Five-generation Chinese Family Research Articles

A novel splice-altering TNC variant (c.5247A > T, p.Gly1749Gly) in an Chinese family with autosomal dominant non-syndromic hearing loss

BackgroundThis study aims to analyze the pathogenic gene in a Chinese family with non-syndromic hearing loss and identify a novel mutation site in the TNC gene.MethodsA five-generation Chinese family from Anhui Province, presenting with autosomal dominant non-syndromic hearing loss, was recruited for this study. By analyzing the family history, conducting clinical examinations, and performing genetic analysis, we have thoroughly investigated potential pathogenic factors in this family. The peripheral blood samples were obtained from 20 family members, and the pathogenic genes were identified through whole exome sequencing. Subsequently, the mutation of gene locus was confirmed using Sanger sequencing. The conservation of TNC mutation sites was assessed using Clustal Omega software. We utilized functional prediction software including dbscSNV_AdaBoost, dbscSNV_RandomForest, NNSplice, NetGene2, and Mutation Taster to accurately predict the pathogenicity of these mutations. Furthermore, exon deletions were validated through RT-PCR analysis.ResultsThe family exhibited autosomal dominant, progressive, post-lingual, non-syndromic hearing loss. A novel synonymous variant (c.5247A > T, p.Gly1749Gly) in TNC was identified in affected members. This variant is situated at the exon–intron junction boundary towards the end of exon 18. Notably, glycine residue at position 1749 is highly conserved across various species. Bioinformatics analysis indicates that this synonymous mutation leads to the disruption of the 5' end donor splicing site in the 18th intron of the TNC gene. Meanwhile, verification experiments have demonstrated that this synonymous mutation disrupts the splicing process of exon 18, leading to complete exon 18 skipping and direct splicing between exons 17 and 19.ConclusionThis novel splice-altering variant (c.5247A > T, p.Gly1749Gly) in exon 18 of the TNC gene disrupts normal gene splicing and causes hearing loss among HBD families.

CAG Repeat Expansion in THAP11 Is Associated with a Novel Spinocerebellar Ataxia.

More than 50 loci are associated with spinocerebellar ataxia (SCA), and the most frequent subtypes share nucleotide repeats expansion, especially CAG expansion. The objective of this study was to confirm a novel SCA subtype caused by CAG expansion. We performed long-read whole-genome sequencing combined with linkage analysis in a five-generation Chinese family, and the finding was validated in another pedigree. The three-dimensional structure and function of THAP11 mutant protein were predicted. Polyglutamine (polyQ) toxicity of THAP11 gene with CAG expansion was assessed in skin fibroblasts of patients, human embryonic kidney 293 and Neuro-2a cells. We identified THAP11 as the novel causative SCA gene with CAG repeats ranging from 45 to 100 in patients with ataxia and from 20 to 38 in healthy control subjects. Among the patients, the number of CAA interruptions within CAG repeats was decreased to 3 (up to 5-6 in controls), whereas the number of 3' pure CAG repeats was up to 32 to 87 (4-16 in controls), suggesting that the toxicity of polyQ protein was length dependent on the pure CAG repeats. Intracellular aggregates were observed in cultured skin fibroblasts from patients. THAP11 polyQ protein was more intensely distributed in the cytoplasm of cultured skin fibroblasts from patients, which was replicated with in vitro cultured neuro-2a transfected with 54 or 100 CAG repeats. This study identified a novel SCA subtype caused by intragenic CAG repeat expansion in THAP11 with intracellular aggregation of THAP11 polyQ protein. Our findings extended the spectrum of polyQ diseases and offered a new perspective in understanding polyQ-mediated toxic aggregation. © 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

Amelogenesis imperfecta in a Chinese family resulting from a FAM83H variation and the effect of FAM83H on the secretion of enamel matrix proteins.

