Florida Isolate Research Articles

Feeding Selectivity of Aphelenchoides besseyi and A. pseudogoodeyi on Fungi Associated with Florida Strawberry.

Aphelenchoides besseyi and A. pseudogoodeyi are foliar nematodes associated with commercial strawberry production in Florida, United States. The reproductive and feeding habits of these two nematode species were assessed on Florida isolates of the fungi Botrytis cinerea, Colletotrichum gloeosporioides, Macrophomina phaseolina, and Neopestalotiopsis rosae, which are pathogenic to strawberry, and nonpathogenic isolates of Fusarium oxysporum and Monilinia fructicola grown on potato dextrose agar in Petri dishes. Each culture was inoculated with six specimens of mixed life stages of A. besseyi or A. pseudogoodeyi and incubated at 24°C under axenic and nonaxenic conditions 23 and 31 days after inoculation, respectively. A. besseyi reproduction rates were greater on strawberry-pathogenic isolates of B. cinerea, C. gloeosporioides, and N. rosae than on the nonpathogenic isolates of F. oxysporum and M. fructicola. In contrast, reproductive rates of A. pseudogoodeyi did not vary among fungi cultures. For both nematode species, M. phaseolina was a poor host because it did not produce mycelium on the media used. Our findings indicate that A. besseyi is more selective in its fungal-feeding preference than A. pseudogoodeyi. Additionally, A. pseudogoodeyi eggs and juveniles were significantly more numerous than adults. Yet, for A. besseyi, adult stages were more abundant. Fungi aid in the maintenance of soil-dwelling populations of these two nematode species. Removing fungus-infected strawberry plant residues is both a desirable and effective management practice to limit A. besseyi in central Florida commercial strawberry fields.

Temperature Effects on Development of Meloidogyne Enterolobii and M. Floridensis.

Meloidogyne enterolobii and M. floridensis are virulent species that can overcome root-knot nematode resistance in economically important crops. Our objectives were to determine the effects of temperature on the infectivity of second-stage juveniles (J2) of these two species and determine differences in duration and thermal-time requirements (degree-days [DD]) to complete their developmental cycle. Florida isolates of M. enterolobii and M. floridensis were compared to M. incognita race 3. Tomato cv. BHN 589 seedlings following inoculation were placed in growth chambers set at constant temperatures of 25°C, and 30°C, and alternating temperatures of 30°C to 25°C (day–night). Root infection by the three nematode species was higher at 30°C than at 25°C, and intermediate at 30°C to 25°C, with 33%, 15%, and 24% infection rates, respectively. There was no difference, however, in the percentages of J2 that infected roots among species at each temperature. Developmental time from infective J2 to reproductive stage for the three species was shorter at 30°C than at 25°C, and 30°C to 25°C. The shortest time and DD to egg production for the three species were 13 days after inoculation (DAI) and 285.7 DD, respectively. During the experimental timeframe of 29 d, a single generation was completed at 30°C for all three species, whereas only M. floridensis completed a generation at 30°C to 25°C. The number of days and accumulated DD for completing the life cycle (from J2 to J2) were 23 d and 506.9 DD for M. enterolobii, and 25 d and 552.3 DD for M. floridensis and M. incognita, respectively. Exposure to lower (25°C) and intermediate temperatures (30°C to 25°C) decreased root penetration and slowed the developmental cycle of M. enterolobii and M. floridensis compared with 30°C.

Tecnologic Development on Pleurotus Cultivation: Specific Practices Used in Brazil

HIGHLIGHTS P. ostreatus and P. sapidus are the most productive species under the evaluated conditions. Different growing systems are suitable for the production of P. ostreatus var. Florida. Temperature control level affects differently the P. ostreatus var. Florida isolates. Environmental and strain factors affect yield and production parameters of P. ostreatus var. Florida.

Tomato Yellow Leaf Curl Virus-Resistant and -Susceptible Tomato Genotypes Similarly Impact the Virus Population Genetics.

