Fertile Men Research Articles

7397 Characterization of Sperm-Carried IGF2 Transcript Variants

Abstract Disclosure: R. Cannarella: None. M. Suryavanshi: None. A. Miller: None. S.D. Lundy: None. A.E. Calogero: None. Background: We have previously identified the expression of the highly-conserved paternally-imprinted insulin-like growth factor 2 (IGF2) gene in human spermatozoa and suggested its role in early embryo development. Although there are 5 different variants of the IGF2, there is no evidence of the variants expressed in human spermatozoa. Objective: The present basic research study was undertaken to characterize the IGF2 transcript variant(s) expressed in human spermatozoa and to develop a sensitive method that can distinguish variants based on quantitative polymerase chain reaction (qPCR). Methods: Two post-gradient sperm samples from healthy, fertile men with proven paternity were used. Granulosa cells (GCs) obtained after the oocyte retrieval procedure and subsequently isolated and purified from follicular fluid were used as controls. Each sample underwent RNA extraction, cDNA synthesis, and PCR. The PCR product was ligated with the pCR4-TOPO vector and used to transform TOPO10 one-shot electro-competent cells of E. coli DH-10α. For each sample, 32 white colonies (true positive clones selected by blue-white screening method) were grown per sample (total in 96). All 96 clones were fully characterized by Sanger sequencing and single nucleotide polymorphism (SNP) were detected. Variations in products from single IGF2 gene primers pair were recorded on Sybr green-based qPCR, such as variations in melting temperatures (Tm), product size, and number of copies. Results: We successfully isolated and identified 96 true positive colonies, which were confirmed as IGF2 cDNA clones. This comprehensive analysis revealed 11 distinct genetic variants within the cDNA clones. Specifically, these variants comprised 6 SNPs and 5 deletions, highlighting the diversity in the sequences. These findings were particularly significant in relation to the IGF2 primer employed in the study, as they indicated the presence of 11 different sequence variants. By Sybr green qPCR, clones derived from GCs and sperm samples predominantly showed an IGF2 transcript variant with Tms of 89.01°C, 88.86°C, and 88.71°C. In a surprising observation, the sperm samples exhibited three sperm-specific variants with a range of a Tm ranging from 89.01°C to 88.26°C. Furthermore, the deletions were characterized by a significantly lower Tm, ranging between 78.86°C and 71.11°C. Conclusion: The IGF2 transcript is intrinsically present in sperm samples, albeit with notable variations. The detected variants likely arise from SNPs within the transcripts and the deletions could be attributed to splicing activity during maturation or post-transcriptional modifications. To our knowledge, this is the first study targeting the IGF2 transcript variants in spermatozoa from fertile men. Basic research is needed to understand the implications of different sperm-specific IGF2 transcript variants on early embryo development. Presentation: 6/2/2024

Immunogenic Detection of IL-6 in Male Patients Suffering from Infertility Disorders

Background; Infertility in men is one of the health and psychological problems around the world that is widespread and related to many physiological and medical causes. Many hormonal differences or viral or bacterial infections in general can lead to infertility in men. Aims of the study; The effect of interleukin 6 and its role in the development of male infertility. Methodology; This study was conducted on patients at Al-Sadr Medical City / Infertility Center / Al-Najaf Al-Ashraf and Dr. Ali Al-Ibrahimi's private center for embryology and infertility. Since October 2023, the control group (fertile men) included 40 healthy 25–45-year-old men. There were 60 infertile men aged 22-46 in the study. An enzyme-linked immunosorbent assay measured interleukin-6. DNA extraction was followed by PCR analysis of the interleukin 6 gene polymorphism. Result; The results showed that there was no statistical significance in age between the two groups. The results also showed an increase in interleukin 6 levels in general and by age groups in the patient group compared to the control group. In addition there is a statistical significance in the polymorphism gene tests between the two groups. Conclusions; The case group had higher interleukin 6 levels, and the gene polymorphism was significant. This suggests that inflammatory factors like viral or bacterial infections or autoimmunity caused the difference in interleukin 6 levels and the mutation in IL-6 gene could play a role in this increase.

Study of the role of polymorphic variants G919A and A2039G of the follicle stimulating hormone receptor gene FSHR in the genesis of male infertility

Aim. To determine the distribution of genotypes of polymorphic variants G919A and A2039G of the gene FSHR (follicle-stimulating hormone receptor) among men with azoospermia. Methods. DNA from peripheral blood leukocytes was isolated and purification using a modified salting out method. Extracted DNA was amplified by Polymerase chain reaction (PCR). The PCR products were subsequently digested with the restriction enzyme for identify polymorphic variants of the follicle-stimulating hormone receptor gene FSHR. Electrophoresis of PCR products was performed in a 2 % agarose gel. Results. Given that idiopathic infertility is overwhelmingly caused by genetic factors, it seemed necessary to conduct a set of cytological and molecular genetic studies in a group of men with azoospermia. The genetic component was verified in 28 men with azoospermia, which is 40 % of all subjects. Molecular genetic studies were performed and the distribution of genotypes of polymorphic variants A919G and A2039G of the FSHR gene among men with azoospermia was determined. Conclusions. A slightly higher frequency of homozygous genotypes GG of polymorphic variants A919G and A2039G of the follicle stimulating hormone receptor gene FSHR was found among men with azoospermia compared to the group of fertile men.

