Flavin-containing Monooxygenase 2 Research Articles

FMO2 ameliorates nonalcoholic fatty liver disease by suppressing ER-to-Golgi transport of SREBP1.

Nonalcoholic fatty liver disease (NAFLD), comprises a spectrum of liver disorders with the initial abnormal accumulation of lipids in hepatocytes called nonalcoholic fatty liver (NAFL), progressing to the more serious non-alcoholic steatohepatitis (NASH) in a subset of individuals. Our previous study revealed that global flavin-containing monooxygenase 2 (FMO2) knockout causes higher liver weight in rats. However, the role of FMO2 in NAFLD remains unclear. Herein, we aimed to determine the function and mechanism of FMO2 in liver steatosis and steatohepatitis. The expression of FMO2 was significantly downregulated in NAFL/NASH patients and mouse model. Both global and hepatocyte-specific knockout of FMO2 resulted in increased lipogenesis and severer hepatic steatosis, inflammation, and fibrosis, whereas FMO2 overexpression in mice improved NAFL/NASH. RNA sequencing showed that hepatic FMO2 deficiency is associated with impaired lipogenesis in response to metabolic challenges. Mechanistically, FMO2 directly interacts with SREBP1 at amino acids 217-296 competitively with SREBP cleavage-activating protein (SCAP) and inhibits SREBP1 translocation from the endoplasmic reticulum (ER) to the Golgi apparatus (GA) and its subsequent activation, thus suppressing de novo lipogenesis (DNL) and improving NAFL/NASH. In hepatocytes, FMO2 is a novel molecule that protects against the progression of NAFL/NASH independent of enzyme activity. FMO2 impairs lipogenesis in HFD or CDAHFD-induced steatosis, inflammation and fibrosis by directly binding to SREBP1 and preventing its organelle translocation and subsequent activation. FMO2 thus is a promising molecule for targeting the activation of SREBP1 and for the treatment of NAFL/NASH.

Circ_MACF1 targets miR-421 to upregulate FMO2 to suppress paclitaxel resistance and malignant cellular behaviors in lung adenocarcinoma.

Chemoresistance remains an enormous challenge in the treatment of lung adenocarcinoma (LADC). Circular RNAs (circRNAs) exhibit important regulation in tumor progression and chemoresistance. This research focused on exploring the regulatory function and mechanism of circ_MACF1 (has_circ_0011780) in paclitaxel (PTX) resistance in LADC. Circ_MACF1, miR-421 and flavin-containing monooxygenase 2 (FMO2) were determined by RT-qPCR. MTT was applied to detect IC50 of PTX. The proliferation analysis was performed using EdU and colony formation assay. Cell apoptosis and motility were examined using flow cytometry and transwell assay, respectively. Western blot was administered for protein detection. A dual-luciferase reporter assay was performed for confirming target interaction. PTX sensitivity in vivo was researched via xenograft tumor assay. Expression of circ_MACF1 was decreased in PTX-resistant LADC tissues and cells. Circ_MACF1 overexpression reduced chemoresistance, proliferation, motility and accelerated apoptosis in PTX-resistant LADC cells. Circ_MACF1 targeted miR-421 and miR-421 upregulation reverted circ_MACF1-evoked effects. FMO2 served as a downstream target of miR-421 and circ_MACF1 sponged miR-421 to elevate the expression of FMO2. MiR-421 enhanced PTX resistance and LADC progression via targeting FMO2. FMO2 knockdown enhanced IC50 of PTX and cell proliferation. In vivo, circ_MACF1 elevated PTX sensitivity of LADC by mediating miR-421/FMO2 axis. These findings elucidated that circ_MACF1 inhibited PTX resistance by absorbing miR-421 to upregulate FMO2 in LADC.

Flavin containing monooxygenase 2 regulates renal tubular cell fibrosis and paracrine secretion via SMURF2 inAKI‑CKD transformation.

