Fig Badnavirus Research Articles

High-Throughput Sequencing Identified Multiple Fig Viruses and Viroids Associated with Fig Mosaic Disease in Iraq.

Mosaic is the most common viral disease affecting fig plants. Although the Fig mosaic virus is the leading cause of mosaic disease, other viruses are also involved. High-throughput sequencing was used to assess viral infections in fig plants with mosaic. The genomic DNA and total RNAseq of mosaic-symptomatic fig leaves were sequenced using the Illumina platform. The analysis revealed the presence of fig badnavirus 1 (FBV-1), grapevine badnavirus 1 (GBV-1), citrus exocortis viroid (CEVd), and apple dimple fruit viroid (ADFVd). The FBV-1 and GBV-1 sequences were 7,140 bp and 7,239 bp long, respectively. The two genomes encode one open reading frame containing five major protein domains. The viroids, CEVd and ADFVd, were 397 bp and 305 bp long. Phylogenetic analyses revealed a close relationship between FBV-1 and Iranian isolates of the same species, while GBV-1 was closely related to Russian grapevine badnavirus isolates (Tem64, Blu17, KDH48, and Pal9). CEVd was closely related to other Iraqi isolates, while ADFVd was strongly related to a Spanish isolate. A registered endogenous pararetrovirus, caulimovirus-Fca1, with a size of 7,556 bp, was found in the RNA transcripts with a low expression level. This integrant was also detected in the genomes of the two lines 'Horaishi' (a female line) and 'Caprifig 6085' (a male line). Phylogenetic analyses revealed that caulimovirus-Fca1 was distinct from two other clades of different endogenous virus genera.

First Report and Molecular Characterization of Umbra-like Virus on Ficus carica Caprifig Trees in Crimea.

Fig mosaic is the most serious viral disease affecting figs. A fig germplasm collection from the Nikita Botanical Garden on the Crimean Peninsula was surveyed for viruses using high-throughput sequencing and RT-PCR with primers specific to known fig viruses. Reads related to fig umbra-like virus (FULV) were generated in samples from Ficus carica caprifig (pollinator) trees of the cultivar Belle dure. F. carica trees of other cultivars, as well as F. afghanistanica, F. palmata, and F. virgata trees, tested negative for FULV. Near-complete genomes of five Crimean fig umbra-like virus (FULV-CR) isolates shared 99.4% to 99.9% identity and were most closely related (85.2% identity) to the Hawaiian FULV isolate Oahu1 (MW480892). Based on their genome structure and a phylogenetic analysis, the FULV-CR isolates were determined to be dicot-infecting Class 2 umbra-like viruses and seem to be highly divergent forms of the same virus found recently in Hawaii, USA. This is the first report of an umbra-like virus found on figs in Crimea and outside of Hawaii, expanding information on the geographical distribution and genetic diversity of FULV. All of the Crimean FULV-positive plants were also co-infected with fig mosaic virus, fig badnavirus 1, and grapevine badna FI virus.

First report of virus detection in Ficus carica in Austria

Ficus carica is one of the most ancient cultivated crops, and is grown mainly in the Mediterranean region. In Austria, due to milder winters and longer warm periods than normal, figs are becoming more productive and popular among private growers. For future propagation of some fig varieties, the phytosanitary status of eight fig accessions, representing four Austrian genotypes maintained in a varietal collection plot, was investigated using PCR assays for presence of eight fig-infecting viruses. The four fig trees were infected with fig mosaic virus (FMV), fig badnavirus 1 (FBV-1), fig leaf mottle-associated virus 1 (FLMaV-1), fig mild mottle-associated virus (FMMaV) and fig fleck-associated virus (FFkaV); whereas fig leaf mottle-associated virus 2 (FLMaV-2), fig latent virus 1 (FLV-1) and fig cryptic virus 1 (FCV-1) were not detected. The sequences of PCR amplicons obtained from different viruses and samples showed greatest nucleotide variability of 0.5% for FBV-1, 12% for FLMaV-1, 16.3% for FMV, 14% for FMMaV, and 15% for FFkaV, when compared to their homologues in GenBank. A phylogenetic tree for FMV constructed based on partial RNA1 sequences showed that the Austrian isolates were most closely related to previously described Spanish and Greek isolates. The different symptoms observed in the tested trees were mainly in similar to with those reported for FMV, the agent of fig mosaic disease. This is the first report on the presence of fig mosaic-associated viruses in Austria.