Whole exome sequencing analysis of 167 men with primary infertility

BackgroundSpermatogenic failure is one of the leading causes of male infertility and its genetic etiology has not yet been fully understood.MethodsThe study screened a cohort of patients (n = 167) with primary male infertility in contrast to 210 normally fertile men using whole exome sequencing (WES). The expression analysis of the candidate genes based on public single cell sequencing data was performed using the R language Seurat package.ResultsNo pathogenic copy number variations (CNVs) related to male infertility were identified using the the GATK-gCNV tool. Accordingly, variants of 17 known causative (five X-linked and twelve autosomal) genes, including ACTRT1, ADAD2, AR, BCORL1, CFAP47, CFAP54, DNAH17, DNAH6, DNAH7, DNAH8, DNAH9, FSIP2, MSH4, SLC9C1, TDRD9, TTC21A, and WNK3, were identified in 23 patients. Variants of 12 candidate (seven X-linked and five autosomal) genes were identified, among which CHTF18, DDB1, DNAH12, FANCB, GALNT3, OPHN1, SCML2, UPF3A, and ZMYM3 had altered fertility and semen characteristics in previously described knockout mouse models, whereas MAGEC1,RBMXL3, and ZNF185 were recurrently detected in patients with male factor infertility. The human testis single cell-sequencing database reveals that CHTF18, DDB1 and MAGEC1 are preferentially expressed in spermatogonial stem cells. DNAH12 and GALNT3 are found primarily in spermatocytes and early spermatids. UPF3A is present at a high level throughout spermatogenesis except in elongating spermatids. The testicular expression profiles of these candidate genes underlie their potential roles in spermatogenesis and the pathogenesis of male infertility.ConclusionWES is an effective tool in the genetic diagnosis of primary male infertility. Our findings provide useful information on precise treatment, genetic counseling, and birth defect prevention for male factor infertility.

Human sperm RNA in male infertility.

The function and value of specific sperm RNAs in apparently idiopathic male infertility are currently poorly understood. Whether differences exist in the sperm RNA profile between patients with infertility and fertile men needs clarification. Similarly, the utility of sperm RNAs in predicting successful sperm retrieval and assisted reproductive technique (ART) outcome is unknown. Patients with infertility and fertile individuals seem to have differences in the expression of non-coding RNAs that regulate genes controlling spermatogenesis. Several RNAs seem to influence embryo quality and development. Also, RNA types seem to predict successful sperm retrieval in patients with azoospermia. These findings suggest that sperm RNAs could influence decision-making during the management of patients with infertility. This evidence might help to identify possible therapeutic approaches aimed at modulating the expression of dysregulated genes in patients with infertility. Performing prospective studies with large sample sizes is necessary to investigate cost-effective panels consisting of proven molecular targets to ensure that this evidence can be translated to clinical practice.

Expression of exosomal microRNAs miR-34a and miR-210 in male infertility: relationship with morphokinetic parameters and sperm DNA fragmentation

Introduction. Infertility affects tens of millions of men and women across the globe. In approximately half of cases, male factors are the cause of infertility. In recent decades, there has been a significant decline in the quality of male ejaculate, which is characterized by reduced sperm concentration and motility. The insufficient diagnostic and prognostic value of routine semen analysis results highlights the challenge of developing effective diagnostic tools and searching for reliable biomarkers of male infertility. One of the most promising approaches may be assessing sperm microRNA expression.Objective. To study the role of sperm exosomal microRNAs miR-34a and miR-210 in the development of male infertility.Materials & methods. The retrospective study included 150 men aged 25 – 49 years; of these, 96 patients were diagnosed with idiopathic infertility. The comparison group consisted of 54 fertile men. To assess the structure and motility of sperm, the results of a standard ejaculate study (WHO, 2021) and computer data analysis using MMC Sperm (MMCSoft, St. Petersburg, Russia) software were used. The degree of DNA fragmentation was assessed using the TUNEL method. To analyze the expression of miR-34a and miR-210, quantitative real-time PCR was performed using the miRCURY LNA SYBR Green PCR Kit («Qiagen» GmbH, Hilden, Germany) and the Rotor-Gene Q PCR product detection system («Qiagen» GmbH, Hilden, Germany).Results. The study of ejaculate using the Computer Assisted Sperm Analysis System (CASA) method revealed a statistically significant relationship between the level of DNA fragmentation of sperm and indicators of the speed of their movement: rectilinear (VSL) (r = -0.522726; p < 0.01), curvilinear (VCL) (r = -0.499096; p < 0.01), along the middle path (VAP) (r = -0.429533; p < 0.01), as well as with the amplitude of lateral head displacement (ALH) (r = -0.294779, p < 0.01), the linearity of their curvilinear path (LIN) (r = -0.385796; p < 0.01), the degree of straight-line movements (STR) (r = -0.268248; p < 0.05) and their progressive mobility (r = -0.411547; p < 0.01). A study of the level of microRNA expression in sperm exosomes revealed a statistically significant decrease in its miRNA-34a pool (p = 0.0116). According to the Chaddock scale, the strength of the correlation between miR-210 expression and the effectiveness of ART programs was moderate (0.437993). The inverse relationship between miR-34a expression and IVF and ICSI results was weak (0.135314).Conclusion. The analysis of exosomal microRNA-34a and microRNA-210, which are involved in the regulation of spermatogenesis, reveals a direct correlation between their variations and changes in the kinetic and morphological parameters of gametes. It also indicates a relationship with the state of DNA fragmentation. These findings suggest varying levels of gene expression among infertile patients, men with proven fertility, and those undergoing assisted reproductive technology (ART) treatments, both with successful and repeated unsuccessful outcomes.