In the follow‑up of hospitalized patients with acute kidney injury (AKI), it has been observed that 15‑30% of these patients progress to develop chronic kidney disease (CKD). Impaired adaptive repair of the kidneys following AKI is a fundamental pathophysiological mechanism underlying renal fibrosis and the progression to CKD. Deficient repair of proximal tubular epithelial cells is a key factor in the progression from AKI to CKD. However, the molecular mechanisms involved in the regulation of fibrotic factor paracrine secretion by injured tubular cells remain incompletely understood. Transcriptome analysis and an ischemia‑reperfusion injury (IRI) model were used to identify the contribution of flavin‑containing monooxygenase 2 (FMO2) in AKI‑CKD. Lentivirus‑mediated overexpression of FMO2 was performed in mice. Functional experiments were conducted using TGF‑β‑induced tubular cell fibrogenesis and paracrine pro‑fibrotic factor secretion. Expression of FMO2 attenuated kidney injury induced by renal IRI, renal fibrosis, and immune cell infiltration into the kidneys. Overexpression of FMO2 not only effectively blocked TGF secretion in tubular cell fibrogenesis but also inhibited aberrant paracrine activation of pro‑fibrotic factors present in fibroblasts. FMO2 negatively regulated TGF‑β‑mediated SMAD2/3 activation by promoting the expression of SMAD ubiquitination regulatory factor 2 (SMURF2) and its nuclear translocation. During the transition from AKI to CKD, FMO2 modulated tubular cell fibrogenesis and paracrine secretion through SMURF2, thereby affecting the outcome of the disease.

Evaluation of Fasting and Probiotics in Reducing Postweaning Stress in Rabbits: Study of their Effects on Biochemical and Gene expression Patterns

Postweaning stress in mammalian in vivo models leads to significant oxidative stress in the body as well as inducing hormonal disturbance. In this study, we assessed progressive alterations in reactive oxygen species (ROS), which at high levels can show oxidative stress, in addition to oxidative damage to the DNA structure of rabbits. Different groups of rabbits were fasted for 48 h per week for 3 weeks, fed a commercial diet with probiotics added (200 mg of Bacillus licheniformis and Bacillus subtilis), and fasted while being treated with probiotics. The results showed that weaning induced a significant elevation in oxidative stress markers, such as the ROS-related genes malate dehydrogenase 1 (MDH1) and flavin-containing monooxygenase 2 (FMO2), DNA damage, and hormonal disturbance. However, probiotic treatment resulted in significant decreases in the levels of malondialdehyde, cortisol, and triiodothyronine (T3); DNA damage; and apoptosis, as well as changes in the expression of ROS-related genes. On the other hand, supplementation with probiotics reduced these postweaning stress signs in fasted animal models by elevating the genes encoding catalase and superoxide dismutase as well as increasing glutathione peroxidase (GSH-Px), glutathione–s-transferase, alkaline phosphatase, glucose, and thyroxin (T4) levels. The results suggest that supplementation with probiotics accompanied by a fasting program could decrease oxidative stress, ROS genes, and genomic DNA damage and improve the hormonal status that is induced by postweaning stress in mammalian in vivo models.

Neurobiological Basis of Aversion-Resistant Ethanol Seeking in C. elegans.

Persistent alcohol seeking despite the risk of aversive consequences is a crucial characteristic of alcohol use disorders (AUDs). Therefore, an improved understanding of the molecular basis of alcohol seeking despite aversive stimuli or punishment in animal models is an important strategy to understand the mechanism that underpins the pathology of AUDs. Aversion-resistant seeking (ARS) is characterized by disruption in control of alcohol use featured by an imbalance between the urge for alcohol and the mediation of aversive stimuli. We exploited C. elegans, a genetically tractable invertebrate, as a model to elucidate genetic components related to this behavior. We assessed the seb-3 neuropeptide system and its transcriptional regulation to progress aversion-resistant ethanol seeking at the system level. Our functional genomic approach preferentially selected molecular components thought to be involved in cholesterol metabolism, and an orthogonal test defined functional roles in ARS through behavioral elucidation. Our findings suggest that fmo-2 (flavin-containing monooxygenase-2) plays a role in the progression of aversion-resistant ethanol seeking in C. elegans.

