutation at disease diagnosis is a negative prognostic factor in myelodysplastic syndrome patients

The role of the FMS-like tyrosine kinase 3 (FLT3) gene in acute myeloid leukemia (AML) has been well documented and the FLT3-internal tandem duplication (FLT3-ITD) mutation has been identified as a prognostic factor in AML. Due to its low incidence, the role of the FLT3 mutation remains unclear in myelodysplastic syndrome (MDS) patients. To investigate the impact of the FLT3-ITD status on the prognosis of MDS at diagnosis, we retrospectively analyzed 72 MDS patients admitted to Teikyo University Hospital. FLT3-ITD was examined by a reverse transcription-polymerase chain reaction using complementary DNA synthesized from mRNA extracted from bone marrow mononuclear cells at the diagnosis of MDS. Fifteen patients (20.8 %) were positive for FLT3-ITD and had significantly worse overall survival (OS) and progression-free survival (PFS) than patients who were negative (P < 0.001 and P < 0.001, respectively) in a multivariate analysis. We also investigated whether the Wilms’ tumor gene-1 (WT-1) copy number was associated with the FLT3-ITD mutational status using data available on WT-1 from 57 patients. A WT-1 transcript copy number ≥50/μg total mRNA in peripheral blood was detected in 35 patients (61.4 %). All FLT3-ITD-positive patients showed WT-1 ≥50. The FLT3-ITD-positive group showed significantly higher WT-1 transcription levels than the negative group. These results indicate that the FLT3-ITD mutation has a prognostic impact at the diagnosis of MDS and is associated with a high level of WT-1.

Preclinical Development of LNA Antimir-155 (MRG-106) in Acute Myeloid Leukemia

IntroductionMicroRNAs (miRs) are deregulated in AML and play a key role in leukemogenesis. MiR-155 is one of the most frequently overexpressed miRs in AML. Higher expression of miR-155 is associated with FLT3 internal tandem duplication (FLT3-ITD) and is associated with worse outcome, independent of FLT3-ITD status. Preliminary data shows that silencing of miR-155 induces strong antileukemic effects in AML cell lines. Altogether these data support a therapeutic role for miR-155 antagonism in AML. Here, we show the in vitro and in vivo activity of MRG-106, a novel LNA antimiR-155 compound that we are developing as a potential treatment for hematological malignancies.MethodsUnconjugated, LNA-modified oligonucleotide against miR-155 (MRG-106) was developed by miRagen Therapeutics, Inc. MRG-106 was evaluated in FLT3-ITD+ AML cell lines and primary FLT3-ITD+ AML samples for impact on apoptosis and cellular proliferation using Annexin V and MTS assays. Predicted and validated targets of miR-155 were measured by qPCR and Western Blotting to assess the efficacy of miR-155 silencing. The in vivo antileukemic effect of MRG-106 was evaluated in NOD/SCID gamma mice engrafted with MV4-11 AML cells that have elevated miR-155 expression. One week after leukemic cell inoculation, the mice were separated in 3 cohorts and received either MRG-106 (n=12); LNA-scramble control (n=12); or saline (n=6).ResultsInhibition of miR-155 decreased cell proliferation in MV-4-11 and MOLM-13 cells at 48hrs (Absorbance 450 nM (A450nM): 0.5 and 0.4 vs controls 2.4 and 2.5, respectively, p<0.01). These effects were associated with increased apoptosis (2-fold increase in Annexin staining) and re-expression of the validated miR-155 target WEE1 protein. MRG-106 produced a 4-6 fold increase in apoptosis in primary samples from 3 newly diagnosed AML patients with FLT3 -ITD cytogenetically normal AML (p<0.01). In addition, inhibition of miR-155 reduced the colony forming ability of the primary blasts (average # of colonies; controls=90 vs. MRG-106=55,p<0.01). In an MV4-11 xenograft model, MRG-106 significantly increased survival compared to controls (p<0.01). Biodistribution studies confirmed adequate MRG-106 distribution to bone marrow. GLP preclinical safety studies have been completed in rats and non-human primates, demonstrating an acceptable safety profile for MRG-106.ConclusionsInhibition of miR-155 in AML cell lines and primary AML samples in vitro and in vivo induces significant antileukemic effects. These studies validate miR-155 as a therapeutic target in AML and support the testing of MRG-106 in AML patients in the context of a phase 1 clinical trial. DisclosuresDickinson:miRagen Therapeutics: Employment, Equity Ownership. Jackson:miRagen Therapeutics: Employment, Equity Ownership. Rodman:miRagen Therapeutics: Employment, Equity Ownership.