Evaluation of Known Markers of Ferroptosis in Semen of Patients with Different Reproductive Pathologies and Fertile Men.

This study aims to investigate the role of ferroptosis, an iron-dependent form of regulated cell death, in male infertility. The motivation behind this research stems from the increasing recognition of oxidative stress and iron metabolism dysregulation as critical factors in male reproductive health. In this study, 28 infertile patients (grouped by the presence of urogenital infections or varicocele) and 19 fertile men were selected. Spermiograms were performed by light microscopy (WHO, 2021). Testosterone, ferritin, transferrin-bound iron, transferrin, and F2-isoprostanes (F2-IsoPs) were detected in seminal plasma. Glutathione peroxidase 4 (GPX4) and acyl coenzyme A synthetase long chain family member 4 (ACSL4) were also assessed in sperm cells using enzyme-linked immunosorbent assays (ELISA). All the variables were correlated (statistically significant Spearman's rank correlations) in the whole population, and then the comparison between variables of the different groups of men were carried out. Seminal ferritin and transferrin positively correlated with seminal F2-IsoPs, which had positive correlations with ACSL4 detected in sperm cells. Ferritin and ACSL4 negatively correlated with the seminal parameters. No correlation was detected for GPX4. Comparing the variables in the three examined groups, elevated levels of ACSL4 were observed in infertile patients with urogenital infections and varicocele; GPX4 levels were similar in the three groups. These results suggested a mechanism of ferroptosis, identified by increased ACSL4 levels and the occurrence of lipid peroxidation. Such events appear to be GPX4-independent in reproductive pathologies such as varicocele and urogenital infections.

A Study of Sperm DNA Damage Mechanism Based on miRNA Sequencing.

To analyze the differential expression profiles of microRNAs (miRNAs) in spermatozoa of patients with sperm DNA damage and to investigate the role of miRNAs in sperm DNA damage. Male infertility patients with sperm DNA damage who attended the First Affiliated Hospital of Henan University of Chinese Medicine from October 2023 to December 2023 were selected and included in this study as a case group. Fertile healthy men who were seen at the health check-up center during the same period and diagnosed by examination were also included as a control group. Sperm miRNA expression was detected in patients with sperm DNA damage (case group, n = 5) and healthy medical check-ups (control group, n = 5) using high-throughput sequencing technology. The differentially expressed miRNAs between the two groups were bioinformatically analyzed to explore the main biological functions of the target genes. We found that 63 miRNAs were significantly changed in the spermatozoa of patients with sperm DNA damage,|log2 (foldchange)| ≥ 1, p < .05. Gene Ontology (GO) enrichment analysis indicated that these differential miRNAs might be involved in developmental process, anatomical structure development, cellular macromolecule metabolic process, multicellular organism development, system development, and so on. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis showed that that they mainly affect the PI3K-AKT signaling pathway. The present study suggests that the altered expression of miR-1255a, miR-921, and miR-3156-5p may play an important role in the sperm DNA damage process, and the mechanism may involve the phosphatidylinositol-3'-kinase-AKT (PI3K-AKT) signaling pathway.