Cancer-associated fibroblasts-derived FMO2 as a biomarker of macrophage infiltration and prognosis in epithelial ovarian cancer

ObjectiveRecent molecular profiling revealed that cancer-associated fibroblasts (CAFs) are essential for matrix remodeling and tumor progression. Our study aimed to investigate the role of flavin-containing monooxygenase 2 (FMO2) in epithelial ovarian cancer (EOC) as a novel CAF-derived prognostic biomarker. MethodsPrimary fibroblasts were isolated from EOC samples. Microdissection and single-cell RNA sequencing (scRNA-seq) datasets (including TCGA, GSE9891, GSE63885, GSE118828 and GSE178913) were retrieved to determine the expression profiles. Gene set enrichment analysis (GSEA) was used to explore the correlation between FMO2 and stromal activation as well as immune infiltration. The predictive value of FMO2 and combined macrophage infiltration level was verified in an independent EOC cohort (n = 113). ResultsWe demonstrated that FMO2 was upregulated in tumor stroma and correlated with fibroblast activation. Besides, FMO2 had the predictive power for worse clinical outcome of EOC patients. In the mesenchymal subtype of EOC, the FMO2-defined signature revealed that FMO2 contributed to infiltration of tumor-infiltrating lymphocytes. Moreover, we confirmed the positive correlation between FMO2 and CD163+ cell infiltration level in EOC tissues, and showed that combination of FMO2 expression with CD163+ cell infiltration level in the tumor stroma could predict poor overall survival (HR = 3.63, 95% CI = 1.93–6.84, p = 0.0008). Additionally, FMO2 also predicted the prognosis of patients with ovarian cancer based on the expression of immune checkpoints (such as PD-L1 and PD1). ConclusionOur results address the tumor-supporting role of FMO2 in EOC and its association with immune components, and it might be a prospective target for stroma-oriented therapies against EOC.

Flavin Containing Monooxygenase 2 Prevents Cardiac Fibrosis via CYP2J3-SMURF2 Axis.

Cardiac fibrosis is a common pathological feature associated with adverse clinical outcome in postinjury remodeling and has no effective therapy. Using an unbiased transcriptome analysis, we identified FMO2 (flavin-containing monooxygenase 2) as a top-ranked gene dynamically expressed following myocardial infarction (MI) in hearts across different species including rodents, nonhuman primates, and human. However, the functional role of FMO2 in cardiac remodeling is largely unknown. Single-nuclei transcriptome analysis was performed to identify FMO2 after MI; FMO2 ablation rats were generated both in genetic level using the CRISPR-cas9 (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat-associated 9) technology and lentivirus-mediated manner. Gain-of-function experiments were conducted using postn-promoter FMO2, miR1a/miR133a-FMO2 lentivirus, and enzymatic activity mutant FMO2 lentivirus after MI. A significant downregulation of FMO2 was consistently observed in hearts after MI in rodents, nonhuman primates, and patients. Single-nuclei transcriptome analysis showed cardiac expression of FMO2 was enriched in fibroblasts rather than myocytes. Elevated spontaneous tissue fibrosis was observed in the FMO2-null animals without external stress. In contrast, fibroblast-specific expression of FMO2 markedly reduced cardiac fibrosis following MI in rodents and nonhuman primates associated with diminished SMAD2/3 phosphorylation. Unexpectedly, the FMO2-mediated regulation in fibrosis and SMAD2/3 signaling was independent of its enzymatic activity. Rather, FMO2 was detected to interact with CYP2J3 (cytochrome p450 superfamily 2J3). Binding of FMO2 to CYP2J3 disrupted CYP2J3 interaction with SMURF2 (SMAD-specific E3 ubiquitin ligase 2) in cytosol, leading to increased cytoplasm to nuclear translocation of SMURF2 and consequent inhibition of SMAD2/3 signaling. Loss of FMO2 is a conserved molecular signature in postinjury hearts. FMO2 possesses a previously uncharacterized enzyme-independent antifibrosis activity via the CYP2J3-SMURF2 axis. Restoring FMO2 expression exerts potent ameliorative effect against fibrotic remodeling in postinjury hearts from rodents to nonhuman primates. Therefore, FMO2 is a potential therapeutic target for treating cardiac fibrosis following injury.