Tomato yellow leaf curl virus is a species in the genus Begomovirus and family Geminiviridae. Tomato yellow leaf curl virus (TYLCV) infection induces severe symptoms on tomato plants and causes serious yield losses worldwide. TYLCV is persistently transmitted by the sweetpotato whitefly, Bemisia tabaci (Gennadius). Cultivars and hybrids with a single or few genes conferring resistance against TYLCV are often planted to mitigate TYLCV-induced losses. These resistant genotypes (cultivars or hybrids) are not immune to TYLCV. They typically develop systemic infection, display mild symptoms, and produce more marketable tomatoes than susceptible genotypes under TYLCV pressure. In several pathosystems, extensive use of resistant cultivars with single dominant resistance-conferring gene has led to intense selection pressure on the virus, development of highly virulent strains, and resistance breakdown. This study assessed differences in TYLCV genomes isolated from susceptible and resistant genotypes in Florida and Georgia. Phylogenetic analyses indicated that Florida and Georgia isolates were distinct from each other. Population genetics analyses with genomes field-collected from resistant and susceptible genotypes from Florida and/or Georgia provided no evidence of a genetic structure between the resistant and susceptible genotypes. No codons in TYLCV genomes from TYLCV-resistant or susceptible genotypes were under positive selection, suggesting that highly virulent or resistance-breaking TYLCV strains might not be common in tomato farmscapes in Florida and Georgia. With TYLCV-resistant genotypes usage increasing recently and multiple tomato crops being planted during a calendar year, host resistance-induced selection pressure on the virus remains a critical issue. To address the same, a greenhouse selection experiment with one TYLCV-resistant and susceptible genotype was conducted. Each genotype was challenged with TYLCV through whitefly-mediated transmission serially 10 times (T1-T10). Population genetics parameters at the genome level were assessed at T1, T5, and T10. Results indicated that genomes from resistant and susceptible genotypes did not differentiate with increasing transmission number, no specific mutations were repeatedly observed, and no positive selection was detected. These results reiterate that resistance in tomato might not be exerting selection pressure against TYLCV to facilitate development of resistance-breaking strains. TYLCV populations rather seem to be shaped by purifying selection and/or population expansion.

Genomic and Phylogenetic Analysis of Zika Virus Isolates from Asymptomatic Blood Donors in the United States and Puerto Rico, 2016

Zika virus (ZIKV) caused a public health threat in the United States in 2016, leading to rapid development and implementation of blood screening assays for ZIKV RNA. Several ZIKV sequences from clinical cases have been reported, but none from asymptomatic/pre-symptomatic infections. We isolated and sequenced ZIKV from asymptomatic/pre-symptomatic blood donor (ABD-ZIKV) samples and compared with reported clinical sequences. Twelve ABD-ZIKV isolates were produced from 67 cultivated samples, and isolates were genetically similar among themselves. Most isolates shared mutations with the clinical isolate PRVABC59 2015, whereas two ABD-ZIKV isolates shared specific mutations with U.S. clinical isolates from 2016. The ABD-ZIKV strains clustered into two distinct subclades: one comprised mostly ABD-ZIKV from Puerto Rico, and another one comprised ABD-ZIKV from Florida and QTX-02 isolate (Puerto Rico). In this study, we showed the circulation of two slightly distinct virus strains among Puerto Rico blood donors, one of which was also reported in Florida.

Genome-wide analyses of Liberibacter species provides insights into evolution, phylogenetic relationships, and virulence factors.

