Fig Mild Mottle-associated Virus Research Articles

First report of virus detection in Ficus carica in Austria

Ficus carica is one of the most ancient cultivated crops, and is grown mainly in the Mediterranean region. In Austria, due to milder winters and longer warm periods than normal, figs are becoming more productive and popular among private growers. For future propagation of some fig varieties, the phytosanitary status of eight fig accessions, representing four Austrian genotypes maintained in a varietal collection plot, was investigated using PCR assays for presence of eight fig-infecting viruses. The four fig trees were infected with fig mosaic virus (FMV), fig badnavirus 1 (FBV-1), fig leaf mottle-associated virus 1 (FLMaV-1), fig mild mottle-associated virus (FMMaV) and fig fleck-associated virus (FFkaV); whereas fig leaf mottle-associated virus 2 (FLMaV-2), fig latent virus 1 (FLV-1) and fig cryptic virus 1 (FCV-1) were not detected. The sequences of PCR amplicons obtained from different viruses and samples showed greatest nucleotide variability of 0.5% for FBV-1, 12% for FLMaV-1, 16.3% for FMV, 14% for FMMaV, and 15% for FFkaV, when compared to their homologues in GenBank. A phylogenetic tree for FMV constructed based on partial RNA1 sequences showed that the Austrian isolates were most closely related to previously described Spanish and Greek isolates. The different symptoms observed in the tested trees were mainly in similar to with those reported for FMV, the agent of fig mosaic disease. This is the first report on the presence of fig mosaic-associated viruses in Austria.

First report of Fig virus B in Ficus carica in New Zealand.

Fig (Ficus carica) has been cultivated since ancient times, and is now grown worldwide, both for its fruit and as an ornamental plant. Several viruses and viroids are associated with Fig mosaic disease (FMD), a disease complex occurring worldwide (Preising et al. 2021). Fig mosaic virus (FMV), fig leaf mottle-associated virus 1 (FLMaV-1), fig mild mottle-associated virus (FMMaV), and fig badnavirus 1 (FBV-1) are known to infect fig in New Zealand (Minafra et al. 2012; Veerakone et al. 2015). In December 2020, leaf samples from a fig tree growing on the roadside at St Heliers, Auckland, showing dieback with foliar chlorotic mosaic symptoms, was received for virus testing. Total nucleic acid was extracted from the symptomatic leaves using a KingFisher™ mL Purification System (Thermofisher Scientific, Waltham, MA) with an InviMag Plant DNA Mini Kit (Invitek Molecular GmbH, Germany) and subjected to high-throughput sequencing on an Oxford Nanopore Technologies MinION device using the method described in Liefting et al. 2021. All sequence analysis was performed using Geneious Prime 2021.1.1 (https://www.geneious.com). A total of 355,858 reads that passed quality check were subjected to BLASTn search against the NCBI nt database as described in Liefting et al. 2021. The following viruses produced hits: FMV, FBV-1, FMMaV and a fig closterovirus. The presence of FMV, FBV-1 and FMMaV were confirmed by species specific RT-PCRs. To identify the closterovirus, reads were mapped to closteroviruses reported in fig including the recently identified tentative species fig virus A (FiVA; GenBank accession no MN817232) and fig virus B (FiVB; GenBank accession no. MN817233). Five viral contigs ranging from 939 to 2,340 nucleotides (nt) were obtained from mapping to FiVB. Subsequently, a 6.4 kb sequence (GenBank accession no. OQ968551) from the 3' region of the NZ isolate was amplified by overlapping RT-PCR using primers designed from the contig sequences. The sequence shared 79.5% nucleotide (nt) identity with FiVB The original sample and a further 25 symptomatic and 10 asymptomatic fig samples, collected from the Auckland area between 2016 and 2021, were tested using FiVB specific RT-PCR and Sanger sequencing using primers FiVB-F1 (5'-GAGGGAGAGATGTAGATGC-3') and FiVB-R2 (5'-TGTCGTCGATATCGTTGTGT-3'), designed to amplify a 725 nt fragment in the 70 kDa heat shock protein (HSP70) ORF. Products of the expected size were amplified from the original sample and three symptomatic samples and their sequences found to be identical. BLAST searches showed that the sequence (GenBank accession no. ON553403) shared 82.7% nt and 87.3% amino acid (aa) identity to an isolate of FiVB (GenBank accession no MN817233). These additional positive samples were collected from a small home nursery where the plants were propagated from cuttings and have been distributed locally, suggesting the virus is very likely to have a limited spread throughout the Auckland area. All three FiVB infected samples were also positive for FMV. However, the association of FiVB with FMD symptoms is unknown. FiVB was first identified from a latex sample exuded from a fig tree collected from Japan (Park et al. 2021) and is the only report of FiVB in the world to date. Although an identical sequence from Argentina, named fig closterovirus 1, was submitted to GenBank, the origin of this isolate is not known. To our knowledge, this is the first report of FiVB in New Zealand.