To investigate the variant of an amelogenesis imperfecta (AI) family and to explore the function of the FAM83H (family with sequence similarity 83 member H) in the enamel formation. We investigated a five-generation Chinese family diagnosed with AI; clinical data was collected, whole-exome sequencing (WES) was conducted to explore the pathogenic gene and variants and Sanger sequencing was used to verify the variants. The three-dimensional protein structures of wild-type and mutant FAM83H were predicted using alpha fold 2. To study the possible regulatory function of Fam83h on amelogenesis, immunolocalization was performed to observe the expression of Fam83h protein in Sprague-Dawley rat postnatal incisors. The mRNA and protein level of amelogenin, enamelin, kallikrein-related peptidase-4 and ameloblastin were also detected after the Fam83h was knocked down by small interfering RNA (siRNA) in HAT-7 cells. A known nonsense variant (c.973 C > T) in exon 5 of FAM83H gene was found in this family, causing a truncated protein (p.R325X). Immunolocalization of Fam83h in Sprague-Dawley rat postnatal incisors showed that Fam83h protein expression was detected in presecretory and secretory stages. When Fam83h expression was reduced by siRNA, the expression of amelogenin, enamelin, kallikrein-related peptidase-4 decreased. However, the expression of ameloblastin increased. FAM83H gene variant (c.973 C > T) causes AI. FAM83H regulates the secretion of enamel matrix proteins and affects ameloblast differentiation. This study provided that FAM83H variants could influence enamel formation and provided new insights into the pathogenesis of AI.

A Novel Missense WFS1 Variant: Expanding the Mutational Spectrum Associated with Nonsyndromic Low-Frequency Sensorineural Hearing Loss.

Background Nonsyndromic low-frequency sensorineural hearing loss (LFSNHL) is an uncommon form of hearing loss (HL) that typically affects frequencies at 2000 Hz and below. Heterozygous variants in the WFS1 gene at the DFNA6/14/38 locus are considered a common cause of LFSNHL. To date, 34 different pathogenic genetic variants have been reported to cause LFSNHL with seven of these variants identified in the Chinese population. However, limited reports are available on the association between WFS1 gene and LFSNHL. Here, we report a five-generation Chinese family with an autosomal dominant inheritance pattern of postlingual and progressive LFSNHL. Methods Routine clinical and audiological examinations were performed on 16 affected and 7 healthy members in this family. The targeted next-generation sequencing of 127 known deafness genes was performed to identify variants in affected individuals. Sanger sequencing were further employed to confirm the pathogenic variant identified. Results A novel heterozygous pathogenic genetic variant c.2530G > T (p.Ala844Ser) was identified in the WFS1 gene in all patients of this family. The mutated Ala residue is evolutionarily conserved and cosegregated with HL. The variant was predicted to be deleterious by MutationTaster, PolyPhen-2, LRT, and Fathmm software. Conservation analysis and 3D protein structure model indicated that the variant caused a structural change in the protein. Conclusions Our present study identifies a novel heterozygous WFS1 variant associated with LFSNHL in a Chinese family.

Clinical characteristics and in silico analysis of congenital pseudarthrosis of the tibia combined with neurofibromatosis type 1 caused by a novel NF1 mutation.

Congenital pseudarthrosis of the tibia (CPT) is a rare congenital bone malformation, which has a strong relationship with Neurofibromatosis type 1 (NF1). NF1 is an autosomal dominant disease leading to multisystem disorders. Here, we presented the genotypic and phenotypic characteristics of one unique case of a five-generation Chinese family. The proband was CPT accompanied with NF1 due to NF1 mutation. The proband developed severe early-onset CPT combined with NF1 after birth. Appearance photos and X-ray images of the left limb of the proband showed significant bone malformation. Slit-lamp examination showed Lisch nodules in both eyes of the proband. Whole-exome sequencing (WES) and Sanger sequencing confirmed the truncation variant of NF1 (c.871G>T, p. E291*). Sequence conservative and evolutionary conservation analysis indicated that the novel mutation (p.E291*) was highly conserved. The truncated mutation led to the loss of functional domains, including CSRD, GRD, TBD, SEC14-PH, CTD, and NLS. It may explain why the mutation led to a severe clinical feature. Our report expands the genotypic spectrum of NF1 mutations and the phenotypic spectrum of CPT combined with NF1.