First report of Fig virus B in Ficus carica in New Zealand.

Fig (Ficus carica) has been cultivated since ancient times, and is now grown worldwide, both for its fruit and as an ornamental plant. Several viruses and viroids are associated with Fig mosaic disease (FMD), a disease complex occurring worldwide (Preising et al. 2021). Fig mosaic virus (FMV), fig leaf mottle-associated virus 1 (FLMaV-1), fig mild mottle-associated virus (FMMaV), and fig badnavirus 1 (FBV-1) are known to infect fig in New Zealand (Minafra et al. 2012; Veerakone et al. 2015). In December 2020, leaf samples from a fig tree growing on the roadside at St Heliers, Auckland, showing dieback with foliar chlorotic mosaic symptoms, was received for virus testing. Total nucleic acid was extracted from the symptomatic leaves using a KingFisher™ mL Purification System (Thermofisher Scientific, Waltham, MA) with an InviMag Plant DNA Mini Kit (Invitek Molecular GmbH, Germany) and subjected to high-throughput sequencing on an Oxford Nanopore Technologies MinION device using the method described in Liefting et al. 2021. All sequence analysis was performed using Geneious Prime 2021.1.1 (https://www.geneious.com). A total of 355,858 reads that passed quality check were subjected to BLASTn search against the NCBI nt database as described in Liefting et al. 2021. The following viruses produced hits: FMV, FBV-1, FMMaV and a fig closterovirus. The presence of FMV, FBV-1 and FMMaV were confirmed by species specific RT-PCRs. To identify the closterovirus, reads were mapped to closteroviruses reported in fig including the recently identified tentative species fig virus A (FiVA; GenBank accession no MN817232) and fig virus B (FiVB; GenBank accession no. MN817233). Five viral contigs ranging from 939 to 2,340 nucleotides (nt) were obtained from mapping to FiVB. Subsequently, a 6.4 kb sequence (GenBank accession no. OQ968551) from the 3' region of the NZ isolate was amplified by overlapping RT-PCR using primers designed from the contig sequences. The sequence shared 79.5% nucleotide (nt) identity with FiVB The original sample and a further 25 symptomatic and 10 asymptomatic fig samples, collected from the Auckland area between 2016 and 2021, were tested using FiVB specific RT-PCR and Sanger sequencing using primers FiVB-F1 (5'-GAGGGAGAGATGTAGATGC-3') and FiVB-R2 (5'-TGTCGTCGATATCGTTGTGT-3'), designed to amplify a 725 nt fragment in the 70 kDa heat shock protein (HSP70) ORF. Products of the expected size were amplified from the original sample and three symptomatic samples and their sequences found to be identical. BLAST searches showed that the sequence (GenBank accession no. ON553403) shared 82.7% nt and 87.3% amino acid (aa) identity to an isolate of FiVB (GenBank accession no MN817233). These additional positive samples were collected from a small home nursery where the plants were propagated from cuttings and have been distributed locally, suggesting the virus is very likely to have a limited spread throughout the Auckland area. All three FiVB infected samples were also positive for FMV. However, the association of FiVB with FMD symptoms is unknown. FiVB was first identified from a latex sample exuded from a fig tree collected from Japan (Park et al. 2021) and is the only report of FiVB in the world to date. Although an identical sequence from Argentina, named fig closterovirus 1, was submitted to GenBank, the origin of this isolate is not known. To our knowledge, this is the first report of FiVB in New Zealand.

A Fig Deal: A Global Look at Fig Mosaic Disease and its Putative Associates.

Fig mosaic disease (FMD) is a complex viral disease with which 12 viruses, including a confirmed causal agent, fig mosaic emaravirus (FMV), and three viroids are associated worldwide. FMD was first described in California in the early 1930s. Symptoms include foliar chlorosis, deformation, and mosaic patterns. FMD is disseminated by vegetative propagation, seed transmission, and vectors, including a mite, Aceria ficus. Management of the disease in fig orchards relies on scouting and elimination of infected trees. In this review, we focus on the distribution of the FMD-associated viruses and viroids by summarizing worldwide surveys and their genome structure. We also determined the full-length sequence of FMV and fig badnavirus 1 (FBV-1) isolates from Connecticut and compared the virus and viroid sequences from fig isolates. We suggest important areas of research including determining the potential synergistic effect of multiple viruses, elucidating the full-length genome sequence of each associated virus, and relating virus titer to phenotypic changes in Ficus carica.