Incidence, Molecular Detection, and Partial Nucleotide Sequencing of Some Viruses Causing Fig Mosaic Disease (FMD) on Fig Plants in Egypt.

Fig mosaic disease (FMD) is a viral disease that poses a significant danger to Egypt's fig-producing economy. During the two growing seasons 2017 and 2018, fig leaves and fruits displaying a variety of symptoms linked with fig mosaic disease (FMD) were collected and differentiated from the most famous fig-growing governorates in Egypt, Mersa Matruh, Ismailia, and Giza. Symptomatic samples were tested for the presence of fig mosaic virus (FMV), fig leaf mottle-associated virus 1 (FLMaV-1), fig leaf mottle-associated virus 2 (FLMaV-2), fig mild mottle-associated virus (FMMaV), fig latent virus 1 (FLV-1), fig fleck-associated virus (FFkaV), and fig cryptic virus (FCV) using reverse transcription-polymerase chain reaction (RT-PCR) with specific primers. Three viruses were detected in mixed infections and showed positive results. FMV was detected with infection rate 49% followed by FLMaV-2 with infection rate 21.8% and FLMaV-1 with infection rate 10.9%, respectively, whereas all tested samples were negative for the other viruses. According to the sequence and phylogenetic analysis, the Egyptian FMV isolate was closely related to other FMV isolates, particularly the Argentina ones (Acc. No. KP796424), with 99% identity. While FLMaV-1 showed more than 98% identity with reference isolate FLMaV-1 (Acc. No. LN873219), on the other hand, the isolate of FLMaV-2 showed 100% identity with reference FLMaV-2 isolate (Acc. No. FJ473383) based on phylogenetic analysis. Because fig output in Egypt is expanding, our findings suggest that greater attention should be paid to improving the phytosanitary condition of fig trees in Egypt.

Development of singleplex and multiplex real-time (Taqman®) RT-PCR assays for the detection of viruses associated with fig mosaic disease

Singleplex and multiplex real-time (TaqMan®) RT-PCR assays were developed to detect seven fig-infecting viruses, i.e., fig leaf mottle-associated virus 1 (FLMaV-1), fig leaf mottle-associated virus 2 (FLMaV-2), fig mild mottle-associated virus (FMMaV), fig mosaic virus (FMV), fig latent virus 1 (FLV-1), fig cryptic virus 1 (FCV-1) and fig fleck-associated virus (FFkaV). The sensitivity of the newly developed TaqMan® assays was compared with the corresponding conventional RT-PCR (RT-PCR) using 10° to 10−6 serial dilutions of both cDNA and crude fig extracts. The results showed that the Taqman® RT-PCR assays were generally 102 to 103-fold more sensitive than the RT-PCR assays, except in the case of FLV-1 detection, where the two techniques had the same sensitivity. In the multiplex Taqman® RT-PCR, only a maximum of five viruses could be detected simultaneously in naturally infected fig trees, regardless of which combination of the virus-specific probes and primers were used. Both the RT-PCR and Taqman® RT-PCR assays were used in a large-scale survey of 100 field-grown fig trees in Egypt. The results showed the presence of all seven viruses under study, mostly occurring as mixed infections (63 %). The prevalence of infections observed in the tested samples were as follows: FMV (62 %), FFkaV (59 %), FLMaV-2 (32 %), FLV-1 (16 %), FLMaV-1 (14 %), FCV-1 (7%) and FMMaV (4%). FMV was invariably associated with diseased trees that presented mosaic-like symptoms. In the few cases where the mosaic-affected trees were found to be free of FMV, they were found to be infected with a mixture of two or more other viruses.