DNA methylation changes in the genome of patients with hypogonadotropic hypogonadism

Although some Mendelian neurodevelopmental disorders have been shown to entail specific DNA methylation changes designated as epi-signatures, it remains unknown whether epi-signatures are consistent features of other genetic disorders. Here, we analyzed DNA methylation profiles of patients with hypogonadotropic hypogonadism (HH), a rare neuroendocrine disorder typically caused by monogenic or oligogenic mutations. First, we performed microarray-based genome-wide methylation analyses of nine patients with HH due to ANOS1, SOX2, or SOX10 variants and 12 control individuals. The results showed that 1118 probes were differentially methylated in one or more patients. The differentially methylated probes were highly variable among patients. No significant methylation changes were observed in genes functionally associated with ANOS1, SOX2, or SOX10. Then, we performed pyrosequencing of six selected CpG sites in the nine patients and 35 additional HH patients. The results of the patients were compared with those of 48 fertile men. There were no common methylation changes among these patients, with the exception of hypermethylation of two CpG sites in the ZNF245 promoter of three patients. Hypermethylation of the promoter has previously been reported as a very rare epigenetic polymorphism in the general population. These results indicate that genomes of HH patients have considerable DNA methylation changes; however, these changes are more likely to be physiological epigenetic variations than disease-specific epi-signatures. Our data suggest a possible association between hypermethylation of the ZNF254 promoter and HH, which needs to be examined in future studies.

Seminal plasma TEX101 protein as a spermatogenesis biomarker in male infertility.

Male infertility may be results from reduced sperm production, or oligozoospermia and azoospermia. Testis-expressed 101 (TEX101) is a glycoprotein that is associated with male fertility, and the disruption of TEX101 results in abnormal semen parameters and sperm function. A case-control study was done to measure seminal plasma TEX101 in 184 volunteers by enzyme-linked immunosorbent assay (ELISA). Significant differences in the mean of TEX101 values were estimated between fertile men (9.64 ng/ml, N= 40), normozoospermic infertile men (8.57 ng/ml, N= 28), and infertile men with oligospermia (5.35 ng/ml, N= 76), and azoospermia (3.19 ng/ml, N= 40). Significant differences between the mean of TEX101 values were estimated in azoospermic infertile men according to the presence of spermatids as no-spermatid (0.66 ng/ml, N=12), few spermatids (3.05 ng/ml, N=16), and moderate spermatids (5.88 ng/ml, N=12). In addition, a significant correlation in oligozoospermia infertile men was found between TEX101 with seminogram. Clinical assay for TEX101 has the potential to diagnose male infertility. And as a biomarker for the seminal fluid quality and as a differential diagnosis of non-obstructive azoospermia.

Novel combination with maca improves sperm parameters in vitro of asthenozoospermic men.

Infertility is an inability to conceive after a reasonable period of time (12 months) without the use of contraception or due to a person's incapacity to procreate, whether independently or with a spouse. Problems with the production and maturation of sperm are the most common causes of male infertility additionally; the motility is the major functional character that determines the fertilizing ability of spermatozoa. Therefore the goal of this study is to get better certain sperm function parameters in vitro of asthenozoospermic patient. The World Health Organization (WHO) and many studies considered the infertility as a disease and so many couples complaining from unsuccessful assisted reproductive technologies (ART) procedures to overcome their problem. The goal of this study is to improve certain sperm function feature in vitro of asthenozoospermic semen patients by using combination of motility inducing namely; Maca, L-carnitine and Pentoxifylline that enhance the medium to improve certain sperm characters that might be utilized for ART centers. Semen aliquots were collected from ninety patients with asthenozoospermia who participated in present study, the volume of semen samples with normal ejaculate when was ranged between 1.4-6ml and can be measured by using a measure pipette or conical graduated tube; Inclusion criteria was Asthenozoospermia, oligozoospermia and teratozoospermia men, Infertile idiopathic men also, fertile normozoospermic men. While Exclusion criteria was Azoospermic men, Alcoholic, Patients under treatment with antibiotics and men with Varicocele.The samples split into two equal groups at random. Using Ham's F12 medium, one portion served as the control group, and the other was the treatment group, which was mixing by combining the following ingredients, Maca powder extracts (Lepidium meyenii) (M) 1 mg/ml, 0.5 mg/ml of L-Carnitine (LC), and 10 mg/ml of Pentoxifylline (PTX). The data were analyzed using Statistical Package for Social Sciences (SPSS) version 23.0. The descriptive statistics including frequency, range, mean and standard error, Data from treated and control groups were expressed as mean ± SEM and to compare value between experimental and control groups using Students t-test. Layering approach is used to investigate sperm parameters before and after in vitro activation. The information showed a very large (p< 0.001) increase in active sperm motility grade A, percentage of progressive motility with significant increase in morphologically normal sperm (MNS) with decreased in DNA fragmentation index after activation by layering technique with novel combination medium compared to Hams F12 medium and before activation. The present work stated that novel combination medium (LC, maca and PXT) have potential effects to improve sperm characters in male infertility factors and suggested to be used for sperm preparation and activation in ART programs.

Non-Obstructive Azoospermia and Intracytoplasmic Sperm Injection: Unveiling the Chances of Success and Possible Consequences for Offspring.