Machine learning-based screening of the diagnostic genes and their relationship with immune-cell infiltration in patients with lung adenocarcinoma

BackgroundLung adenocarcinoma (LUAD) is the most common type of lung cancer, and has a dismal mortality rate of 80%, mainly due to diagnosis at an advanced stage. Biomarkers with high specificity and sensitivity for the early diagnosis of LUAD are sparse. This study aimed to identify markers for the early diagnosis of LUAD.MethodsThe GSE32863 and GSE75037 data sets were standardized and merged to screen for differentially expressed genes (DEGs). Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were conducted. The intersected DEGs from the least absolute shrinkage and selection operator (LASSO) and support vector machine (SVM) regression analyses were considered the hub genes. Then the diagnostic ability and expression of hub genes was tested in GSE63459 data set, Finally, CIBERSORT was used to analyze the correlation between the immune-infiltrating cells and hub genes.ResultsThe following 7 DEGs were intersected by the LASSO and SVM regression analyses: Locus 401286 (LOC401286), flavin-containing monooxygenase 2 (FMO2), XLKD1, Ras homolog family member J (RHOJ), scavenger receptor Class A member 5 (SCARA5), heat shock protein beta-2 (HSPB2), and serine incorporator 2 (SERINC2). The area under the receiver operating characteristic curve (AUC) of LOC401286, FMO2, XLKD1, RHOJ, SCARA5, HSPB2, and SERINC2 was 0.99, 1.00, 0.99, 1.00, 0.99, 0.99, and 0.98, respectively in the training groups. The AUC of LOC401286, FMO2, XLKD1, RHOJ, SCARA5, HSPB2, and SERINC2 was 0.97, 0.96, 0.94, 0.88, 0.85, 0.94 and 0.89, respectively in the validation group. The immune-cell infiltrations of naive B cells, memory B cells, plasma cells, naive cluster of differentiation (CD) 4 T cells, T follicular helper cells, regulatory T cells, gamma delta T cells, monocytes, M0 macrophages, M1 macrophages, resting mast cells, activated mast cells, and neutrophils were different between the normal and tumor tissues. Notably, these immune cells were correlated with the above-mentioned 7 diagnostic genes.ConclusionsWe identified 7 DEGs in LUAD tissue that can be considered diagnostic genes based on 2 machine-learning regression methods, which could be very helpful for the early diagnosis of LUAD in clinical practice.

Mechanisms of Cell Non-Autonomous Longevity Regulation

An organism’s ability to respond to stress is crucial for long-term survival. These stress responses are coordinated by distinct but overlapping pathways, many of which also regulate longevity across taxa. Our previous work identified a cell non-autonomous signaling pathway led by the hypoxia-inducible factor and resulting in induction of flavin-containing monooxygenase-2 (fmo-2) to promote health and longevity. Our current work identifies a distinct cell non-autonomous pathway downstream of dietary restriction (DR) that also relies on fmo-2 induction to promote health and longevity. We now find that these cell non-autonomous pathways can be mimicked by small molecule interventions that increase longevity by inducing fmo-2. Based on the commonalities of these pathways, we hypothesized that fmo-2, a classically annotated xenobiotic enzyme, might play a key endogenous role in responding to metabolic stress. Our resulting data, using metabolic profiling and further epistatic analysis, both support this hypothesis and link fmo-2’s mechanism to modifications in one-carbon metabolism (OCM), a key intermediate pathway consisting of the folate and methionine cycles. Using mathematical modeling and a labeled metabolomics approach, we were able to further identify the likely mechanism of fmo-2-mediated metabolic effects and connect them to both OCM and downstream components. We propose that fmo-2 is induced cell non-autonomously to modify systemic metabolism and longevity, and that fmo-2 is a key member of a conserved metabolic stress response.

Cellular, Molecular and Biochemical Impacts of Silver Nanoparticles on Rat Cerebellar Cortex.