Viruses Associated with Fig Mosaic Disease in Different Fig Varieties in Montenegro.

Symptoms of fig mosaic disease have been noticed on leaves of fig (Ficus carica) for several decades, in Montenegro. In 2014, leaf samples were collected from trees of six fig cultivars in a plantation located in the main fig-producing area of Montenegro, to study the disease. After RNA isolation, samples were tested by RT-PCR for detection of nine fig viruses and three viroids. Four viruses were detected: fig leaf mottle-associated virus 1 (FLMaV-1), fig mosaic virus (FMV), fig mild mottle-associated-virus (FMMaV) and fig badnavirus 1 (FBV-1). Most of the viruses were present in mixed infections. The amplicons of the viruses were directly sequenced from both directions. A BLAST search of these sequences revealed sequence identities with their closest counterparts at GenBank of 92, 97, 92 and 100%, for FLMaV-1, FMV, FMMaV and FBV-1, respectively. Different responses in symptom expression due to the various virus combinations detected have been demonstrated. Variety Sušilica had the least symptom expression, with only one virus (FBV-1) found. Considering that the production of figs in Montenegro is increasing and has a substantial relevance in this geographic location, the results indicate that more attention should be given to improving the phytosanitary condition of fig trees in the country.

SEROLOGICAL AND MOLECULAR DETECTION OF VIRUSES INFECTING FIG TO IDENTIFY THE VIRUS-FREE PLANTS

Fig (Ficus carica L.) is one of the old and the most common fruit tree grown in all the Mediterranean countries, which is among those exposed to diseases and pathogens. A recent investigation indicated that fig mosaic disease was the main pathogenic agent. In this study, field surveys were conducted in different areas of Egypt. A total of 300 leaf samples were collected randomly from symptomatic and symptomless fig trees of six cultivars, and tested by RT-PCR for the presence of Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FMMaV-2), Fig mild mottle-associated virus (FMMaV) and Fig latent virus 1 (FLV-1), using specific sets of primers. About 84% of the samples tested were found to be infected by at least one virus. FLMaV-1 was the prevailing virus with a (78.3%) incidence followed by FMV (73.7%), FLMaV-2 (50%), FLV-1(40.3%) and FMMaV (35%). The highest infection rate was observed in Sultani, Asuani and Adasi-Ahmer (100%), followed by Kahramani (80%), Kadota (64%) and Black Mission (60%).Ultra thin section for infected fig plants showed a large double-membrane particles (DMPs) 100-150 nm in diameter were located in the cytoplasm of parenchyma cells. Fig mosaic virus-specific antiserum raised in rabbits, proved useful for its detection in fig tissues. The plantlets from meristem tip tissue culture were transplanted successfully. FMV could be detected through DAS-ELISA in the virus-free fig plantlets.

Detection and phylogenetic analyses of fig-infecting viruses in Bosnia and Herzegovina and Montenegro