Non-obstructive azoospermia (NOA) is found in up to 15% of infertile men. While several causes for NOA have been identified, the exact etiology remains unknown in many patients. Advances in assisted reproductive technology, including intracytoplasmic sperm injection (ICSI) and testicular sperm retrieval, have provided hope for these patients. This review summarizes the chances of success with ICSI for NOA patients and examines preoperative factors and laboratory techniques associated with positive outcomes. Furthermore, we reviewed possible consequences for offspring by the use of ICSI with testicular sperm retrieved from NOA patients and the interventions that could potentially mitigate risks. Testicular sperm retrieved from NOA patients may exhibit increased chromosomal abnormalities, and although lower fertilization and pregnancy rates are reported in NOA patients compared to other forms of infertility, the available evidence does not suggest a significant increase in miscarriage rate, congenital malformation, or developmental delay in their offspring compared to the offspring of patients with less severe forms of infertility or the offspring of fertile men. However, due to limited data, NOA patients should receive specialized reproductive care and personalized management. Counseling of NOA patients is essential before initiating any fertility enhancement treatment not only to mitigate health risks associated with NOA but also to enhance the chances of successful outcomes and minimize possible risks to the offspring.

The association of sperm BAX and BCL-2 gene expression with reproductive outcome in Oligoasthenoteratozoospermia cases undergoing intracytoplasmic sperm injection: A case-control study.

The B-cell lymphoma 2 (BCL-2) protein is one of the members of the BCL-2 associated X (BAX) protein family that acts as an inducer of apoptosis. The present study aims to investigate the association between BAX and BCL-2 gene expression with reproductive outcome, in cases undergoing intracytoplasmic sperm injection. In this case-control study, 50 men were divided into healthy fertile and oligoasthenoteratozoospermic infertile men (n = 25/each). They were subjected to history taking, clinical examination, and semen analysis. Expression of BAX and BCL-2 genes were measured using real-time polymerase chain reaction. The DNA fragmentation index was measured using the sperm chromatin dispersion assay technique. Using World Health Organization criteria, sperm parameters were evaluated. Evaluation of apoptosis-related genes showed that oligoasthenoteratozoospermic significantly increased mRNA expression of BAX, and significantly decreased mRNA expression of BCL-2, when compared with control. Moreover, the BAX/BCL-2 ratio was significantly higher in oligoasthenoteratozoospermic compared to the normozoospermic group (p = 0.01). Also, this study showed that the BAX and BCL-2 genes expression had a significant correlation with sperm quality, and DNA fragmentation in the oligoasthenoteratozoospermic group (p = 0.01). The oligoasthenoteratozoospermic men, had a considerably lower proportion of fertilization rate and good-quality embryos at the cleavage stage than the normozoospermic subjects (p = 0.01). A significant correlation was observed between the expression of BAX and BCL-2 genes, fertilization, and embryo quality (p = 0.01). We concluded that the sperm BAX/BCL-2 ratio demonstrates a significant correlation with fertilization rate and embryo quality.

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.

Sperm Quality in 1252 Adolescents and Young Adults (AYAs) Undergoing Fertility Preservation Due to Cancer or Nonmalignant Diseases.

Purpose: To investigate the quality of emergency-collected semen samples aimed at sperm cryopreservation provided by adolescents and young adults (AYAs) presenting with cancer or nonmalignant diseases. Methods: This is a prospective cohort study of postpubertal males referred for sperm cryopreservation who provided at least one semen sample for fertility preservation at the Reproductive Medicine Clinic of Karolinska University Hospital, Stockholm, Sweden, between January 2009 and January 2020. Sperm quality was assessed by total sperm count, concentration, and motility. Sperm quality by disease groups was compared with the reference population data of fertile men defined by the World Health Organization (WHO). Results: Among the 1252 patients who provided samples for cryopreservation, 1063 had cancer and 189 had nonmalignant diseases. The most common malignant indications included testicular cancers (n = 501) and Hodgkin lymphoma (n = 102). Among those with nonmalignant disease, 35% (n = 66) had testicular disease. Sperm quality was significantly lower in all groups of patients with cancer compared with the reference population. In total, azoospermia was found in 8% of the patients with cancer, in 9% of those with nonmalignant testicular disease, and in 3% of the remaining men with nonmalignant disease. Conclusion: Sperm quality in adult patients with cancer was significantly impaired compared with the WHO reference population standards for fertile men. For adolescent patients, standard reference values are lacking. AYAs wishing to preserve fertility should receive individualized counseling regarding sperm quality at the time of cryopreservation, and in selected cases, banking of additional samples should be recommended depending on the sperm quality parameters.

Contraceptive efficacy: Determining the threshold for effective suppression based on sperm concentration, motility, and morphology.