‘Candidatus Liberibacter’ species are insect‐transmitted, phloem‐limited α‐Proteobacteria in the order of Rhizobiales. The citrus industry is facing significant challenges due to huanglongbing, associated with infection from ‘Candidatus Liberibacter asiaticus’ (Las). In order to gain greater insight into ‘Ca. Liberibacter’ biology and genetic diversity, we have performed genome sequencing and comparative analyses of diverse ‘Ca. Liberibacter’ species, including those that can infect citrus. Our phylogenetic analysis differentiates ‘Ca. Liberibacter’ species and Rhizobiales in separate clades and suggests stepwise evolution from a common ancestor splitting first into nonpathogenic Liberibacter crescens followed by diversification of pathogenic ‘Ca. Liberibacter’ species. Further analysis of Las genomes from different geographical locations revealed diversity among isolates from the United States. Our phylogenetic study also indicates multiple Las introduction events in California and spread of the pathogen from Florida to Texas. Texan Las isolates were closely related, while Florida and Asian isolates exhibited the most genetic variation. We have identified conserved Sec translocon (SEC)‐dependent effectors likely involved in bacterial survival and virulence of Las and analysed their expression in their plant host (citrus) and insect vector (Diaphorina citri). Individual SEC‐dependent effectors exhibited differential expression patterns between host and vector, indicating that Las uses its effector repertoire to differentially modulate diverse organisms. Collectively, this work provides insights into the evolution of ‘Ca. Liberibacter’ species, the introduction of Las in the United States and identifies promising Las targets for disease management.

Reactions of Soybean Germplasm Accessions to Six Phakopsora pachyrhizi Isolates from the United States

Soybean rust, caused by Phakopsora pachyrhizi Syd. & P. Syd., is one of the most economically important foliar diseases of soybean. Resistant cultivars could reduce yield losses and management costs but considerable pathogenic diversity exists among populations of the fungus; thus, resistance to a range of pathotypes is essential. Seedling and detached-leaf assays were conducted to characterize the resistance of 55 soybean plant introductions (PIs) to six purified isolates of P. pachyrhizi originating from the southern United States. In the greenhouse resistance assays, the differentials Hyuuga (PI 506764) and PI 471904 and accessions PI 224268, PI 567025A, PI 567039, PI 567046A, and DT 2000 (PI 635999) were resistant to all six isolates, including Florida isolates from 2011 and 2012 that were able to defeat resistance conditioned by the Rpp1 through Rpp4 genes. Twenty-six other PIs were resistant to four or five of the six isolates. In the detached-leaf assays, eight accessions developed reddish-brown reactions to all six isolates, with an average of only 0.23 to 0.55 uredinia/lesion. These included Hyuuga, DT 2000, two differentials with a resistance allele at the Rpp5 locus, and accessions PI 224268, PI 423960B, PI 567025A, and PI 567046A. Many of the resistant accessions have subsequently been reported to have a resistance allele at the Rpp3 locus, and two others have resistance genes at the Rpp4 or Rpp6 locus. This study provided new information about resistance reaction phenotypes that can be useful for understanding mechanisms of resistance, which Rpp genes and alleles could be combined to obtain broader and more durable rust resistance in soybean cultivars, and pathotype diversity among the six isolates used.

Complete Nucleotide Sequence of a Novel Hibiscus-Infecting Cilevirus from Florida and Its Relationship with Closely Associated Cileviruses.

ABSTRACTThe complete nucleotide sequence of a recently discovered Florida (FL) isolate of hibiscus-infecting cilevirus (HiCV) was determined by Sanger sequencing. The movement and coat protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HI (Hawaii) isolate.

High genetic variation and recombination events in the vicinity of non-autonomous transposable elements from ‘Candidatus Liberibacter asiaticus’