A novel variant in the ROR2 gene underlying brachydactyly type B: a case report

BackgroundBrachydactyly type B is an autosomal dominant disorder that is characterized by hypoplasia of the distal phalanges and nails and can be divided into brachydactyly type B1 (BDB1) and brachydactyly type B2 (BDB2). BDB1 is the most severe form of brachydactyly and is caused by truncating variants in the receptor tyrosine kinase–like orphan receptor 2 (ROR2) gene.Case presentationHere, we report a five-generation Chinese family with brachydactyly with or without syndactyly. The proband and her mother underwent digital separation in syndactyly, and the genetic analyses of the proband and her parents were provided. The novel heterozygous frameshift variant c.1320dupG, p.(Arg441Alafs*18) in the ROR2 gene was identified in the affected individuals by whole-exome sequencing and Sanger sequencing. The c.1320dupG variant in ROR2 is predicted to produce a truncated protein that lacks tyrosine kinase and serine/threonine- and proline-rich structures and remarkably alters the tertiary structures of the mutant ROR2 protein.ConclusionThe c.1320dupG, p.(Arg441Alafs*18) variant in the ROR2 gene has not been reported in any databases thus far and therefore is novel. Our study extends the gene variant spectrum of brachydactyly and may provide information for the genetic counselling of family members.

Identification of a novel LATS1 variant associated with familial cerebral cavernous malformations in a Chinese family.

Cerebral cavernous malformations (CCMs) are common sporadic or hereditary vascular malformations in the central nervous system. CCM1-3 variants have been identified that are associated with the majority of familial cerebral cavernous malformations (FCCMs). However, there are still a few CCM1-3 wild-type FCCMs. The aim of the present study was to identify an additional pathogenic variant of FCCMs. In this study, a large five-generation Chinese Han family affected by CCMs was recruited. Magnetic resonance imaging (MRI) was done for the detection of CCMs. Whole-exome sequencing (WES) was performed, and the identified variants were co-segregation analyzed by Sanger sequencing. The function of candidate variants was predicted in silico and experimental validated by angiogenesis assay in human umbilical vein endothelial cells (HUVECs) in vitro. Twenty-four family members and one healthy spouse were enrolled. We found that CCMs were exhibited on MRI in nine family members. Overall, twenty-seven candidate variants were identified using WES, and no CCM1-3 variants were detected. The missense variant in LATS1 (c.821C > T, p.Thr274Ile) was verified to be associated with the clinical and pathological phenotype of FCCMs. Our findings indicated that the LATS1 variant could be a potential pathogenic factor for FCCMs in this Chinese family.

A novel missense variant c.71G > T (p.Gly24Val) of the CRYBA4 gene contributes to autosomal-dominant congenital cataract in a Chinese family.

To investigate the potential genetic defects in a five-generation Chinese family with autosomal dominant congenital cataract (ADCC). Whole exome sequencing was performed to search the variants in the candidate genes associated with congenital cataract. Sanger sequencing was used to validate the variants and examine their co-segregation in the patients and their relatives. The potential effect of the variants was analyzed using several bioinformatic methods and further examined through Western blotting and co-immunoprecipitation. A missense variant c. 71 G > T (p. Gly24Val) in the CRYBA4 gene, a known ADCC candidate gene, was identified to be heterozygously present in the patients and co-segregate with cataract in the family. The mutation was absent in all of the searched databases, including our in-house exome sequences of 10,000 Chinese. The alignments of the amino acid sequences of CRYBA4 in a variety of species revealed that the amino acid residue Gly24 was evolutionarily highly conserved, and the in silico analysis predicted that the missense mutation of Gly24Val was damaging for the protein structure and function of CRYBA4. Then, the in vitro expression analysis further revealed that the Gly24Val mutation in CRYBA4 inhibited its binding with CRYBB1. The impaired interaction of β-crystallin proteins may affect their water-solubility and contribute to the formation of precipitates in lens fiber cells. We identified a novel missense variant in the CRYBA4 gene as a pathogenic mutation of ADCC in a Chinese family. Our finding expanded the CRYBA4 variation spectrum associated with congenital cataracts.

A novel KCNQ4 gene variant (c.857A>G; p.Tyr286Cys) inan extended family with non‑syndromic deafness 2A.