Human spermatogenesis is a complex process that transforms spermatogonial stem cells through mitosis and meiosis to spermatozoa. Testosterone is the key regulator of the terminal stages of meiosis, adherence of spermatids to Sertoli cells, and spermiation. Follicle-stimulating hormone (FSH) may be required for early spermatogenesis and is important for maintaining normal spermatogenesis in men. Hormonal contraception suppresses FSH, luteinizing hormone, and intratesticular testosterone concentration, resulting in marked suppression of sperm output. Clinical trials using testosterone alone or testosterone plus progestin demonstrate that sustained suppression of sperm concentration to ≤1 million/mL is sufficient to prevent pregnancy in the female partner. New agents that target spermatogenesis could use this as a target for contraceptive efficacy while others that block sperm function or transport may require a lower threshold. When sperm concentrations are suppressed to such low levels, measurement of sperm motility and morphology is technically difficult and unnecessary. With current data from fertile and infertile men, it is not possible to establish a lower limit of sperm motility or percent normal morphology that equates to the prevention of conception. New compounds that decrease sperm motility or alter sperm morphology may need to demonstrate a complete absence of sperm motility or altered morphology in all spermatozoa in the ejaculate. Sperm function tests may be useful depending on the mechanism of action of each new compound. Monitoring of sperm surrogate markers to ensure effective contraception relies on laboratories experienced in semen analyses. The development of at-home tests to assess sperm parameters has progressed rapidly. Some tests have been assessed in clinical trials and approved by regulatory agencies for at-home use for fertility assessment. However, caution must be exercised in using these tests as many have not been rigorously validated against semen parameters measured in laboratories by trained technologists using standardized tests defined in the World Health Organization Semen Manual.

O-016 To be or not to be capacitated after sperm preparation: tyrosine phosphorylation as predictive indicator for capacitation status and male fertility potential

Abstract Study question Can post-capacitation tyrosine phosphorylation (TP) levels distinguish “capacitated” from “non-capacitated” molecular profiles, and are these similarly distributed among infertile and fertile men? Summary answer TP levels after 3 hours of incubation post-capacitation robustly predicted “capacitated” and “non-capacitated” molecular profiles, with the latter being more common in the infertile group. What is known already TP is considered one of the most relevant intracellular signalling events in the capacitation process and in the regulation of sperm function. Despite the recognized general trend of increased TP post-capacitation, interindividual variability can be observed, with some samples showing phosphorylation levels like those before capacitation. Currently, no test is conducted on capacitated samples to verify whether they have indeed acquired a molecular pattern consistent with capacitation. Therefore, the objective of this study was to evaluate the predictive ability of post-capacitation TP levels measured at various time points in distinguishing molecularly “capacitated” patterns from “non-capacitated” ones. Study design, size, duration Prospective experimental study conducted from June 2021 to September 2023 with the aim of assessing TP levels in different populations before (B-cap) and after (A-cap) in vitro capacitation and after different incubation times (1h and 3h) under capacitating conditions. A total of 335 samples, including infertile patients (n = 111), tests for the inclusion in the sperm donation program (n = 57) and sperm donors (n = 167) were included. Participants/materials, setting, methods Semen samples were examined following WHO guidelines and in vitro capacitation was performed using density gradient centrifugation. Flow cytometry was used to assess global TP (%) (B-cap, A-cap, 1h and 3h). Receiver operating characteristic (ROC) curve analyses were performed to evaluate the discriminatory potential of post-capacitation TP levels (A-cap, 1h and 3h) against B-cap, aiming to distinguish between “capacitated” and “non-capacitated” molecular profiles. Chi-square test was used to compare proportions. P &amp;lt; 0.05 was considered statistically significant. Main results and the role of chance The dataset was randomly split into two subsets, one for model development and the other for subsequent performance evaluation. The areas under the curve (AUC) for A-cap, 1h and 3h were 73.8% (95% CI = 69.3%-78.3%), 84.5% (81.0%-88.0%), and 92.7% (90.4%-95.0%), respectively. Sensitivity and specificity values were calculated for the curve with the highest AUC, constructed with TP values from non-capacitated (B-cap) and 3-hours incubated (3h) samples. The selected cut-off point was 4.35% (sensitivity: 85.0%, specificity: 85.7%). The model exhibited robust overall performance in identifying molecularly “capacitated” and “non-capacitated” samples, with a sensitivity, specificity, false positive rate and false negative rate of 85.2%, 89.7%, 9.4% and 12.9%, respectively. Accuracy, positive predictive value and negative predictive value were 87.3%, 90.2%, and 84.5%, respectively. In infertile patients, using TP values at the third hour of incubation and the selected cut-off, the model identified 73.9% (82/111) of samples as molecularly “capacitated” and 26.1% (29/111) as “non-capacitated,” despite laboratory capacitation. In contrast, in the control group, the model identified 93.4% (156/167) of samples as “capacitated” and 6.6% (11/167) as “non-capacitated”. A significantly higher number of seminal samples were identified as “non-capacitated” in the infertile patient group compared to the proven fertile donor group (p &amp;lt; 0.001). Limitations, reasons for caution The model's performance demonstrates its utility and reliability in identifying samples with a molecular “non-capacitated” profile, even after in vitro capacitation. However, further refinement is possible by incorporating additional data. External validation is essential to confirm generalizability of the results. Wider implications of the findings The assumption that a molecular capacitation profile is acquired following in vitro sperm processing may be questioned. Our results suggest a potential link between the selected threshold and fertility, offering insights into male infertility aetiology and paving the way for personalized intervention strategies. Trial registration number NCT04962100