Background: The excessive exposure to silver nanoparticles (Ag-NPs) has raised concerns about their possible risks to the human health. The brain is a highly vulnerable organ to nano-silver harmfulness. The aim of this work was to evaluate the impacts of Ag-NPs exposure on the cerebellar cortex of rats. Methods: Rats were assigned to: Control, vehicle control and Ag-NP-exposed groups (at doses of 10 mg and 30 mg/kg/day). Samples were processed for light and electron microscopy examinations. Immunohistochemical localization of c-Jun N-terminal kinase (JNK), nuclear factor kappa beta (NF-κB) and calbindin D28k (CB) proteins was performed. Analyses of expression of DNA damage inducible transcript 4 (Ddit4), flavin containing monooxygenase 2 (FMO2) and thioredoxin-interacting protein (Txnip) genes were done. Serum levels of inflammatory cytokines were also measured. Results: Ag-NPs enhanced apoptosis as evident by upregulation of Ddit4 gene expressions and JNK protein immune expressions. Alterations of redox homeostasis were verified by enhancement of Txnip and FMO2 gene expressions, favoring the activation of inflammatory responses by increasing NF-κB protein immune expressions and serum inflammatory mediator levels. Another cytotoxic effect was the reduction of immune expressions of the calcium regulator CB. Conclusion: Ag-NPs exposure provoked biochemical, cellular and molecular changes of rat cerebellar cortex in a dose-dependent manner.

A Metabolic Stress Response

An organism’s ability to respond to stress is crucial for long-term survival. These stress responses are coordinated by distinct but overlapping pathways, many of which have been found to also regulate longevity in multiple organisms across species. Despite extensive effort, our understanding of these pathways and how they affect aging remains incomplete and thus is a key area of study in Geroscience. Our previous work identified flavin-containing monooxygenase-2 (fmo-2) as a key longevity-promoting gene downstream of at least three longevity promoting pathways, including the hypoxic response, the pentose phosphate pathway, and the dietary restriction pathway. Based on the commonalities of these pathways, we hypothesized that fmo-2, a classically annotated xenobiotic enzyme, might play a key endogenous role in responding to metabolic stress. Our resulting data, using metabolic profiling and further epistatic analysis, both support this hypothesis and link fmo-2’s mechanism to modifications to one-carbon metabolism (OCM), a key intermediate pathway between the nucleotide metabolism, methylation, and transsulfuration pathways. Using mathematical modeling and a novel metabolomics approach, we were able to further identify the likely mechanism of fmo-2-mediated metabolic effects, and connect them to both OCM and downstream components. We propose a model whereby nematode fmo-2 represents a class of enzymes that are able to modify large aspects of metabolism, similar to how transcription factors modify gene expression, and that fmo-2 is a key member of a conserved metabolic stress response.

Metabolic Regulation of Longevity by One-Carbon Metabolism and Flavin-Containing Monooxygenase

Nematode flavin-containing monooxygenase-2 (fmo-2) is induced by dietary restriction and hypoxia, and is required for the longevity and health benefits of these pathways. It is also sufficient to confer these benefits when overexpressed. As FMOs are well-conserved across taxa, the fmo-2 mechanism has high translational potential. To determine the changes that occur following fmo-2 induction, we performed RNA-seq and untargeted metabolomics analyses. Our data reveal that one-carbon metabolism (OCM) is significantly altered by fmo-2 overexpression. OCM is a nexus for essential metabolic pathways, including transmethylation, transsulfuration, nucleotide synthesis, and amino acid metabolism. We hypothesized that fmo-2 confers longevity benefits by altering key metabolic processes within or downstream of OCM. To test this, we asked whether fmo-2 and OCM interact to regulate longevity by knocking down expression of genes involved with OCM and measuring lifespan and oxidative stress resistance. To understand the biological implications of these interactions, we generated a computational model using qPCR data of key OCM-related genes to predict changes in OCM metabolic flux. Our model predicts significant changes in OCM flux that are regulated by fmo-2 expression levels and are consistent with our RNAi and multi-omics results. We are now testing this model by knocking down genes downstream of OCM to determine their role in fmo-2-mediated benefits. Preliminary results support our hypothesis that changes in metabolic flux through OCM are involved downstream of fmo-2 expression, and may also implicate the UPRER in this pathway. Our future work will elucidate this mechanism and link stress perception and fmo-2-mediated longevity.