MicroRNAs in Intermediate Risk Cytogenetic Acute Myeloid Leukemia Add Relevant Prognostic Information to Molecular Categorization

Abstract 235The prognosis of AML patients within the intermediate cytogenetics category is mainly determined by the mutational status of some relevant genes, such as NPM1 mutations (NPMmut), or biallelic CEBPA mutations (CEBPAmut), associated with a favorable outcome, and with the presence of FLT3 internal tandem duplication (FLT3-ITD), which correlates with an adverse prognosis. Nonetheless, additional biological features such as microRNA (miRNA) expression pattern might contribute to refine prognosis and guide therapy in this setting.The aim of the present study is to investigate whether miRNA expression is associated with molecular characteristics and clinical outcome in intermediate-risk AML patients (IR-AML).We have analyzed samples from 85 IR-AML patients (median age, 52 [range, 18–71]; 52% males) who received intensive therapy from 1994 to 2009. Forty-three patients (51%) harbored NPMmut, 37 (44%) harbored FLT3-ITD (including 23 with NPMmut), and 11 (13%) harbored CEBPAmut, including 7 with biallelic mutations. The expression of 670 mature miRNAs was analyzed by multiplex Real Time PCR using TaqMan Human MicroRNA Arrays (Applied Biosystems). All PCR reactions were performed using an ABI 7900 HT sequence detection system. miRNA expression data was analyzed by the 2−DDCt method, using RNU48 as endogenous control. Statistical analysis was performed with BRB Array Tools, SPSS version 15.0.1 and R software version 2.9.0.Supervised analysis by means of t-test based on multiplex permutations (class comparisons analysis, p<0.001) revealed a distinctive miRNA signature in patients with NPMmut, with overexpression of miR-10a, miR-10a*, miR-10b and miR-196b, and downregulation of miR-126, miR126*, miR-424, miR-424* and miR-335, as well as patients with biallelic CEBPAmut, characterized by downregulation of miR-196b and upregulation of miR-181a. Response rate in this series of patients was 84%, with 5-year survival of 43±11% and relapse incidence (RI) of 55±14%. Multivariate analysis for overall survival(OS) including NPM status, FLT3-ITD status, age, WBC, and Log Rank OS significant miRNAs (miR-632, miR-23b, miR-409-3p, let-7a*, miR-565 and miR-196b) identified age, absence of NPMmut, and FLT3-ITD as unfavorable variables together with low expression of miR-409-3p (p<0.001; HR=3.3, 95% CI: 1.7–6.4), and increased level of let-7a* (p=0.026; HR=5.1, 95% CI: 1.21–21.5) and miR-196b (p=0.056; HR=7.27, CI: 0.95–55.6). Concerning risk of relapse (RR), multivariate analysis including NPM status, age, FLT3-ITD, WBC, and Log Rank RR significant miRNAs (miR-632, miR-155*, miR-135a, miR-409-3p, miR-150, miR-23a* and miR-363) the absence of NPMmut, FLT3-ITD and increasing leukocyte count were associated with a higher RI. Remarkably, decreased miR-409-3p expression (p=0.011; HR=3.3, 95% CI: 1.3–8.2) and miR-135a (p=0.02; HR=4.2, 95% CI: 1.2–14.2), together with higher levels of miR-23a* (p<0.001; HR=6.2, 95% CI: 2.61–14.7) were independently associated with a higher relapse risk. Of note, a decreased miR-409-3p level retained its adverse prognosis value in the subgroup of patients without favorable molecular markers (i.e., wild-type NPM1 and CEBPA and/or FLT3-ITD;p=0.001) together with low miR-361-3p (p=0.013, HR= 2.4, CI: 1.2–5.1). On the contrary, let-7a* levels segregated subgroups of patients in the category of favorable genotype (i.e., mutated NPM1 without FLT3-ITD p=0.027).In this series of patients of intermediate-risk cytogenetic AML, measurement of expression levels of several miRNAs such as miR-409-3p, miR-135a, let-7a* or miR-23a* showed independent prognostic value, and contribute to predict the outcome within specific molecular subgroups. Nonetheless, confirmation of the prognostic impact of these miRNAs and investigation of possible underlying mechanisms account for this effect require future studies. Disclosures:No relevant conflicts of interest to declare.