P-085 Transcriptomic and proteomic characterization of unexplained male infertility: alterations in energy metabolism

Abstract Study question Which are the transcriptomic and proteomic profiles of spermatozoa belonging to patients with Unexplained Male Infertility (UMI)? Summary answer Transcriptomic and proteomic profiles of UMI patients differ from the fertile men, having the energy metabolism altered. What is known already About 30% of infertile couples suffer from “Unexplained Infertility” (UI). Considering that the male factor contributes to 50% of infertility cases, it is estimated that half of all couple UI cases are due to unexplained male infertility (UMI). Men are diagnosed with UMI when despite having “normal” seminal parameters they are unable to conceive. Due to the lack of UMI classification criteria and the seminogram-only-based infertility diagnosis, little is known about the mechanisms underlying UMI. Study design, size, duration 80 normozoospermic human semen samples with proven fertility and 80 samples from patients with UMI were used for this study. Ejaculates were obtained from Clínica Quirón Bilbao between 2012 and 2018, and after capacitation they were pooled to perform protein and RNA extractions. Participants/materials, setting, methods For transcriptomic analysis, libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v3. Sequencing was performed on NextSeq 2000 system (1x 50 bp, 50 cycles, P3 kit) at Centre de Regulació Genómica (CRG). For the proteomic analysis, Tandem MassTag (TMT) 6-plex isotopic labeling strategy was adopted, and generated peptides were run in a Q Exactive mass spectrometer. To find differentially expressed genes and proteins between both groups EdgeR and Perseus softwares were employed. Main results and the role of chance In the present study, a total of 156.124 transcripts and 1722 proteins were identified in human sperm. Principal Component Analysis (PCA) confirmed the existence of distinguishable differences in the transcriptomic and proteomic profile of control and UMI samples. Specifically, 3112 differentially expressed transcripts and 385 differentially expressed proteins were identified. Among the differentially expressed proteins, 49 were correlated with RNA expression. Coherent RNA-protein signatures were mainly related to axonemal dynein complex assembly and flagellated sperm motility. Proteins involved in energy metabolism were enriched in UMI protein signatures but were not well correlated with the RNA. Furthermore, genes involved in protein transport and chromosome condensation were highly enriched in UMI group but were not detected by proteomics profiling. According to our results, there is a lack of RNA-protein correlation at human sperm. However, differential transcriptomic and proteomic profiles were found when comparing fertile normozoospermic samples to UMI samples. Concretely, our results suggest that altered energy metabolism may be one of the key factors in patients leading with UMI. Thus, the study of human sperm metabolism may be essential to find new targets of male infertility. Limitations, reasons for caution The lack of a consensus on the classification criteria of UMI makes this group of patients very heterogeneous. Further studies are needed to identify and validate specific transcripts and/or proteins that may alter specific metabolic processes and cause infertility. Wider implications of the findings The study of human sperm metabolism may be essential to understand the causes of many UMI cases. In this context, the identification of key protein or transcripts could be very helpful to predict the success of the assisted reproductive treatments. Trial registration number Not applicable

P-606 Maintenance of telomere length through autophagy and androgen receptor inhibition in infertile individuals with differences of sex development (DSD)