Two miniature inverted-repeat transposable elements (MITEs), MCLas-A and MCLas-B, were recently identified from ‘Candidatus Liberibacter asiaticus’ known to be associated with citrus Huanglongbing (HLB, yellow shoot disease). MCLas-A was suggested as an active MITE because of its mobility. The immediate upstream gene of the two MITEs was predicted to be a putative transposase. The goal of this study is to analyze the sequence variation in the upstream putative transposase of MITEs and explore the possible correlation between sequence variation of transposase gene and MITE activity. PCR and sequence analysis showed that 12 sequence types were found in six major amplicon types from 43 representative ‘Ca. L. asiaticus’ isolates from China, the United States and Brazil. Out of the 12 sequence types, three (T4, T5-2, T6) were reported for the first time. Recombination events were found in the two unique sequence types (T5-2 and T6) which were detected in all Brazilian isolates. Notably, no sequence variation or recombination events were detected in the upstream putative transposase gene of MCLas-A, suggesting the conservation of the transposase gene might be closely related with the MITE activity. Phylogenetic analysis demonstrated two well supported clades including five subclades were identified, clearly reflecting the geographical origins of isolates, especially that of Ruili isolates, São Paulo isolates and a few Florida isolates.

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5'-CTCGGTTTTCTGCTTTTC-3' and JAP886, 5'CGGACAGGCTGGAGAAATCG3') (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5'-CGTATCTGAGGATGTTGAGT-3' and JAP888, 5'-GCTAACTCCTTGTTCTTTTG-3'). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5'-AGTATTATGCATCTATAGATTAGCACA-3' and TCSV-R1, 5'-ACAAATCATCACATTGCCAGGA-') were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry.

Characterization of "Candidatus Liberibacter asiaticus" populations by double-locus analyses.

"Candidatus Liberibacter asiaticus" (CaLas) is associated with citrus Huanglongbing (HLB, yellow shoot disease), which is highly destructive to world citrus production. Understanding the relationships of CaLas isolates from different geographical regions is important for HLB research and development of disease management strategies. In this study, 301 CaLas isolates [85 Brazil, 132 China, and 84 U.S. (83 Florida and 1 California)] were collected, and genomic variations among them were evaluated based on the analyses of two genomic loci: trn1, characteristic of variable tandem repeat numbers (TRNs), and snp1, characteristic of single nucleotide polymorphisms (SNPs). Locus trn1 revealed the homogeneity of all Brazilian isolates, and locus snp1 revealed the homogeneity of most Florida isolates. When the two loci were analyzed simultaneously, i.e., double-locus (DL) analyses, CaLas isolates were clustered mostly according to geographical origins. DL genotype 1 included 97% of the Chinese isolates, DL genotype 2 included all Brazilian isolates, and DL genotype 3 included 93% of the U.S. isolates. DL analyses successfully revealed inter-continental overlapping or movement pattern of CaLas isolates. The isolate recently found in California belonged to Asiatic DL genotype 1.

Genetic variation among Phyllosticta strains isolated from citrus in Florida that are pathogenic or nonpathogenic to citrus

Citrus black spot is an emerging disease in Florida since 2010. The causal agent is Phyllosticta citricarpa (teleomorph Guignardia citricarpa), but non-pathogenic P. capitalensis (teleomorph often referred to as G. mangiferae) is often isolated from black spot lesions. Florida isolates of P. citricarpa and P. capitalensis from citrus have not been characterized in detail. In this study, Phyllosticta species isolated from Florida citrus were compared with worldwide isolates using multi-locus sequencing of four conserved loci (rDNA ITS, TEF1, ACT, and GPDH genes). Moreover, the diversity within the two Phyllosticta species was compared based on the same four loci. DNA sequences of P. citricarpa and P. capitalensis were clearly distinct, coinciding with other P. citricarpa and P. capitalensis sequences from different continents. The species showed different population structures in Florida. P. citricarpa isolates did not exhibit genetic variation and were similar to strains from other continents. In contrast, Florida P. capitalensis isolates were distributed over five sequence groups. This study did not point to the potential origin of P. citricarpa and P. capitalensis in Florida. More variable genetic markers and isolates from various continents would be required to track the possible movement of these Phyllosticta species.

First Report of Phakopsora pachyrhizi Adapting to Soybean Genotypes with Rpp1 or Rpp6 Rust Resistance Genes in Field Plots in the United States.