Deafness is one of the most common sensory disorders found in humans; notably, >60% of all cases of deafness have been attributed to genetic factors. Variants in potassium voltage-gated channel subfamily Q member 4 (KCNQ4) are etiologically linked to a type of progressive hearing loss, deafness non-syndromic autosomal dominant 2A (DFNA2A). In the present study, whole-exome sequencing (WES) was performed on three members of a five-generation Chinese family with 46 members with hearing loss. Pure tone audiometry and Sanger sequencing were performed for 11 family members to determine whether the novel variant in the KCNQ4 gene was segregated with the affected family members. In addition, evolutionary conservation analysis and computational tertiary structure protein prediction of the wild-type KCNQ4 protein and its variant were performed. The family exhibited autosomal dominant, progressive, post-lingual, non-syndromic sensorineural hearing loss. A novel co-segregating heterozygous missense variant (c.857A>G; p.Tyr286Cys) in the glycine-tyrosine-glycine signature sequence in the pore region of the KCNQ4 channel was identified. This variant was predicted to result in a tyrosine-to-cysteine substitution at position 286 in the KCNQ4 protein. The tyrosine at position 286 is well conserved across different species. The substitution of tyrosine with cysteine would affect the structure of the pore region, resulting in the loss of channel function. The KCNQ4 gene is one of the most common mutated genes observed in patients with autosomal dominant, non-syndromic hearing loss. Taken together, for the family analyzed in the present study, performing WES in conjunction with Sanger sequencing has led to the detection of a novel, potentially causative variant (c.857 A>G; p.Tyr286Cys) in exon 6 of the KCNQ4 gene. The present study has added to the number of pathogenic variants observed in the KCNQ4 gene, and the findings may prove to be useful for both the diagnosis of DFNA2A and in the design of early interventional therapies.

Missense Variant of Endoplasmic Reticulum Region of WFS1 Gene Causes Autosomal Dominant Hearing Loss without Syndromic Phenotype.

Objective Genetic variants in the WFS1 gene can cause Wolfram syndrome (WS) or autosomal dominant nonsyndromic low-frequency hearing loss (HL). This study is aimed at investigating the molecular basis of HL in an affected Chinese family and the genotype-phenotype correlation of WFS1 variants. Methods The clinical phenotype of the five-generation Chinese family was characterized using audiological examinations and pedigree analysis. Target exome sequencing of 129 known deafness genes and bioinformatics analysis were performed among six patients and four normal subjects to screen suspected pathogenic variants. We built a complete WFS1 protein model to assess the potential effects of the variant on protein structure. Results A novel heterozygous pathogenic variant NM_006005.3 c.2020G>T (p.Gly674Trp) was identified in the WFS1 gene, located in the C-terminal domain of the wolframin protein. We further showed that HL-related WFS1 missense variants were mainly concentrated in the endoplasmic reticulum (ER) domain. In contrast, WS-related missense variants are randomly distributed throughout the protein. Conclusions In this family, we identified a novel variant p.Gly674Trp of WFS1 as the primary pathogenic variant causing the low-frequency sensorineural HL, enriching the mutational spectrum of the WFS1 gene.

Phosphatidylinositol 4-kinase β mutations cause nonsyndromic sensorineural deafness and inner ear malformation

Congenital hearing loss is a common disorder worldwide. Heterogeneous gene variation accounts for approximately 20–25% of such patients. We investigated a five-generation Chinese family with autosomal-dominant nonsyndromic sensorineural hearing loss (SNHL). No wave was detected in the pure-tone audiometry, and the auditory brainstem response was absent in all patients. Computed tomography of the patients, as well as of two sporadic SNHL cases, showed bilateral inner ear anomaly, cochlear maldevelopment, absence of the osseous spiral lamina, and an enlarged vestibular aqueduct. Such findings were absent in nonaffected persons. We used linkage analysis and exome sequencing and uncovered a heterozygous missense mutation in the PI4KB gene (p.Gln121Arg) encoding phosphatidylinositol 4-kinase β (PI4KB) from the patients in this family. In addition, 3 missense PI4KB (p.Val434Gly, p.Glu667Lys, and p.Met739Arg) mutations were identified in five patients with nonsyndromic SNHL from 57 sporadic cases. No such mutations were present within 600 Chinese controls, the 1000 genome project, gnomAD, or similar databases. Depleting pi4kb mRNA expression in zebrafish caused inner ear abnormalities and audiosensory impairment, mimicking the patient phenotypes. Moreover, overexpression of 4 human missense PI4KB mutant mRNAs in zebrafish embryos resulted in impaired hearing function, suggesting dominant-negative effects. Taken together, our results reveal that PI4KB mutations can cause SNHL and inner ear malformation. PI4KB should be included in neonatal deafness screening.