High Cytogenetic or Molecular Genetic Risk Acute Myeloid Leukemia

Resistance, manifested as failure to enter remission despite living long enough to do so or as relapse from remission, is the principal cause of therapeutic failure in acute myeloid leukemia, even in patients age ≥ 75. Recently, a "monosomal karyotype" in acute myeloid leukemia blasts has been found to be a principal predictor of resistance. It is also clear that patients with a normal karyotype, and other intermediate prognosis karyotypes, can be placed into a high-risk group based on the absence of a mutation in the NPM1 gene or the presence of an internal tandem duplication (ITD) of the Fms-like tyrosine kinase 3 gene (FLT3) gene, particularly if there is loss of the wild-type FLT3 allele. The effects of other genetic abnormalities have been inconsistent, perhaps reflecting differences in expression of the abnormality and its translation into protein. Several reports have shown the prognostic potential of profiling global gene expression, micro-RNA expression, DNA methylation, and proteomics. Although routine application of these approaches is still premature, pretreatment assessment of the nucleophosmin 1 (NPM1) mutation and FLT3 ITD status, as well as cytogenetics, should be routine. These results can be used to guide the choice of remission induction therapy, for example, by placing patients with monosomal karyotype or FLT3 ITDs on clinical trials. Allogeneic hematopoietic cell transplant in first complete remission is generally indicated for high-risk patients. However, new approaches are needed to reduce the high rates of relapse, even after hematopoietic cell transplant.

An 86-Probe Gene Expression Signature Can Predict Survival in AML with Normal Karyotype Independently of FLT3 ITD and NPM1 Mutation Status - A Collaborative Study from the AMLCG and CALGB Study Groups.

Patients with acute myeloid leukemia and a normal karyotype (NK AML) comprise 50% of all AML cases and show heterogeneous treatment outcomes and survival. We used gene expression profiling to develop a prognostic gene signature that predicts survival in this clinically relevant AML subgroup. Our analysis was based on data from 163 patients with newly diagnosed NK AML treated in the German multicenter AMLCG 2000 trial, for whom pretreatment gene expression profiles were obtained using Affymetrix HG-U133 microarrays. We used supervised principal component analysis to identify 86 oligonucleotide probesets (corresponding to 66 different genes and ESTs) that were correlated with overall survival (OS), and to define a prognostic score based on these probesets. When applied to an independent test cohort of 79 NK AML cases from the same AMLCG trial, the continuous prognostic score was predictive of OS (P=0.002, hazard ratio [HR] for a change in prognostic score equal to the difference between the 75th and 25th percentiles of the score = 1.94) and event-free survival (EFS) (P = 0.001, HR=1.70). The score based on our gene signature showed a strong correlation with the presence of the FLT3 internal tandem duplication (ITD), but retained its prognostic value for OS in the test cohort even after adjustment for FLT3 ITD, NPM1 status and age (P=0.037, HR=1.65). When we defined a cut-off value in the training population and used it to dichotomize the gene expression score values in the test cohort, the resulting two subgroups had significantly different OS (median, 259 days vs. not reached, P=0.002) and event-free survival (EFS) (median, 72 vs. 300 days, P = 0.015). We subsequently confirmed our findings in a group of 64 NK AML patients (Blood 2006; 108:1677–83) treated on CALGB 9621. In this validation cohort, our continuous gene expression score was predictive of OS (P < 0.001, HR=4.11) and EFS (P < 0.001, HR=2.90). In multivariate analyses that adjusted for age, NPM1 and FLT3 ITD status, the gene expression score remained significant for OS (P = 0.007, HR=3.40). When we used the prognostic score to split the CALGB validation cohort into two groups, based on the same cut-off value as in the AMLCG test population, the two resulting subgroups differed in their OS (median, 375 days vs. not reached, P < 0.001) and EFS (median, 258 vs. 728 days, P = 0.027). In summary, we present a novel and robust gene expression signature that offers independent prognostic information for patients with normal karyotype AML.

Assessment of Multidrug Resistance and FLT3 Internal Tandem Duplication in Patients with Plasmacytoid Dendritic Cell Leukemia.