During the years following the first detection of soybean rust, caused by Phakopsora pachyrhizi Syd., in the continental United States in November, 2004, soybean (Glycine max [L.] Merr.) genotypes with the Rpp1 or Rpp6 resistance genes exhibited high levels of resistance there (1,2,3). When challenged with 72 different American isolates collected between 2006 and 2009, PI 200492 (source of Rpp1) produced no sporulating lesions (2). In 2011 and 2012, however, field populations of P. pachyrhizi from Gadsden County, FL, caused higher rust severity on plants with Rpp1 or Rpp6 than in previous years. To assess aggressiveness, sporulation ratings were made using a 1 to 5 scale (no sporulation to profuse sporulation) on leaflets collected from field plants at or near the R6 (full seed) stage of development. A dissecting microscope was used to examine 3 replications of 5 leaflets each in 2009 or 2 replications of 10 leaflets each in 2012. The sporulation ratings increased on PI 200492 (from 1.1 ± 0.1 in 2009 to 4.1 ± 0.4 in 2012), PI 567102B (Rpp6; from 1.1 ± 0.1 in 2009 to 2.4 ± 0.2 in 2012), and L85-2378, a 'Williams 82' isoline carrying the Rpp1 gene (from 1.0 ± 0 in 2009 to 4.0 ± 0.3 in 2012). The mean 2009 and 2012 sporulation ratings for susceptible control Williams 82 were 5.0 ± 0 and 4.2 ± 0.1, respectively. Single-uredinium-derived isolates were purified from bulk isolates collected from field plots in 2009 (FL-Q09-1), 2011 (FL-Q11-1), and 2012 (FL-Q12-1). Greenhouse and detached leaflet assays were then used to test the virulence of these isolates under controlled conditions. Detached leaflets from 3-week-old seedlings of Williams 82, PI 200492, PI 567102B, and L85-2378 were inoculated by pipetting 15-μl drops of a 30 to 40 urediniospore μl-1 suspension onto the abaxial side of 3 to 4 leaflets per genotype, which were then sealed in Petri plates and incubated in a growth chamber at 20 to 22°C. Plates were kept in the dark for 12 h following inoculation. For the greenhouse assay, the first trifoliolate leaves of at least 3 seedlings were each sprayed with 1.5 ml of a 40 urediniospore μl-1 suspension and incubated 24 h at 22 to 24°C in a dark mist chamber. The plants were then maintained at 22 to 24°C and 76 to 86% relative humidity in a greenhouse with 10 h of daylight on average. Two weeks after inoculation with FL-Q11-1 or FL-Q12-1, all of the genotypes had developed TAN lesions with abundant sporulation, indicating susceptibility. On leaves inoculated with FL-Q09-1, however, no visible reaction was observed on PI 200492, and PI 567102B developed reddish-brown (RB) lesions associated with incomplete resistance. Although the lesions on Rpp1 and Rpp6 greenhouse seedlings inoculated with the FL-Q11-1 and FL-Q12-1 isolates were slightly darker than those that developed on Williams 82 plants or on detached leaflets, the profuse sporulation that is characteristic of the TAN infection type was observed. The higher virulence of the 2011 and 2012 Florida isolates on two soybean genotypes with Rpp1 and one with Rpp6 confirmed the presence of a P. pachyrhizi pathotype in north-central Florida that is more virulent against these genes than earlier populations from the southeastern United States.

Detection and characterization of miniature inverted-repeat transposable elements in “Candidatus Liberibacter asiaticus”.