A novel deletion variant in TRAPPC2 causes spondyloepiphyseal dysplasia tarda in a five-generation Chinese family

BackgroundSpondyloepiphyseal dysplasia tarda (SEDT) is a rare X-linked recessive inherited osteochondrodysplasia caused by mutations in the TRAPPC2 gene. It is clinically characterized by disproportionate short stature and early onset of degenerative osteoarthritis. Clinical diagnosis can be challenging due to the late-onset of the disease and lack of systemic metabolic abnomalites. Genetic diagnosis is critical in both early diagnosis and management of the disease. Here we reported a five-generation Chinese SEDT family and described the novel molecular findings.MethodsDetailed family history and clinical data were collected. Genomic DNA was extracted from venous blood samples of family members. The exons of genes known to be associated with skeletal disorders were captured and deep sequenced. Variants were annotated by ANNOVAR and associated with multiple databases. Putative variants were confirmed by Sanger sequencing. The identified variant was classified according to the American College of Medical Genetics (ACMG) criteria.ResultsThe proband was a 27-year-old Chinese male who presented with short-trunk short stature and joint pain. His radiographs showed platyspondyly with posterior humping, narrow hip-joint surfaces, and pelvic osteosclerosis. A pedigree analysis of 5 generations with 6 affected males revealed an X-linked recessive mode of inheritance. Affected males were diagnosed as SEDT according to the clinical and radiological features. Next-generation sequencing identified a novel variant of c.216_217del in the exon 4 of TRAPPC2 gene in the proband and other affected males. This variant resulted in the shift of reading frame and early termination of protein translation (p.S73Gfs*15). The mother and maternal female relatives of the proband were heterozygous carriers of the same variant, while no variations were detected in this gene of his father and other unaffected males. Based on the ACMG criteria, the novel c.216_217del variant of the TRAPPC2 gene was the pathogenic variant of this SEDT family.ConclusionIn this study we identified the novel pathogenic variant of of c.216_217del in the gene of TRAPPC2 in this five-generation Chinese SEDT family. Our findings expand the clinical and molecular spectrum of SEDT and helps the genetic diagnosis of SEDT patients.

A novel variant of IHH in a Chinese family with brachydactyly type 1

BackgroundBrachydactyly type A1(BDA-1) is an autosomal dominant disorder which is caused by heterozygous pathogenic variants in a specific region of the N-terminal active fragment of Indian Hedgehog (IHH). The disorder is mainly characterized by shortening or missing of the middle phalanges. In this study, Our purpose is to identify the pathogenic variations associated with BDA-1 involved in a five-generation Chinese family.MethodsA BDA-1 family with 8 affected and 14 unaffected family members was recruited. Whole exome sequencing (WES) was performed to identify the pathogenic variant in the proband, and which was later confirmed and segregated by Sanger sequencing. The significance of variants were assessed using several molecular and bioinformatics analysis methods.ResultsWe uncovered a novel heterozygous missense variant c.299A > G (p.D100G) at the mutational hotspot of IHH gene following whole-exome sequencing of a Chinese family with BDA-1. The variant co-segregated with BDA-1 in the pedigree, showed 100% penetrance for phalange phenotype with variable expressivity.ConclusionsIn conclusion, this study reports a five-generation Chinese family with BDA-1 due to a novel pathogenic variant (c.299A > G (p.D100G)) of IHH and expands the clinical and genetic spectrum of BDA-1.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family

BackgroundSynpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family.MethodsWe used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines.ResultsOur results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family.ConclusionBased on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

A 105\xa0kb interstitial insertion in the Xq27.1 palindrome from pseudoautosomal region PAR1 causes a novel X-linked recessive compound phenotype