Abstract 210: Flavin Containing Monooxygenase 2 Confers Cardiac Protection via Unfolded Protein Response Signaling Modulated by Disulfide Bond Catalysis

Introduction: Myocardial infarction (MI) is characterized by cardiac dysfunction and increased cardiomyocyte death, induced mainly by apoptosis. Using an unbiased transcriptome analysis, we identified flavin containing monooxygenase 2 (FMO2) as one of the top-ranked genes involved in the process of MI. In this study, we investigate the roles of FMO2 in ischemic injury and its potential mechanisms. Hypothesis: FMO2 exhibits the cardiac protection from MI injury. Methods: Male SD rats receiving either adeno-associated virus serotype 9 containing FMO2 shRNA particles (AAV-shFMO2) or FMO2 (AAV-FMO2), and FMO2 knockout rats were subjected to myocardial infarction surgery. Cardiac function, fibrosis, and apoptosis were examined in these rats and related cellular and molecular mechanisms were investigated. Results: Cardiac ischemia injury was associated with significant increases of FMO2 levels both in ex vivo and in vivo models. Loss of FMO2 significantly enhanced cardiomyocyte apoptosis and deteriorated cardiac function accompanied by augmented infarct size in infarcted rat hearts, while elevated expression of FMO2 exhibited the opposite results. Mechanically, located on the ER membrane, FMO2 inhibited activation of ER stress-initiated apoptotic proteins including caspase 12 and C/EBP homologous protein (CHOP), via down-regulating upstream unfolded protein response (UPR) pathway. Furthermore, we found that FMO2, as a novel chaperone in ER, directly catalyzed disulfide-bond synthesis to facilitate proteins folding. Finally, structure analysis of FMO2 revealed the active site GVSG for disulfide-bond catalysis, which was confirmed by the molecular docking experiment of GSH with FMO2. However, FMO2 with GVSG mutation failed to catalyze disulfide-bond formation and lost protection from ER stress or apoptosis in cardiomyocytes. Conclusion: FMO2 confers cardiac protection from ischemic damage due to improved cardiomyocyte apoptosis through UPR pathway, which is mediated by disulfide-bond catalysis at GVSG active site. Our findings uncover a novel FMO2-involved regulatory mechanism which could serves as a potential therapeutic target for ischemic cardiovascular diseases.

Abstract 298: Flavin Containing Monooxygenase 2 in Cardiac Fibrosis

Cardiac fibrosis is associated with clinical outcome in patients with heart failing. There is no information concerning whether flavin containing monooxygenase 2 (FMO2) is involved in the fibrotic response. Here, we demonstrate that FMO2 is consistently down-regulated after myocardial infarction (MI) in rats, non-human primates and patients with chronic MI. Furthermore, FMO2 knockdown or knockout results in significantly increased cardiac fibrosis accompanied with impaired heart function in rats. Compensation of non-myocyte FMO2 using the strategy of miR133a/1a TS aided lentivirus inhibits the cardiac fibrosis and restores the deteriorated cardiac function following MI in rats. In vitro studies showed FMO2 expression in neonatal rat cardiac fibroblasts (NRCFs) is dramatically decreased after treatment of TGF-β. FMO2 deficiency in CFs isolated from FMO2-/- rats induces augmented collagen deposition, fibroblast-myofibroblast transdifferentiation and increased phosphorylated SMAD2/3. However, overexpression of FMO2 in NRCFs or CFs from MI patients suppresses this exact process. Mechanistically, we demonstrate using mass spectrometry that FMO2 combines with cytochrome p450 superfamily 2J3 (CYP2J3) at the ubiquitination site of the latter one after TGF-β stimulation, and then blocks the CYP2J3 ubiquitination. The accumulated CYP2J3 expression induces the up-regulation and nuclear translocation of SMURF2, the E3 ubiquitin-protein ligase specifically degrades phosphorylated SMAD2/3, through a negative feedback as another substrate of SMURF2, in addition, FMO2 can competitively exploit CYP2J3 from SMURF2, thus in turn promotes nuclear translocation of SMURF2 to degrade phosphorylated SMAD2/3. Furthermore, in non-human primate MI model, delivery of non-myocyte FMO2 over-expression lentivirus significantly decreases the cardiac fibrosis and improves heart function. In summary, our study demonstrates for the first time that FMO2 is a critical determinant of cardiac fibrosis by interfering TGF-β/SMAD2/3 and provides a novel potential target for treating cardiac fibrosis.