Miniature inverted-repeat transposable elements (MITEs) are nonautonomous transposons (devoid of the transposase gene tps) that affect gene functions through insertion/deletion events. No transposon has yet been reported to occur in “Candidatus Liberibacter asiaticus,” an alphaproteobacterium associated with citrus Huanglongbing (HLB, yellow shoot disease). In this study, two MITEs, MCLas-A and MCLas-B, in “Ca. Liberibacter asiaticus” were detected, and the genome was characterized using 326 isolates collected in China and Florida. MCLas-A had three variants, ranging from 237 to 325 bp, and was inserted into a TTTAGG site of a prophage region. MCLas-A had a pair of 54-bp terminal inverted repeats (TIRs), which contained three tandem repeats of TGGTAACCAC. Both “filled” (with MITE) and “empty” (without MITE) states were detected, suggesting the MITE mobility. The empty sites of all bacterial isolates had TIR tandem repeat remnants (TRR). Frequencies of TRR types varied according to geographical origins. MCLas-B had four variants, ranging from 238 to 250 bp, and was inserted into a TA site of another “Ca. Liberibacter” prophage. The MITE, MCLas-B, had a pair of 23-bp TIRs containing no tandem repeats. No evidence of MCLas-B mobility was found. An identical open reading frame was found upstream of MCLas-A (229 bp) and MCLas-B (232 bp) and was predicted to be a putative tps, suggesting an in cis tps-MITE configuration. MCLas-A and MCLas-B were predominantly copresent in Florida isolates, whereas MCLas-A alone or MCLas-B alone was found in Chinese isolates.

Epidemiology and Management of Fusarium Wilt of China Asters.

The epidemiology and strategies for management of Fusarium wilt of China aster (Callistephus chinensis) were studied in Connecticut and Florida, USA, by examining seed contamination, on-farm disease incidence, sanitation, host resistance, and various soil treatments. Five out of 25 commercial seed packages from three separate distribution companies assayed in Connecticut had seeds contaminated with the pathogen Fusarium oxysporum f. sp. callistephi. Farm surveys of two cut-flower farms in Connecticut had disease incidences of 32 and 58%, while in Florida, the incidence of the disease ranged from 0.002 to 71.2% in two cut-flower operations. All pathogenic isolates from seed and symptomatic plants in Connecticut were vegetatively compatible, suggesting a common origin. Pathogenic isolates from Florida and nonpathogenic isolates fell into different vegetative compatibility groups and may have had another origin. Sodium hypochlorite solutions (1%) eliminated the fungus from seeds and Styrofoam when applied as a soak or spray, respectively. Soil fumigation with methyl bromide + chloropicrin, 1,3-dichloropropene + chloropicrin, or metam sodium maintained Fusarium wilt at low levels at a Florida cut-flower production facility. Evaluations of disease resistance of 44 cultivars in the greenhouse identified eight cultivars with moderate resistance. Four cultivars were identified with moderate resistance in field trials and thus could serve as a source of resistant germplasm for future breeding programs. These findings should encourage growers to use sanitation protocols to prevent entry of the pathogen into their fields and to choose commercially available cultivars that have moderate resistance.

Genetic Variation and Exchange in Trypanosoma cruzi Isolates from the United States

Trypanosoma cruzi, the causative agent of Chagas disease, is a multiclonal parasite with high levels of genetic diversity and broad host and geographic ranges. Molecular characterization of South American isolates of T. cruzi has demonstrated homologous recombination and nuclear hybridization, as well as the presence of 6 main genetic clusters or “discrete typing units” (DTUs). Few studies have extensively investigated such exchange events and genetic diversity in North American isolates. In the current study, we genetically characterized over 50 US isolates from wildlife reservoirs (e.g., raccoons, opossums, armadillos, skunks), domestic dogs, humans, nonhuman primates, and reduviid vectors from nine states (TX, CA, OK, SC, FL, GA, MD, LA, TN) using a multilocus sequencing method. Single nucleotide polymorphisms were identified in sequences of the mismatch-repair class 2 (MSH2) and Tc52 genes. Typing based on the two genes often paralleled genotyping by classic methodologies using mini-exon and 18S and 24Sα rRNA genes. Evidence for genetic exchange was obtained by comparing sequence phylogenies of nuclear and mitochondrial gene targets, dihydrofolate reductase-thymidylate synthase (DHFR-TS) and the cytochrome oxidase subunit II- NADH dehydrogenase subunit I region (COII-ND1), respectively. We observed genetic exchange in several US isolates as demonstrated by incongruent mitochondrial and nuclear genes phylogenies, which confirms a previous finding of a single genetic exchange event in a Florida isolate. The presence of SNPs and evidence of genetic exchange illustrates that strains from the US are genetically diverse, even though only two phylogenetic lineages have been identified in this region.