BackgroundGenomic disorders present a wide spectrum of unrelated clinical entities that result from genomic rearrangements. Interstitial insertions requiring three points of breakage are rare genomic rearrangement events. The pseudoautosomal region PAR1, homologous between the Xp22 and Yp11 loci, has a high crossover and recombination rate. A 180 bp human-specific palindrome at Xq27.1 appears to be a hotspot for genomic rearrangement, and several genetic diseases/phenotypes associated with Xq27.1 palindrome-driven genomic rearrangement have been reported. Here we investigate a Chinese family with an extremely rare X-linked compound phenotype that remains undiagnosed. We attempt to identify underlying genetic causes by an integrated genome analysis.MethodsA five-generation Chinese family with a distinct X-linked compound phenotype was recruited. Peripheral blood samples were collected and genomic DNA was extracted. Systemic physical and lab examinations were performed to evaluate the phenotype. An integrated genomic analysis was performed. Genotyping and linkage analysis were conducted to map the disease locus. Whole exome sequencing was performed to detect mutations in coding region. Whole genome sequencing was used to detect single nucleotide variations, small insertions, small deletions, or large structural variations. Copy number variation scanning was also performed on the genome scale. Interstitial insertion was confirmed by gap-PCR and quantitative-PCR, and breakpoint junctions were identified by genome walking and direct sequencing. Expression of products of genes nearby to the Xq27.1 palindrome was measured in peripheral blood from patients and unrelated controls via quantitative-PCR.ResultsThe identified compound phenotype of genu varum, cubitus valgus, and everted lipsdoes not match any reported clinical entities. Fine mapping and linkage analysis identified a candidate interval of 4 Mb on the X chromosome. No potential coding region mutations were detected. A 105 kb genomic fragment of PAR1 containing no coding genes was duplicated and inserted into the center of a human-specific palindrome at Xq27.1. The interstitial insertion fully cosegregated with the family phenotype. No expression of FGF13 or SOX3 was detected in peripheral blood from the proband or unrelated controls.ConclusionWe report an extremely rare phenotype associated with an infrequently-seen genomic rearrangement. The novel compound phenotype is X-linked and characterized by genu varum, cubitus valgus, and everted lips. A 105 kb interstitial insertion of a PAR1 fragment into the Xq27.1 palindrome is associated with the phenotype in the family. The present study identified the underlying genetic cause of the phenotype, expanding the spectrum of known human-specific Xq27.1 palindrome insertion events and associated phenotypes.

A novel missense mutation of CRYGS underlies congenital cataract in a Chinese family

Congenital cataract is a clinically and genetically heterogeneous disease. In this study, we examined a five-generation Chinese family with autosomal dominant nuclear congenital cataracts by whole exome sequencing. A novel heterozygous missense mutation c.199T>A, p.(Tyr67Asn) in CRYGS was identified in this family. The p.(Tyr67Asn) substitution was predicted to decrease the local hydrophobicity and affect the three-dimensional structure of γS-crystallin, and resulted in a portion of mutant protein translocation from the cytoplasm to cell membrane. Our observations expand the mutation spectrum of CRYGS and provide further evidence for the genetic basis and molecular mechanism of congenital cataract.

A dominant variant in the PDE1C gene is associated with nonsyndromic hearing loss.

Identification of genes with variants causing non-syndromic hearing loss (NSHL) is challenging due to genetic heterogeneity. The difficulty is compounded by technical limitations that in the past prevented comprehensive gene identification. Recent advances in technology, using targeted capture and next-generation sequencing (NGS), is changing the face of gene identification and making it possible to rapidly and cost-effectively sequence the whole human exome. Here, we characterize a five-generation Chinese family with progressive, postlingual autosomal dominant nonsyndromic hearing loss (ADNSHL). By combining population-specific mutation arrays, targeted deafness genes panel, whole exome sequencing (WES), we identified PDE1C (Phosphodiesterase 1C) c.958G>T (p.A320S) as the disease-associated variant. Structural modeling insights into p.A320S strongly suggest that the sequence alteration will likely affect the substrate-binding pocket of PDE1C. By whole-mount immunofluorescence on postnatal day 3 mouse cochlea, we show its expression in outer (OHC) and inner (IHC) hair cells cytosol co-localizing with Lamp-1 in lysosomes. Furthermore, we provide evidence that the variant alters the PDE1C hydrolytic activity for both cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP). Collectively, our findings indicate that the c.958G>T variant in PDE1C may disrupt the cross talk between cGMP-signaling and cAMP pathways in Ca2+ homeostasis.