During spring 2016, a survey was carried out in Bosnian-Herzegovinian (BiH) and Montenegrin (MNE) fig orchards, germplasm collection plots and outdoor gardens, to investigate the presence of unreported fig viruses possibly present in both countries, i.e. Fig leaf mottle-associated virus 2 (FLMaV-2), Fig latent virus 1 (FLV-1), Fig cryptic virus 1 (FCV-1), Fig fleck-associated virus (FFkaV) and Fig badnavirus 1 (FBV-1); as well as those previously reported, i.e. Fig leaf mottle-associated virus 1 (FLMaV-1), Fig mild mottle-associated virus (FMMaV) and Fig mosaic emaravirus (FMV). A total of 84 fig samples (49 from BIH and 35 from MNE) were collected and tested by PCR/RT-PCR using sets of virus-specific primers. Results showed that FBV-1 was the prevailing virus with all samples (100%) infected, followed by FLMaV-1 (54% ) , FMV (35%), FMMaV (7%), FFkaV (6%) and FLMaV-2 (1%); whereas FLV-1 and FCV-1 were not detected. Excluding the FBV-1 detection, 35% of tested trees were infected with at least one other virus. Sequence analyses of PCR/RT-PCR fragments obtained from different viruses showed that FBV-1 was the least variable (0.9% of nucleotides divergent) compared with FLMaV-1 (15.7% sequence variation), FLMaV-2 (17.4%), FMMaV (14.9%), FMV (16.9%) and FFkaV (14.3%). Phylogenetic trees constructed with obtained sequences, together with their homologues retrieved from the Genbank database, showed distinct separation of the BiH and MNE isolates from those of different origins, in particular for FFkaV and FMV; whereas for closteroviruses (FLMaV-1, FLMaV-2 and FMMaV), there was no distinction between the isolates. This is the first report on sequence analyses of fig viruses in this geographical region, and of the presence of FBV-1 in BiH and MNE, and of FLMaV-2 and FFkaV.

Analysis of fig tree virus type and distribution in China

The common fig (Ficus carica L.) was one of the earliest horticultural crops to be domesticated. A number of different viruses can infect fig trees including Fig mosaic virus (FMV) that has been detected in several commercial fig trees in Xinjiang, China. However, the distribution of FMV and other fig-infecting viruses in China remains unknown. In the present study, a sample from an ancient fig tree growing in Xinjiang was investigated by electron microscopy (EM) followed by PCR/RT-PCR, and FMV, Fig badnavirus 1 (FBV-1) and Fig leaf mottle-associated virus 1 (FLMaV-1) were detected. Fig leaf samples (252) from commercial orchards across China were subjected to PCR/RT-PCR, and FMV, FBV-1 and Fig fleck-associated virus (FFkaV) were relatively abundant (44.4, 48.4 and 44%, respectively), while FLMaV-1 and Fig mild mottle-associated virus (FMMaV) were much scarcer (5.6 and 0.4%, respectively), and FLMaV-2, Fig cryptic virus (FCV), and Fig latent virus (FLV) were not detected. The presence of disease-causing viruses in fig trees presents a significant challenge for fig producers in China. This study may help to promote actions aimed at controlling fig viruses, especially FMV.

FIRST REPORT OF FIG MOSAIC VIRUS, FIG LEAF MOTTLE- ASSOCIATED VIRUS 1 AND FIG MILD MOTTLE-ASSOCIATED VIRUS INFECTING FIG (Ficus carica) IN MONTENEGRO

In Montenegro more than 200 000 fig trees are registered with an annual production of about 4000 t. A survey was conducted on fig trees of different varieties, located in a commercial orchard in Podgorica and a germplasm collection located in Bar, Montenegro, to assess the presence of five fig viruses i.e. Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 and 2 (FLMaV-1 and -2), Fig latent virus 1 (FLV-1) and Fig mild mottle-associated virus (FMMaV). In May 2015, leaf samples were taken from 21 fig trees showing leaf discolorations, vein clearing, ring spots, leaf distortion and mosaic symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (QIAGEN) and tested by RT-PCR using virus-specific primers (Elbeaino et al., 2006, 2009, 2010). RT-PCR results showed infections with FMV (9 of 21 samples tested), FLMaV-1 (18 of 21) and FMMaV (2 of 21), whereas FLMaV-2 and FLV-1 were not detected. FMMaV was identified only in samples from Bar in mixed infection with FMV and FLMaV-1. Nucleotides sequence analyses of PCR amplicons obtained (GenBank accession Nos. KU198374-KU198377, KU198383-KU198389) revealed that at the nucleotide level, FMV, FLMaV-1 and FMMaV isolates from Montenegro shared 86-95%, 93-95% and 84- 95% identity, respectively with homologues in the GenBank. To our knowledge, this is the first report of FMV, FLMaV-1 and FMMaV in fig trees in Montenegro. In the future, an extensive survey on more samples could allow a better evaluation of the sanitary status of this crop in the country.