Salivary gland hypertrophy virus of house flies in Denmark: prevalence, host range, and comparison with a Florida isolate

House flies (Musca domestica) infected with Musca domestica salivary gland hypertrophy virus (MdSGHV) were found in fly populations collected from 12 out of 18 Danish livestock farms that were surveyed in 2007 and 2008. Infection rates ranged from 0.5% to 5% and averaged 1.2%. None of the stable flies (Stomoxys calcitrans), rat-tail maggot flies (Eristalis tenax) or yellow dung flies (Scathophaga stercoraria) collected from MdSGHV-positive farms displayed characteristic salivary gland hypertrophy (SGH). In laboratory transmission tests, SGH symptoms were not observed in stable flies, flesh flies (Sarcophaga bullata), black dump flies (Hydrotaea aenescens), or face flies (Musca autumnalis) that were injected with MdSGHV from Danish house flies. However, in two species (stable fly and black dump fly), virus injection resulted in suppression of ovarian development similar to that observed in infected house flies, and injection of house flies with homogenates prepared from the salivary glands or ovaries of these species resulted in MdSGHV infection of the challenged house flies. Mortality of virus-injected stable flies was the highest among the five species tested. Virulence of Danish and Florida isolates of MdSGHV was similar with three virus delivery protocols, as a liquid food bait (in sucrose, milk, or blood), sprayed onto the flies in a Potter spray tower, or by immersiion in a crude homogenate of infected house flies. The most effective delivery system was immersion in a homogenate of ten infected flies/ml of water, resulting in 56.2% and 49.6% infection of the house flies challenged with the Danish and Florida strains, respectively.

First Report of Anthracnose Caused by Colletotrichum fragariae on Cyclamen in North Carolina.

In November 2009, cyclamen (Cyclamen persicum) plants with disease symptoms from a commercial greenhouse operation in the western part of North Carolina were sent to the Plant Diseases and Insect Clinic at North Carolina State University. Symptoms consisted of coalescing reddish and tan necrotic leaf spots with concentric circles. Other symptoms included darkened vascular tissue and decay of the corm, large roots, and petioles. Diseased leaves and stems were surface sterilized in 0.5% sodium hypochlorite for 3 min, air dried, and placed in petri dishes containing alkaline water agar. After 3 days of incubation at room temperature, fungal colonies were transferred to acidified potato dextrose agar. Isolation frequency after 5 days was 33% (three of nine pieces) and 16% (one of six pieces) from small leaf spots and petioles, respectively. Pure cultures of isolates were gray and black with abundant, aerial, gray whitish mycelia. Diseased plants were also incubated in a moist chamber at room temperature and sporulation was observed within 7 days. Conidia were tapered with rounded ends and produced in the acervulus and on the tips of setae, which is consistent with the morphology of described isolates of Colletotrichum fragariae. Similar setae were also observed directly on the fine roots of the original sample. The pathogenicity of single-spore cultures was tested by spraying four 2-month-old cyclamen plants with a conidial suspension (106 conidia/ml) and the plants were kept in a humid chamber for 24 h. Noninoculated controls (four plants) were sprayed with distilled water and subjected to the same conditions. The pathogenicity test was also repeated. Inoculated plants and controls were placed in a greenhouse with a temperature range from 22 to 25°C. After 7 to 10 days, symptomatic leaves and stems were observed on all the inoculated plants but not on the control plants. Fungi reisolated from 10 symptomatic leaf tissues had identical morphological features as the original isolates. Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits following the manufacturer's protocol (Qiagen Inc., Valencia, CA). Sequence analysis of the rRNA internal transcribed spacer (ITS) region of the cyclamen isolate (GenBank Accession No. HQ188923), based on the fragment amplified with ITS1 and ITS4 primers, showed 100% similarity to isolates of C. fragariae deposited in GenBank (Accession Nos. FJ172290 [ATCC MYA-4443 from cyclamen] and FJ810510 [ATCC MYA-4442 from silver date palm]) and Florida isolate C16 isolated from strawberry (1). In addition, the morphology and ITS sequences of the cyclamen isolate were identical to those of the C. fragariae voucher isolate from strawberry (GU174546). Results from disease symptoms, colony and spore morphology, pathogenicity tests, and ITS sequence analysis suggest that C. fragariae was the pathogen responsible for the disease symptoms on cyclamens. To our knowledge, this is the first report of a disease caused by C. fragariae on cyclamen in North Carolina and complements an earlier report from Florida (1). Reference: (1) S. J. MacKenzie et al. Plant Dis. 92:1432, 2008.