Detection and Phylogenetic Analysis of Viruses Linked with Fig Mosaic Disease in Seventeen Fig Cultivars in Palestine.

Fig mosaic is a viral disease (FMD) that spreads in Palestinian common fig ( Ficus carica L.) orchards. Recognizing the economic value of fig plants and the harmful nature of FMD, the disease poses a significant threat to the economy of the fig production in Palestine. We applied the reverse transcription and amplification (RT-PCR) and PCR technique to leaf samples of 77 trees and 14 seedlings of 17 fig cultivars. The samples were collected from orchards in the main fig-growing provinces of the Palestinian West Bank, to assess the prevalence of viruses associated with FMD, and confirm a possible link of symptoms with viruses detected. Four viruses were detected: Fig mosaic virus (FMV), Fig badnavirus-1 (FBV-1), Fig leaf mottle-associated virus 2 (FLMaV-2), and Fig fleck-associated virus (FFkaV). FMV and FBV-1 were found in all tested fig plants (100%), while FLMaV-2 and FFkaV were detected in 61.5% and 33% of the fig samples, respectively. The high incidence of FBV-1 in the newly propagated symptomatic and symptomless seedlings from different cultivars may be an indication that FBV-1 is integrated into the genome of the fig in a cultivar nondiscriminatory manner. Very weak or no association was detected between FMD symptoms severity in the 17 Palestinian fig cultivars with the various viruses’ combinations observed (i.e., number of the viruses infecting the plant). These results support the notion that FMD symptom severity expression is likely to be controlled by a combination of FMV infection, cultivars, and environmental factors, rather than the number of viruses infecting the plant.

Viruses Associated with Fig Mosaic Disease in Different Fig Varieties in Montenegro.

Symptoms of fig mosaic disease have been noticed on leaves of fig (Ficus carica) for several decades, in Montenegro. In 2014, leaf samples were collected from trees of six fig cultivars in a plantation located in the main fig-producing area of Montenegro, to study the disease. After RNA isolation, samples were tested by RT-PCR for detection of nine fig viruses and three viroids. Four viruses were detected: fig leaf mottle-associated virus 1 (FLMaV-1), fig mosaic virus (FMV), fig mild mottle-associated-virus (FMMaV) and fig badnavirus 1 (FBV-1). Most of the viruses were present in mixed infections. The amplicons of the viruses were directly sequenced from both directions. A BLAST search of these sequences revealed sequence identities with their closest counterparts at GenBank of 92, 97, 92 and 100%, for FLMaV-1, FMV, FMMaV and FBV-1, respectively. Different responses in symptom expression due to the various virus combinations detected have been demonstrated. Variety Sušilica had the least symptom expression, with only one virus (FBV-1) found. Considering that the production of figs in Montenegro is increasing and has a substantial relevance in this geographic location, the results indicate that more attention should be given to improving the phytosanitary condition of fig trees in the country.

Exploring the genetic diversity and molecular evolution of fig badnavirus-1 from Iran

Complete genome sequences of five fig badnavirus-1 (FBV-1) isolates from different geographic origins in Iran were obtained from infected fig plants using conventional sequencing of overlapping PCR fragment with appropriate primers. Phylogenetic analysis of these five Iranian isolates as well as the one previously sequenced USA isolate indicated that the Iranian isolates could be divided into two distinct subgroups, reflecting either divergences or two different origins. Iranian isolates were genetically distinct from the USA isolate. The phylogenetic analysis of the so-called diversity genomic region (992 nt) from 27 FBV-1 Iranian and 44 USA isolates gave two main groups. Sequences from Iran were distributed between two groups and the four subgroups of the first group besides other US isolates, and segregated according to their geographical origin. In contrast to the Iranian isolates, phylogenetic analysis grouped the USA isolates into three subgroups in the first group. To gain insight into the evolutionary forces driving the emergence of these FBV-1 populations, we analyzed the nucleotide sequences of the diversity genomic region from 71 FBV-1 isolates. Neutrality tests suggested the occurrence of purifying selection acting upon the population. For all genomic regions analyzed, diversity values were high for the nucleotide-coding sequences of the open reading frame 3, which suggests different selective constraints from the variation observed in the proteins encoded by this open reading frame. Low natural selection following founder events and rapid expansion of FBV-1 isolates into new ecological niches could result in the observed homogeneity of subpopulations.