DETECTION OF FIG MOSAIC VIRUS, FIG LEAF MOTTLE-ASSOCIATED VIRUS 1 AND FIG MILD MOTTLE-ASSOCIATED VIRUS IN BOSNIA AND HERZEGOVINA

During May 2015, a small scale survey was conducted on 27 fig trees situated in three locations (Mostar, Trebinje and Ljubuski) in Bosnia and Herzegovina, to investigate the presence of Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FLMaV- 2) and Fig mild mottle-associated virus (FMMaV). Samples consisted of leaves singularly taken from trees with symptoms of mosaic, vein yellowing, ring spots, necroses and leaf malformations (23 plants) and one asymptomatic tree, all situated in a fig germplasm collection plot. Additional three samples were taken from symptomatic fig plants of three outdoor gardens. Total RNAs extracted from the leaf midrib using RNeasy Plant Mini Kit (QIAGEN), were used in RT-PCR assays with specific primer pairs for each virus following protocols described in Elbeaino et al. (2006, 2009, 2010). RT-PCR results revealed 19 FMV- (70%), 25 FLMaV-1- (92%) and 4 FMMaV- (15%) positive samples. Double infections with FLMaV-1 and FMV were detected in 74% samples, while triple infections with FLMaV- 1, FMV and FMMaV affected 15% of tested figs. After cloning and bi-directional sequencing of 2 clones from random PCR amplicons for each virus, nucleotide BLASTn sequence analyses for FLMaV- 1 (350 bp) (GenBank Accession Nos. KU198378-KU198382), FMMaV (311 bp) (KU198388) and FMV (302 bp) (KU198367-KU198373) showed identity levels of 84-95%, 89-92% and 83-97%, respectively, with homologues available in GenBank. To our knowledge, this is the first report of three fig-infecting viruses (FLMaV-1, FMMaV and FMV) in Bosnia and Herzegovina and the results obtained, even if limited, reflect a precarious sanitary status of fig that needs a clean stock program in this country.

Four viruses infecting figs in Western Saudi Arabia

Many diseases are compromising fig production in Saudi Arabia and in particular those caused by viruses. RT-PCR assays were conducted on 80 samples collected from four fig-growing provinces in the West Mecca region of Saudi Arabia, including the Fatima, Khulais, Rabigh and Alshifa valleys. Samples consisted of leaf tissues taken from caprifig and common fig trees. The presence of Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FLMaV-2) and Fig mild mottle-associated virus (FMMaV) was assessed from the samples. RT-PCR results showed that all four viruses were present in the surveyed areas with different proportions of infection. Incidence was 69% of samples, with a peak of 80%, from the Alshifa and Fatima valleys, 60% from Rabigh and 55% from Khulais valley. FLMaV-1 was the prevailing virus (55% of samples), followed by FMV (34%), whereas FLMaV-2 (11% of samples) and FMMaV (6%) were less common. Most of the mosaic symptoms observed in surveyed fig orchards occurred with the presence of FMV. However, many other symptoms remained unexplained because of the arduous task of determining the involvement of other fig-infecting viruses with mosaic disease. This is the first report of FMMaV and FLMaV-2 in Saudi Arabia, and of FMV and FLMaV-1 in western Saudi Arabia. The virus status of this crop is probably compromised and a sanitation programme is required to produce healthy plant material in Saudi Arabia.

Incidence and distribution of viruses in Tunisian fig orchards.