Diversity and plasticity of the intracellular plant pathogen and insect symbiont "Candidatus Liberibacter asiaticus" as revealed by hypervariable prophage genes with intragenic tandem repeats.

"Candidatus Liberibacter asiaticus" is a psyllid-transmitted, phloem-limited alphaproteobacterium and the most prevalent species of "Ca. Liberibacter" associated with a devastating worldwide citrus disease known as huanglongbing (HLB). Two related and hypervariable genes (hyv(I) and hyv(II)) were identified in the prophage regions of the Psy62 "Ca. Liberibacter asiaticus" genome. Sequence analyses of the hyv(I) and hyv(II) genes in 35 "Ca. Liberibacter asiaticus" DNA isolates collected globally revealed that the hyv(I) gene contains up to 12 nearly identical tandem repeats (NITRs, 132 bp) and 4 partial repeats, while hyv(II) contains up to 2 NITRs and 4 partial repeats and shares homology with hyv(I). Frequent deletions or insertions of these repeats within the hyv(I) and hyv(II) genes were observed, none of which disrupted the open reading frames. Sequence conservation within the individual repeats but an extensive variation in repeat numbers, rearrangement, and the sequences flanking the repeat region indicate the diversity and plasticity of "Ca. Liberibacter asiaticus" bacterial populations in the world. These differences were found not only in samples of distinct geographical origins but also in samples from a single origin and even from a single "Ca. Liberibacter asiaticus"-infected sample. This is the first evidence of different "Ca. Liberibacter asiaticus" populations coexisting in a single HLB-affected sample. The Florida "Ca. Liberibacter asiaticus" isolates contain both hyv(I) and hyv(II), while all other global "Ca. Liberibacter asiaticus" isolates contain either one or the other. Interclade assignments of the putative Hyv(I) and Hyv(II) proteins from Florida isolates with other global isolates in phylogenetic trees imply multiple "Ca. Liberibacter asiaticus" populations in the world and a multisource introduction of the "Ca. Liberibacter asiaticus" bacterium into Florida.

Phylogenetic Analysis of Eastern Equine Encephalitis Virus Isolates from Florida

Florida has the highest degree of endemicity for eastern equine encephalitis virus (EEEV) of any state in the United States and is the only state with year-round transmission of EEEV. To further understand the viral population dynamics in Florida, the genome sequence of six EEEV isolates from central Florida were determined. These data were used to identify the most polymorphic regions of the EEEV genome from viruses isolated in Florida. The sequence of these polymorphic regions was then determined for 18 additional Florida isolates collected in four geographically distinct regions over a 20-year period. Phylogenetic analyses of these data suggested a rough temporal association of the Florida isolates, but no clustering by region or by source of the isolate. Some clustering of northeastern isolates with Florida isolates was seen, providing support for the hypothesis that Florida serves as a reservoir for the periodic introduction of EEEV into the northeastern United States.