Detection and phylogenetic analyses of fig-infecting viruses in Bosnia and Herzegovina and Montenegro

During spring 2016, a survey was carried out in Bosnian-Herzegovinian (BiH) and Montenegrin (MNE) fig orchards, germplasm collection plots and outdoor gardens, to investigate the presence of unreported fig viruses possibly present in both countries, i.e. Fig leaf mottle-associated virus 2 (FLMaV-2), Fig latent virus 1 (FLV-1), Fig cryptic virus 1 (FCV-1), Fig fleck-associated virus (FFkaV) and Fig badnavirus 1 (FBV-1); as well as those previously reported, i.e. Fig leaf mottle-associated virus 1 (FLMaV-1), Fig mild mottle-associated virus (FMMaV) and Fig mosaic emaravirus (FMV). A total of 84 fig samples (49 from BIH and 35 from MNE) were collected and tested by PCR/RT-PCR using sets of virus-specific primers. Results showed that FBV-1 was the prevailing virus with all samples (100%) infected, followed by FLMaV-1 (54% ) , FMV (35%), FMMaV (7%), FFkaV (6%) and FLMaV-2 (1%); whereas FLV-1 and FCV-1 were not detected. Excluding the FBV-1 detection, 35% of tested trees were infected with at least one other virus. Sequence analyses of PCR/RT-PCR fragments obtained from different viruses showed that FBV-1 was the least variable (0.9% of nucleotides divergent) compared with FLMaV-1 (15.7% sequence variation), FLMaV-2 (17.4%), FMMaV (14.9%), FMV (16.9%) and FFkaV (14.3%). Phylogenetic trees constructed with obtained sequences, together with their homologues retrieved from the Genbank database, showed distinct separation of the BiH and MNE isolates from those of different origins, in particular for FFkaV and FMV; whereas for closteroviruses (FLMaV-1, FLMaV-2 and FMMaV), there was no distinction between the isolates. This is the first report on sequence analyses of fig viruses in this geographical region, and of the presence of FBV-1 in BiH and MNE, and of FLMaV-2 and FFkaV.

Analysis of fig tree virus type and distribution in China

The common fig (Ficus carica L.) was one of the earliest horticultural crops to be domesticated. A number of different viruses can infect fig trees including Fig mosaic virus (FMV) that has been detected in several commercial fig trees in Xinjiang, China. However, the distribution of FMV and other fig-infecting viruses in China remains unknown. In the present study, a sample from an ancient fig tree growing in Xinjiang was investigated by electron microscopy (EM) followed by PCR/RT-PCR, and FMV, Fig badnavirus 1 (FBV-1) and Fig leaf mottle-associated virus 1 (FLMaV-1) were detected. Fig leaf samples (252) from commercial orchards across China were subjected to PCR/RT-PCR, and FMV, FBV-1 and Fig fleck-associated virus (FFkaV) were relatively abundant (44.4, 48.4 and 44%, respectively), while FLMaV-1 and Fig mild mottle-associated virus (FMMaV) were much scarcer (5.6 and 0.4%, respectively), and FLMaV-2, Fig cryptic virus (FCV), and Fig latent virus (FLV) were not detected. The presence of disease-causing viruses in fig trees presents a significant challenge for fig producers in China. This study may help to promote actions aimed at controlling fig viruses, especially FMV.