A survey for viruses was carried out in the main fig-growing areas of Tunisia and in a fig germplasm collection at the Institut Superieure Agronomique de Chatt Mariem of Sousse. A total of 232 leaf samples were collected randomly from symptomatic and symptomless fig trees of 26 cultivars, and tested by RT-PCR for the presence of Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FMMaV-2), Fig mild mottle-associated virus (FMMaV), Fig cryptic virus (FCV), Fig fleck-associated virus (FFkaV) and Fig latent virus 1 (FLV-1), using specific sets of primers. About 62.1% of the samples tested were found to be infected by at least one virus. FMV was the prevailing virus with a 34.5% incidence, followed by FLV-1 (32.4%), FMMaV (10.7%), FLMaV-1 (10.3%), FFkaV (10.3%), FCV (9.9%) and FLMaV-2 (4.3%). The highest infection rate was observed in Sfax (100%), followed by Takelsa (73.4%), Djebba (70.2%), Sousse (66.6%), Mornag (54.4%) and Rafraf (50%), whereas it was moderate in Sidi Fraj (23.3%). Among all viruses detected, FMV was the most widespread, especially in Djebba (51.3%), Sfax (50%) and Takelsa (40.6%). According to the fig varieties, the highest infection rates were in the commercial cvs. Hamouri (87.5%), Bayoudhi (75%), Bouhouli (70.3%), Zidi (54.2%) Bither (53.8%), Bither Abyath (66.6%) and Soltani (69.2%). The results show the need to develop a clean stock program to prevent the dissemination of fig-infecting viruses associated with Fig mosaic disease in Tunisia.

Prevalence and genetic diversity of fig mosaic virus isolates infecting fig tree in Iran.

Commercial and outdoor fig orchards in four Iranian provinces were surveyed for the incidence of fig mosaic virus (FMV), fig leaf mottle associated virus 2 (FLMaV-2) and fig mild mottle associated virus (FMMaV) from March 2011 to October 2012. A total of 350 asymptomatic and symptomatic fig samples were collected and tested by dot-immunobinding assay (DIBA) for the fig mosaic disease (FMD) using a polyclonal antiserum. According to DIBA results, FMD was present in 73% of the collected symptomatic samples from all visited regions. Samples with positive reactions in DIBA were then analyzed by RT-PCR using with specific primers. PCR results showed that about 14.8% of the FMD-positive samples from three inspected provinces are infected with at least one virus. FMV was the most widely spread virus (14%) followed by FLMaV-2 (1.5%), whereas FMMaV was not found. Phylogenetic analysis of the glycoprotein nucleotide and amino acid sequences of known FMV isolates showed two independent groups with high bootstrap values, with all Iranian isolates distinctly clustered in group I, subgroup IA beside those reported in Turkey. Nucleotide diversity was high within but low between different selected geographic regions and except for Europe, nucleotide distance within geographic regions was low. Statistical analyses indicated a correlation between the genetic structure of the FMV isolates and the geographical origin of isolation. Our analyses suggested that the FMV population is in a state of increase following a bottleneck or founder event in Iran.

Fig Viruses in Mainland Spain

A survey of fig viruses was conducted from 2010 to 2012 on individual fig trees from outdoor gardens showing different symptoms associated with fig mosaic disease. A total of 30 fig leaf samples were collected from eight different provinces of mainland Spain and tested by reverse transcription polymerase chain reaction (RT-PCR) to assess the presence of fig mosaic virus (FMV), fig leaf mottle-associated virus 1 (FLMaV-1), fig leaf mottle-associated virus 2 (FLMaV-2), fig mild mottle-associated virus (FMMaV), fig latent virus 1 (FLV-1) and Fig fleck-associated virus (FFkaV). The 96.7% (29 samples of 30) of the analysed samples were infected with FMV, 16.7% (5 of 30) with FLMaV-1 and 26.7% (8 of 30) with FMMaV, whereas all samples were negative for FLMaV-2, FLV-1 and FFkaV. Mixed infection was observed in 13 samples. Sequencing analyses results showed that FMV, FMMaV and FLMaV-1 Spanish isolates shared 89–93% nt identity with other Mediterranean isolates of the same viruses. Phylogenetic analyses of the amplified RdRp fragment from the FMV grouped the Spanish isolates into a subgroup together with Japanese, Canadian and some Serbian and Turkish isolates. To our knowledge, this is the first report of FMV, FMMaV and FLMaV-1 occurring in mainland Spain.

Presence of Fig mild mottle-associated virus and Fig latent virus 1 in Tunisia.