ELMOD3, a novel causative gene, associated with human autosomal dominant nonsyndromic and progressive hearing loss.

Autosomal dominant nonsyndromic hearing loss (ADNSHL) is a highly genetically heterogeneous disorder. Up to date only approximately 37 ADNSHL-causing genes have been identified. The goal of this study was to determine the causative gene in a five-generation Chinese family with ADNSHL. A Chinese family was ascertained. Simultaneously, two affected individuals and one normal hearing control from the family were analyzed by whole exome capture sequencing. To assess the functional effect of the identified variant, in-vitro studies were performed. novel missense variant, c.512A>G (p.His171Arg) in exon 8 of the ELMO domain-containing 3 (ELMOD3) gene, was identified as a causative variant in this family affected by late-onset and progressive ADNSHL. The variant was validated by Sanger sequencing and found to co-segregate with the phenotype within the pedigree and was absent in 500 ethnically matched unrelated normal hearing control subjects. To our knowledge, this is the first report of a family with ADNSHL caused by ELMOD3 mutation. Western blots and immunofluorescence staining demonstrated that p.His171Arg resulted in abnormal expression levels of ELMOD3 and abnormal subcellular localization. Furthermore, the analysis of the stability of the wild-type (WT) and mutant ELMOD3 protein shows that the decay of p.His171Arg is faster than that of the WT, suggesting a shorter halflife of the c.512A > G variant. A novel variant in the ELMOD3 gene, encoding a member of the engulfment and cell motility (ELMO) family of GTPase-activating proteins, was identified for the first time as responsible for ADNSHL.

Identification of a Missense Mutation in the α-galactosidase A Gene in a Chinese Family with Fabry Disease.

Introduction: Fabry Disease (FD), the second most common lysosomal storage disorder after Gaucher disease, is characterized by variable clinical manifestations, including angiokeratoma, corneal dystrophy, recurrent episodes of extremity pain, renal impairment, cardiac complications and cerebrovascular manifestations. It is caused by mutations in the α-galactosidase A gene (gene symbol GLA) on chromosome Xq22, which leads to deficiency of lysosomal α-galactosidase A (α-Gal A), and subsequent accumulation of glycosphingolipids in various tissues and organs. The aim of this study is to identify the disease-causing mutation in a five-generation Chinese family with FD. A c.782G>T transversion (p.G261V) in the GLA gene was identified in four patients and two asymptomatic carriers by direct sequencing, and it co-segregated with the disease in the family. The variant is predicted to be disease-causing mutation and result in seriously abnormal function of α-Gal A. Four patients in this family present with classic phenotype of FD, including acroparesthesias, hypohidrosis, angiokeratomas and intermittent burning pain in extremity.Conclusion: The disease severity is similar among male and female patients. Our study extends the genotype-phenotype relationship between mutations in the GLA gene and clinical findings of FD, which may be helpful in the genetic counseling of patients with FD.

Exome sequencing identifies a novel missense mutation of WFS1 as the cause of non-syndromic low-frequency hearing loss in a Chinese family

ObjectiveAutosomal dominant non-syndromic low-frequency sensorineural hearing loss (LFSNHL) DFNA6/14/38 is an uncommon type of hearing loss that classically affects low frequencies of 2000 Hz and below, demonstrating an ascending configuration. The current study aimed to investigate the cause of LFSNHL in a five-generation Chinese family. MethodsThe phenotype of the Chinese family was characterized using audiologic testing and pedigree analysis. The combined approach of array screening and whole-exome sequencing was used to identify the disease-causing gene in this family. ResultsThis pedigree, in which the affected subjects presented isolated low-frequency sensorineural hearing impairment with childhood onset, was associated with autosomal dominant inheritance of the c.2591A > G mutation in exon 8 of the Wolframin syndrome 1 (WFS1) gene which was not present in 286 unrelated controls with matched ancestry and is highly conserved across species. In addition, several mutations affecting the Glu864 residue have been previously identified in different populations, suggesting that this site is likely to be a mutational hot spot. ConclusionsWe identified a novel substitution, Glu864Gly, of WFS1 as the causative variant for this pedigree. Our data extend the mutation spectrum of the WFS1 gene in Chinese individuals and may contribute to establishing a better genotype-phenotype correlation for LFSNHL.