INCIDENCE AND DISTRIBUTION OF FIG BADNAVIRUS 1 AND MULBERRY BADNAVIRUS 1 ON MULBERRY TREES IN IRAN

Fig badnavirus 1 (FBV-1) and mulberry badnavirus-1 (MBV-1) are two closely related badnaviruses which were recently identified in fig and mulberry plants. Thirty-six fig and 27 mulberry orchards were surveyed to determine the presence and incidence of FBV-1 and MBV-1 in four provinces of Iran. A total of 81 fig and 70 mulberry asymptomatic and symptomatic leaf samples were collected in April to August 2015 and tested by PCR. Approximately 62% and 33% of the tested fig and mulberry samples, respectively, were infected with FBV-1. None of the fig samples was found to be infected with MBV-1. MBV-1 was detected in only 8.5% of the mulberry samples collected in two provinces. Mixed infections of FBV-1 with MBV-1 were detected in 7% of the samples. The presence of both viruses in asymptomatic and symptomatic trees was verified by PCR. Sequence analysis of the cloned movement protein (MP) gene of thirteen Iranian FBV-1 isolates showed 97-99% nucleotide (nt) sequence identity among the isolates and 98-99% nt sequence identity to the American reference isolate. The MP fragments of two Iranian MBV-1 isolates showed 98-100% nt sequence identity to the reference Lebanese MBV-1 isolate. In phylogenetic analyses, isolates of FBV-1 formed two distinct clades and grouped according to the host. To our knowledge, this is the first report of FBV-1 and MBV-1 infecting mulberry plants in Iran.

FIRST REPORT OF FIG MOSAIC VIRUS AND FIG BADNAVIRUS 1 ON COMMON FIG TREES IN CROATIA

Common fig (Ficus carica L.) is one of the most common fruit trees in the Croatian coastal region. Fig mosaic symp- toms, first reported more than a half century ago (Perisic , 1952) are found on most cultivars. In 2014, leaf samples were taken from 30 autochthonous fig trees from two locations of the Istrian peninsula for laboratory analyses. Twenty six trees exhibited typical symptoms of foliar mosaic, one tree exhibited also fasciations, while the remaining four trees were asymptomatic. Extraction of total RNA was done us- ing an RNeasy plant mini kit (Qiagen, Germany) and ex- traction of DNA using a GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich, USA). Plants were tested by PCR for the presence of Fig mosaic virus (FMV) and Fig badnavirus 1 (FBV-1), applying previously described condi- tions and diagnostic primers (Elbeaino et al., 2009; Laney et al., 2012). A symptomless fig tree was used as negative control. The infection with FMV was confirmed in 26 symp- tomatic out of 30 sampled trees (87%), while all 30 plants were positive for FBV-1. One amplicon each of FMV and FBV-1 (isolates FMV-Cro-19S and FBV-1-Cro-17S, respec- tively), were sequenced in both directions (GenBank acces- sion Nos KT312843 and KT312844). A BLASTN program search showed 97% identity at the nucleotide level of the FMV-Cro-19S RdRp gene with the comparable sequence of FMV SB2-2 isolate from Serbia (AB697838), while the poly- protein gene from FBV-1-Cro-17S had a sequence identical to that of several FBV-1 isolates from the USA (JN050864, JN050875, JN112365). To the best of our knowledge, this is the first report of FMV and FBV-1 in Croatia.

Prevalence and phylogenetic analysis of Fig mosaic virus and Fig badnavirus-1 in Iran

Abstract Fig mosaic virus (FMV) and Fig badnavirus-1 (FBV-1) are two of the most important fig infecting viruses. The incidence and distribution of FBV-1 and FMV were determined by testing in PCR 138 asymptomatic and symptomatic samples. These samples were collected from 60 fig gardens and agricultural fields in three provinces of Iran. The fig infecting viruses FBV-1 and FMV, respectively, were detected in 92 (66.6%) and 34 (24.6%) samples collected from all the surveyed fields. Overall, 24 out of 138 (17.3%) samples showed mixed infections. The sequence analysis of a genomic fragment of 922 nt, comprising the entire ORF-2 and part of the 5’ termini of the ORF-3 of 10 selected FBV-1 Iranian isolates from different provinces, and of the type member from GenBank (Acc. No: JF411989), showed a variation ranging from 1 to 3% at nucleotide level and 1% at the amino acid level. The phylogenetic analysis grouped the FBV-1 isolates into two groups, with the Iranian isolates clustered in two distinct subgroups of group I, according to their geographical origin. In our research, the prevalence and sequence analysis of FBV-1 as the only identified DNA virus infecting fig trees, was studied for the first time in Iran.