A wide range of foliar symptoms including deformations, mosaic, chlorotic mottling, blotching, vein banding, clear- ing, feathering and chlorotic ringspots, as well as chlorotic ringspots on immature fruits were observed in Tunisian fig trees. The objective of this study was to survey fig orchards for the presence of Fig mild mottle-associated virus (FMMaV) and Fig latent virus 1 (FLV1). Eighty symptomatic and symp- tomless fig trees located at Takelsa, Sousse, Sfax and Morneg were collected in spring 2012. Total nucleic acids were ex- tracted from leaf tissue with the silica capture protocol (Fois- sac et al., 2000) and used in RT-PCR with specific prim- ers (i) FMMaV-s 5’ AAGGGGAATCTACAAGGGTCG 3’ and FMMaV-a 5’ TATTACGCGCTTGAGGATTGC 3 for the amplification of a 311 bp fragment from the heat shock protein 70 homologue gene (Elbeaino et al., 2010); and (ii) FLV1-s 5’ CCATCTTCACCACACAAATGTC 3’ and FLV1-a 5’ CAATCTTCTTGGCCTCCATAAG 3’ for the amplifica- tion of a 389 bp segment from the coat protein gene (Gattoni et al., 2009). Results disclosed 12 FMMaV-positive samples (14%) in Takelsa (5%), Morneg (1%) and Sousse (9%) but not in Sfax while FLV-1 occurred in all surveyed areas (44%) with the highest prevalence in Takelsa (19%) followed by Morneg (10%), Sousse (9%) and Sfax (6%). FMMaV-infected plants showed mild mottling and leaf deformations compa- rable to those observed in Italy on accession Cal-1 (Elbeaino et al., 2010). FLV-1 was detected in symptomless as well as in symptomatic trees. To the best of our knowledge, this represents the first record of FMMaV and FLV1 in Tunisia.

VIRUSES AND HOP STUNT VIROID OF FIG TREES IN SYRIA

A virus survey was carried out in spring and summer 2010 in Syrian fig orchards and gardens in 9 cities and in a varietal collection at Idleb. A total of 90 fig samples were collected and tested by RT-PCR for the presence of Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FLMaV-2), Fig mild mottleassociated virus (FMMaV), Fig mosaic virus (FMV), Fig latent virus 1 (FLV-1), Fig cryptic virus (FCV), Fig fleck-associated virus (FFkaV), and Hop stunt viroid (HSVd) using sets of specific primers. PCR results showed that about 84% of the trees were infected with at least one virus. FMV was the prevailing virus (56.7%), followed by FFkaV (36.7%), FLMaV-2 (31.1%), FMMaV (12.2%), FLV-1 (11.1%) and FLMaV-1 (4.4%), whereas FCV was not found. HSVd was detected in 13.3% of the samples. In a phylogenetic tree, the nucleotide sequences of most Syrian HSVd-fig isolates grouped with those reported in Lebanon from the same host and from mulberry, forming a distinct clade (M-group). This is the first report of FMMaV, FMV, FLV-1 and HSVd in fig trees in Syria.

Molecular Detection and Comparative Sequence Analysis of Viruses Infecting Fig Trees in Turkey

AbstractSeveral viruses infecting fig trees in Turkey have been identified recently. The samples were collected from the commonest fig cultivars showing typical mosaic symptoms and from symptomless plants from different fig growing regions of Turkey. They were tested for Fig leaf mottle‐associated virus 1‐2 (FLMaV1‐2), Fig mosaic virus (FMV), Fig latent virus‐1 (FLV‐1), Fig mild mottle‐associated virus (FMMaV), Arkansas fig closterovirus 1‐2 (AFCV1‐2), Fig badnavirus‐1 (FBV‐1) and Fig cryptic virus (FCV) by PCR and sequence analyses. One hundred fig trees were tested, and 83% of tested samples were found to be infected by at least one virus. Complex infections were detected in most of the samples, and the most common viruses were FBV‐1 and FMV with 82 and 79% infection ratios, respectively. The sequence analyses confirmed virus identity except for AFCV‐1 for which no sequence data are available in GenBank. Based on phylogenetic analysis, the sequences clustered into seven groups: FLV‐1, FMMaV, FBV‐1, FCV, FMV, AFCV‐1, FLMaV‐1, as expected, and no correlation was found between Turkish isolates depending on cultivars and provinces for these viruses.