CELL NON-AUTONOMOUS SEROTONIN SIGNALING MEDIATES STRESS RESISTANCE AND LONGEVITY

The ability of organisms to perceive and respond to their environment is crucial to their long-term survival. Recent studies in model organisms identify signaling pathways that perceive environmental stress and cell non-autonomously modify systemic physiology. These pathways often originate in the neurons, where key cells monitor the external environment for changes including food availability, air-quality, and the presence of dangerous toxins. Our previous work identified a key role for serotonin signaling in the induction of flavin-containing monooxygenase-2 (fmo-2) downstream of hypoxic signaling. fmo-2 expression is necessary and sufficient to promote stress resistance and longevity downstream of multiple genetic pathways, making it a useful tool for identifying key components of these pathways. Our current data defines environments, pathways, and signaling molecules that induce fmo-2 and subsequently increase lifespan. Our resulting data define key roles for serotonin signaling and fmo-2 that rely upon the perception of oxygen and food.

An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

Aging: All in the head—and the gut

Two life-span–extending pathways in the worm converge to increase production of an enzyme in the intestine.

Aging: All in the head--and the gut

Aging The effects of hypoxia and caloric restriction, both of which extend life span in Caenorhabditis elegans , converge on the activation of an enzyme in cells of the intestine. Leiser et al. show that the life-extending effects of hypoxia begin in neurons with transcriptional activation by hypoxia-inducible factor–1 and increased serotonergic signaling. These effects lead to increased production of flavin-containing monooxygenase-2 (FMO-2) in the intestine, which increased longevity. Finding the relevant targets of FMO-2, which also accumulates in mammals under conditions that promote longevity, may elucidate further mechanisms that promote healthy aging. Science , this issue p. [1375][1] [1]: /lookup/doi/10.1126/science.aac9257

Cell nonautonomous activation of flavin-containing monooxygenase promotes longevity and health span.

Stabilization of the hypoxia-inducible factor 1 (HIF-1) increases life span and health span in nematodes through an unknown mechanism. We report that neuronal stabilization of HIF-1 mediates these effects in Caenorhabditis elegans through a cell nonautonomous signal to the intestine, which results in activation of the xenobiotic detoxification enzyme flavin-containing monooxygenase-2 (FMO-2). This prolongevity signal requires the serotonin biosynthetic enzyme TPH-1 in neurons and the serotonin receptor SER-7 in the intestine. Intestinal FMO-2 is also activated by dietary restriction (DR) and is necessary for DR-mediated life-span extension, which suggests that this enzyme represents a point of convergence for two distinct longevity pathways. FMOs are conserved in eukaryotes and induced by multiple life span-extending interventions in mice, which suggests that these enzymes may play a critical role in promoting health and longevity across phyla.

Constraints on the evolution of a doublesex target gene arising from doublesex’s pleiotropic deployment

"Regulatory evolution," that is, changes in a gene's expression pattern through changes at its regulatory sequence, rather than changes at the coding sequence of the gene or changes of the upstream transcription factors, has been increasingly recognized as a pervasive evolution mechanism. Many somatic sexually dimorphic features of Drosophila melanogaster are the results of gene expression regulated by the doublesex (dsx) gene, which encodes sex-specific transcription factors (DSX(F) in females and DSX(M) in males). Rapid changes in such sexually dimorphic features are likely a result of changes at the regulatory sequence of the target genes. We focused on the Flavin-containing monooxygenase-2 (Fmo-2) gene, a likely direct dsx target, to elucidate how sexually dimorphic expression and its evolution are brought about. We found that dsx is deployed to regulate the Fmo-2 transcription both in the midgut and in fat body cells of the spermatheca (a female-specific tissue), through a canonical DSX-binding site in the Fmo-2 regulatory sequence. In the melanogaster group, Fmo-2 transcription in the midgut has evolved rapidly, in contrast to the conserved spermathecal transcription. We identified two cis-regulatory modules (CRM-p and CRM-d) that direct sexually monomorphic or dimorphic Fmo-2 transcription, respectively, in the midguts of these species. Changes of Fmo-2 transcription in the midgut from sexually dimorphic to sexually monomorphic in some species are caused by the loss of CRM-d function, but not the loss of the canonical DSX-binding site. Thus, conferring transcriptional regulation on a CRM level allows the regulation to evolve rapidly in one tissue while evading evolutionary constraints posed by other tissues.