FIRST REPORT OF GRAPEVINE RODITIS LEAF DISCOLORATION- ASSOCIATED VIRUS IN ITALY

In 2014, some registered native grapevine cultivars from Apulia were analyzed to determine their "absolute" sanitary status (virome) i.e. the totality of virus, viroids and phytoplasmas, present in any single accession, using a high throughput sequencing (HTS) approach (Giampetruzzi et al., 2015). Small RNA libraries synthesized from a symptomless red-berried wine grapevine of cv. Bombino nero (accession D205), growing in a foundation block, showed the presence of 21 contigs (ranging from 329 to 56 nucleotides in length) which, upon BLASTX analysis (Altschul et al., 1997), were identified as badnavirus-like sequences. To confirm deep-sequencing findings, a set of PCR specific primers (11for-G: 5’CAAAGTAAGAGCAATCCTTGATACCGG3’; 13rev-G: 5’ CCCAATGTTACAGATCACCATCTCCTG3’) were designed, using the closest reference sequence, i.e. Fig badnavirus 1 (FBV-1, GenBank Accession no. NC017830). A product of the expected size (410 bp) was amplified and custom-sequenced, showing ca. 91% identity at the nucleotide level with the sequence of a badnavirus recently discovered in Greece (Maliogka et al., 2015) and denoted Grapevine Roditis leaf discoloration-associated virus (GRLDaV, NC027131). For a preliminary assessment of the incidence of this virus in the field, a preliminary survey in the same foundation block was conducted. A total of 11 samples from different autochthonous cultivars were checked by PCR, but none of them tested positive. It is worth nothing that accession D205 is a registered clone, which has been inspected for years by laboratory testing and field indexing without revealing the presence of regulated viruse, nor showing symptoms. To our knowledge, this is the first report of GRLDaV in Italy.

A SURVEY FOR FIG-INFECTING VIRUSES IN PALESTINE

SUMMARY A virus disease of fig (Ficus carica) known as fig mosaic (FM) is widely spread in Palestine, where its severity varies according to the cultivar and the growing area. At least 10 viruses and three viroids have been detected so far in fig trees. This study reports the results of a preliminary survey carried out in Palestine to secure information on the viruses associated with mosaic-infected figs. Samples were collected from scattered trees, fig orchards and nurseries of different areas of central Palestine, where figs are traditionally grown, and tested for the presence of Fig mosaic virus (FMV), Fig latent virus 1 (FLV-1), Fig badnavirus-1 (FBV-1), Fig leaf mottle-associated virus 1 (FLMaV-1) and 2 (FLMaV-2), and Fig cryptic virus (FCV) in addition to Apple dimple fruit viroid (ADFVd). The following viruses. FMV, FBV-1, FLV-1 and FLMaV-2, were detected by RT-PCR. FBV-1 was the most widespread followed by FMV. The genetic diversity of FMV was assessed by sequencing a fragment from the viral p4 protein, revealing a low divergence from the homologous sequences from GenBank.

A novel grapevine badnavirus is associated with the Roditis leaf discoloration disease

Roditis leaf discoloration (RLD), a graft-transmissible disease of grapevine, was first reported in Greece in the 1980s. Even though various native grapevine viruses were identified in the affected vines, the etiology of the disease remained unknown. In the present study, we used an NGS platform for sequencing siRNAs from a twenty-year old Roditis vine showing typical RLD symptoms. Analysis of the NGS data revealed the presence of various known grapevine viruses and viroids as well as a hitherto uncharacterized DNA virus. The circular genome of the new virus was fully reassembled. It is 6988 nts long and includes 4 open reading frames (ORFs). ORF1, ORF2 and ORF4 code for proteins with unknown functions while ORF3 encodes a polyprotein with motifs related to the replication, encapsidation and movement of the virus. Phylogenetic analysis classified the novel virus within the genus Badnavirus, with closest relationship to Fig badnavirus 1. Further studies showed that the new badnavirus is closely related with the RLD disease and the provisional name grapevine Roditis leaf discoloration-associated virus (GRLDaV) is proposed. Our findings extend the number of DNA viruses identified in grapevine, further drawing attention to the potential importance of this virus group on grapevine pathology.

Complete genome sequence of yacon necrotic mottle virus, a novel putative member of the genus Badnavirus.