Current Status of Fig Mosaic Disease in Iran

AbstractDuring 2009–2010, a survey was conducted in gardens and commercial fig orchards throughout Iran to determine the prevalence of Fig leaf mottle‐associated virus 1 (FLMaV‐1), Fig leaf mottle‐associated virus 2 (FLMaV‐2), Fig mild mottle‐associated virus (FMMaV), Fig latent virus 1 (FLV‐1) and Fig mosaic virus (FMV). Reverse transcription‐polymerase chain reaction and dot immunobinding assay (DIBA) were conducted on 104 fig samples collected from seven provinces. FLV‐1, FLMaV‐1 and FMV were found in 14.5, 11.5 and 8.6% of the samples, respectively, but FLMaV‐2 and FMMaV were absent. The overall average of infection reached 18.3%, with a peak of 42.9% in Semnan Province, followed by Golestan (40%), Tehran (32.3%), Lorestan (28.6%) and Mazandaran (25%) provinces. No infection was found in Fars and Gilan provinces. Fig samples from Varamin and Khorramabad districts showed high levels of mixed infections, 35.7 and 28.6%, respectively. The presence of FMV and FLV‐1 in the sap of symptomatic fig leaves was also ascertained by DIBA. Sequence analysis of amplified DNA from the partial RNA‐dependent RNA polymerase gene of two FMV isolates from Iran showed a low level of nucleotide variability (5%). The Iranian isolates shared a common phylogeny with other Mediterranean FMV isolates and in particular with those originating from Turkey already reported in GenBank. This is the first report on the presence of FLMaV‐1 and FLV‐1 in Iran and offers a preliminary insight into the unsatisfactory health status of fig in this country.

Viruses infecting figs in Egypt

Fig production in Egypt is in continuous decline because many diseases, particularly those caused by viruses, are compromising this crop. RT-PCR assays were conducted on 60 fig samples collected from three Egyptian fig-growing provinces (Ismailia, Qena and North Sinai), from the three main fig varieties (cvs. Sultany, Abode and El-Adasy), to investigate the presence of Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FLMaV-2), Fig mild mottle-associated virus (FMMaV) and Fig mosaic virus (FMV). The overall average incidence of infection reached 90%, with a peak of 95% in Ismailia province. All four viruses were detected in tested samples, with infection rates of 68.3% for FLMaV-1, 35% for FLMaV-2, 28.3% for FMMaV and 46.7% for FMV. This is the first report of the presence of these viruses in Egypt and offers a preliminary insight on the unsatisfactory sanitary status of fig in this country.

FIG MILD MOTTLE-ASSOCIATED VIRUS, A NOVEL CLOSTEROVIRUS INFECTING FIG

The partial genome sequence of a putative new closterovirus with particles ca. 2000 nm long, denoted Fig mild mottle-associated virus (FMMaV), was determined. The 6,290 nt long sequence encompasses seven open reading frames (ORFs), i.e. an incomplete ORF1b encoding the putative RNA-dependent RNA polymerase (RdRp), a 25 kDa protein with unknown functions, a 6 kDa protein with putative nucleotide-binding properties, the 63 kDa homologue of the heat-shock protein 70 (HSP70h), a 64 kDa protein, the minor coat protein (CPm) of 26 kDa in size, and the incomplete coat protein (CP). The genome organization of FMMaV is the same as that of members of the genus Closterovirus. This taxonomic position was confirmed by comparative analyses of the RdRp, HSP70h and CPm amino acid sequences which clustered FMMaV in a clade comprising members of the genus Closterovirus in phylogenetic trees constructed with these sequences. Comparison with Fig leaf mottle-associated virus 1 (FLMaV-1), the other putative fig-infecting closterovirus currently known, showed ca. 30% divergence in the HSP70h gene at the amino acid level. In a preliminary survey carried out in southern Italian fig orchards, FMMaV was detected in three different cultivars.