Plasmacytoid dendritic cell leukemia (pDCL) is a rare hematological malignancy, characterized by the expression of CD123hi, CD4+, CD56+ and absence of myeloid or lymphoid markers. Patients usually have an aggressive clinical course, short survival and increased rates of relapse after chemotherapy. We report the clinical, biological, phenotypic features of three cases of pDCL and their multidrug resistance profile (MDR) and FLT3 internal tandem duplication (FLT3-ITD) status.Methods and Results: we reanalyzed 193 patients with acute leukemia, studied at the laboratory of Cellular Biology and Flow Cytometry at diagnosis, between 2002 and 2006. Among them three patients presented imunnophenotypic features of dendritic cell malignancy. At diagnosis, patients (2M/1F, aged 63, 64 and 74 y) presented anemia, thrombocytopenia and the WBC count was 6.7, 12.6 and 45.1×109/L, with circulating blast cells in two cases (69% and 80%). Bone marrow blasts showed L2/M0 (one case) or monocytoid morphology (2 cases). Lymph nodes enlargement and splenomegaly in one case and cutaneous lesions in one other case were observed. Multiparametric flow cytometry using a large panel of monoclonal antibodies showed the presence of CD123hi, CD4, HLA-DR and CD45dim in all cases, CD56 in two and the absence of any lineage-associated markers expression (CD13-, CD117-, CD15-, CD14-, CD64-, MPO-, CD41-, CD3-, CD19-, CD16-). Karyotype was available in one patient and it was normal. MDR was studied on leukemic cells by Rhodamine 123 efflux test in the presence/absence of Verapamil, using flow cytometry. All three cases showed increased rates of functional drug efflux. The FLT3-ITD was assessed by polymerase chain reaction in mononuclear cells DNA using the following primers: 14F (GCAATTTAGGTATGAAAGCAGC) and 15R (CTTTCAGCATTTTGACGGCAACC) and it was negative in all patients. Two patients were submitted to chemotherapy (BFM-ALL-5/93 protocol in one and Idarubicin + Cytarabine in another). One patient was resistant to IDA+ Cytarabine and the other died 20 days after BFM protocol induction by infection. The untreated patient died one month later.Discussion To our knowledge, these are the first cases of dendritic cell malignancies where the MDR functional expression and FLT3-ITD status were evaluated. Additionally, they are the first Brazilian cases of pDCL reported. None of the patients presented the FLT3-ITD; moreover a recent study (Dijkman R et al, Blood, 2007) of gene expression profile using microarray demonstrated that FLT3 mRNA was upregulated on pDCL. Our results suggest that the expression of MDR might contribute to the adverse outcome in this rare entity and to the poor response to chemotherapy described by others. Literature data suggest intensive treatment with bone marrow transplantation for pDCL but the addition of MDR-modulators to the chemotherapy schedules might be useful for the management of this disorder, especially in elderly patients.

Independent Validation of Prognostic Relevance of a Previously Reported Gene-Expression Signature in Acute Myeloid Leukemia (AML) with Normal Cytogenetics (NC): A Cancer and Leukemia Group B (CALGB) Study.

The heterogeneous clinical outcome of NC AML patients (pts), who constitute about 45% of AML pts and are assigned to an intermediate-risk category, likely reflects a biologic diversity. Although mutations in FLT3, MLL, CEBPA and NPM genes and overexpression of BAALC at diagnosis can stratify prognostically NC AML, novel approaches may improve the predictive value of these markers. cDNA microarrays were used recently to gain insight into the biologic and clinical heterogeneity of NC AML. Bullinger et al. (NEJM 2004; 350:1605) reported a set of 133 genes represented by 149 cDNAs (Suppl. Table 6, www.ncbi.nlm.nih.gov/geo/ , accession #GSE425) that separated NC AML into 2 cluster-based groups with significant differences in overall survival (OS) (Bullinger et al. Fig. 4D), albeit the number of pts analyzed was small. Hence, we sought to validate this signature in a larger, independent set of adults (n=64), <60 years, with primary NC AML, treated on CALGB 9621. Pretreatment samples were analyzed using Affymetrix U133 plus 2.0 GeneChips (Affymetrix, Santa Clara, CA). Normalization to a baseline array with median overall brightness and probe-set level expression computation were performed with dChip version 1.3. The log (base 2) of expression values were exported to BRB-ArrayTools v3.2.3 for analysis. Of the 133 genes from Bullinger et al., 81, represented by 157 probe sets, were on the Affymetrix chip and were expressed in ≥ 25% of our specimens. Hierarchical clustering, using the 157 probe sets, resulted in cluster I, corresponding to the poor-, and cluster II, corresponding to the good-outcome group in Bullinger et al. With a 4.7-year median follow-up, cluster I pts had lower estimated 5-year DFS (24% vs. 60%; P=.001; Fig. 1A) and OS (28% vs. 64%; P=.001; Fig. 1B) rates than cluster II pts. The 2 groups had similar complete remission rates (81% vs. 89%). With regard to pretreatment features, cluster I pts were younger (P=.06), had lower % skin infiltrates (P=.03), higher % marrow blasts (P=.06), different distribution of FAB subtypes (P=.04) with a high % M4, and higher incidence (67% vs. 12%) of FLT3 internal tandem duplication (ITD) (P<.001). A multivariable model including gene-expression cluster membership, FLT3 ITD status by Genescan analysis, and their interaction was fit to determine if the gene-expression signature added any information once accounting for FLT3 ITD status. A significant interaction of the gene-expression signature and FLT3 status was observed for DFS (P=.009) and OS (P=.01), where the gene-expression signature predicted DFS (P=.02) and OS (P=.02) only in pts with wild-type (wt) FLT3 but not in those with FLT3 ITD, who had adverse outcome irrespective of the gene-expression signature. Cluster I pts with wtFLT3 had >3x the risk of relapse and death than the corresponding cluster II pts. In conclusion, we independently validated for the first time the prognostic value of a gene-expression signature in NC AML. This expression profiling appears particularly useful in predicting outcome of pts lacking the prognostically adverse FLT3 ITD. [Display omitted]