The complete genome sequence of a previously undescribed virus isolated from a yacon plant exhibiting necrotic mottle, chlorosis, stunting, and leaf malformation symptoms in Gyeongju, Korea, was determined. The genome of this virus consists of one circular double-stranded DNA of 7661 bp in size. The genome contained four open reading frames (ORFs 1 to 4) on the plus strand that potentially encode proteins of 26, 32, 234, and 25 kDa. Protein BLAST analysis showed that ORF3, which is the largest ORF, has 45 % amino acid sequence identity (with 89 % coverage) to the ORF3 of fig badnavirus 1 (FBV-1), a recently identified badnavirus. Phylogenetic analysis provided further evidence that the virus identified in this study is probably a member of a new species in the genus Badnavirus. The name yacon necrotic mottle virus (YNMoV) is proposed for this new virus.

Complete genome sequencing of Piper yellow mottle virus infecting black pepper, betelvine, and Indian long pepper.

The complete genome of the Piper yellow mottle virus (PYMoV), a Badnavirus belonging to the family Caulimoviridae, was sequenced from three naturally infected hosts namely, black pepper, betelvine, and Indian long pepper. The genome length of the three virus strains (one from each of the three host species) varied from 7,559 to 7,584 nucleotides, and all the three strains possessed four open reading frames (ORFs) I to IV that potentially encode proteins of 15.67, 17.08, 218.6, and 17.22 kDa, respectively. ORF III encodes a polyprotein consisting of viral movement protein, trimeric dUTPase, zinc finger, aspartic protease, reverse transcriptase, and RNase H whereas ORF I, II, and IV encode proteins of unknown functions. The complete genome sequences at the nucleotide level were 89-99 % identical with one available sequence of PYMoV and 39-56 % identical with other badnaviruses, indicating that all three are strains of PYMoV. Nucleotide and amino acid sequences of ORF I-IV and of the intergenic region (IR) were 80-100 % identical among PYMoV strains. Phylogenetic analysis of ORF III amino acid sequences showed the PYMoV strains forming a distinct cluster well separated from other badnaviruses. Among other badnaviruses, Fig badnavirus 1 (FBV-1) was the one most closely related to PYMoV.

Sanitation trials for the production of virus-free fig stocks

SUMMARY Heat therapy, meristem tip culture in vitro and a combination of both techniques were used for obtaining fig (Ficus carica) plants free from some viruses associated with fig mosaic, a disease with a worldwide distribution. Source plants were two field-grown adult fig accessions from a germplasm repository of the University of Bari (Italy) that showed severe and mild symptoms of mosaic, respectively, and two symptomless fig seedlings grown under screen. Adult plants were infected by Fig mosaic virus (FMV), Fig latent virus 1 (FLV-1) and Fig badnavirus 1 (FBV-1). Seedlings were infected by FLV-1 and FBV-1. Progeny of explants subjected to meristem tip culture were still infected by FMV (93.8% elimination). This virus, however, was eradicated (100% sanitation) by shoot tip culture combined with heat therapy, or in vitro heat therapy. High sanitation rates from FLV-1 (81 to 100%) were also registered with all sanitation procedures employed, such as in vitro heat therapy alone (two cycles) or combined with tissue culture. By contrast, the DNA virus FBV-1 resisted all attempts of elimination, a behaviour that confirms indirectly its hypothesized integration in the fig genome.

IDENTIFICATION OF A BADNAVIRUS INFECTING MULBERRY

SUMMARY Electron microscope observation of leaf dips from a mulberry (Morus alba) tree from Lebanon showing leaf mottling and vein yellowing disclosed the presence of bacilliform particles ca. 150x30 nm in size, resembling those of members of the genus Badnavirus. BLAST analysis of the sequence of a DOP-PCR clone (810 bp) generated from DNA extracts from partially purified particle preparation disclosed a 67% (nucleotide) and 63% (amino acid) identity with the reverse transcriptase/RNase H gene (ORF3) of the badnavirus Cacao swollen shoot virus (CSSV). In a phylogenetic tree constructed with the amino acid sequence obtained, the putative mulberry badnavirus clustered close to CSSV and Citrus mosaic virus (CiMV) in a branch comprising also Fig badnavirus 1 (FBV-1) and Dioscorea bacilliform virus (DBALV). PCR analyses showed that the virus occurs with high infection rates in Lebanon (7 out of 13 trees examined), Turkey (2 out of 3) and Italy (29 out of 39). However, except for one, all PCR-positive trees were symptomless. Thus, since there is no clear-cut association of the virus in question with a specific disease, we propose for it the provisional name of Mulberry badnavirus 1 (MBV-1).