Abstract Study question What are the molecular mechanisms underlying genome instability concomitant with increased telomere length (TL) in individuals with DSD? Summary answer Low autophagy activity and androgen receptor signaling stabilize GAR1, a telomerase-specific protein, leading to an increase in TL in DSD cells. What is known already Increased genome instability is linked to infertility, and compromised telomere maintenance is associated with genome instability. Individuals with DSD, characterized by dysgenic gonads and a high risk of Germ Cell Tumor (GCT) development, exhibit concurrent genome instability, increased TL, and deregulated Androgen Receptor (AR) signaling. Telomeric DNA damage promotes autophagy, which induces cell death and prevents propagation of replication crisis and tumorigenesis. We previously demonstrated that inhibition of autophagy, a conservative process of protein degradation, led to TL increase in cell lines derived from individuals with DSD, but the underlying mechanisms remain unclear. Study design, size, duration 112 individuals with DSD, including Swyer syndrome (46,XY females), Complete Androgen Insensitivity Syndrome (CAIS 46,XY females), Turner (45,X0 females), and Mixed Gonadal Dysgenesis (MGD 45,X0/46,XY females and males) were enrolled into study during routine praxis in our clinic. The samples were collected with written patients consent. A control group included fertile women and men, when appropriate, of comparable age. Samples underwent standard genetic and histological characterization. Lymphoblastoid cell lines were used for functional studies. Participants/materials, setting, methods Study groups comprised individuals with CAIS (n = 19); Swyer (n = 8); MGD (n = 12); Turner (n = 23) with mosaic (n = 12), with chr. X/Y deletions (n = 8), with X-isochr./idiocentric/marker chr. (n = 23) syndromes. Blood samples were collected for DNA, RNA and protein isolation from leukocytes. Additionally, individuals with DSD who underwent gonadectomy formed an additional group with histologically proven GCT (DSD-GCT, n = 7). Gonadal tissue was provided by the tissue bank. Samples were analyzed using quantitative real-time PCR (qRT-PCR), immunoblotting, and mass spectrometry. Main results and the role of chance Leukocytes from Swyer (p = 0,0069), Turner (p = 0,0064), and MGD without GCT (p = 0,05) groups exhibited a 1,5-folds increase in TL, diminished with GCT (p = 0,003). The RNA component of telomerase, TERC, was inhibited two times in Swyer (p = 0,0417). Proteomic analysis identified a telomerase protein GAR1 accumulation in Swyer, but downregulated in GCT group together with AR upregulation (p = 0,0379). Immunoblotting confirmed a two-fold increase of GAR1 in Swyer (p = 0,0022) and Turner (p = 0,0401), while GAR1 decreased in all DSD samples (p = 0,0455). GAR1 protein increased stability, not due to upregulated transcription, and promoted TL since we illustrated GAR1 accumulation within 72h of BafilomycinA1 treatment inhibiting autophagy. This treatment induced telomerase activity within 24h. Further autophagy inhibition caused accumulation of DNA damage in DSD cells, measured by γH2AX levels labeling double strand brakes (p = 0,0286). Dysgenic gonadal tissue analysis also showed a negative correlation between autophagy and TL-specific gene expression, with LC3 (p = 0,0341) and P62 (p = 0,0342) increased in all DSD samples, and proteins LC3 (p = 0,0298) and P62 (p = 0,0237) upregulated, and GAR1 (p = 0,0432) inhibited exclusively in Swyer group. Inhibition of AR increased TL (p = 0,0357) together with GAR1 (p = 0,0125) in DSD group at 19h, which was associated with a consecutive γH2AX upregulation (p = 0,0489) at 24h with Enzalutamide. Limitations, reasons for caution This study is based on a limited number of samples from the individuals with rare genetic syndromes, some observed only in 1 out of 10,000 clinical cases. Therefore, in vitro study models are recommended for further research. Wider implications of the findings The study reveals gene expression patterns and molecular regulatory mechanisms associated with DSD and GCT risk. The data suggest possibilities for prophylactic treatment of DSD individuals and new diagnostic approaches of GCT using peripheral blood. The study also emphasizes the importance of addressing genome integrity in infertility research. Trial registration number NA

O-098 The transcriptome of endometrial organoids of fertile and subfertile women exposed to seminal plasma of fertile men

Abstract Study question What is the effect of seminal plasma (SP) from fertile males on the transcriptome of endometrial epithelial organoids of fertile and subfertile women? Summary answer Transcriptomic changes in fertile and subfertile endometrial organoids are observed upon treatment with SP, related to hormone- and immune-regulation, reproduction and cellular organisation. What is known already Clinical studies have demonstrated the potential beneficial effect of intrauterine SP (liquid fraction of semen) insemination during assisted reproductive technology (ART), resulting in higher implantation- and pregnancy rates. However, the molecular mechanism by which SP exerts its function remains unclear. SP components such as TGF-β1 or IL-8 have the potential capacity of conditioning the uterus for pregnancy. SP has shown to induce significant transcriptional changes in 2D endometrial epithelial cells. 3D self-organising human endometrial organoids have been established over the last years, mimicking a more in vivo-like physiology, and therefore may better represent the interaction of the endometrium with SP. Study design, size, duration Endometrial tissue biopsies from fertile (n = 5) and subfertile (n = 5; subfertile defined as women not having reached clinical pregnancy after at least 12 months of regular unprotected intercourse) were used to establish endometrial epithelial organoids. Subsequently, SP from fertile males (n = 5) was collected and pooled. Endometrial organoids were cultured in complex media supplemented with 1 µM 17β-estradiol (E2) and incubated with or without (control) 1% SP for 6 h. Participants/materials, setting, methods RNA sequencing was performed using NextSeq600 (Illumina). Significant DEGs upon SP exposure were identified using DESeq2 (Fold Change (FC) of ≥ 1.5 or ≤ -1.5). Eight selected DEGs were validated by qPCR in one cell line. Principal Component Analysis (PCA) was performed to compare endometrium donor correlation. Gene Set Enrichment Analysis (GSEA; v4.3.2) was then used to identify overrepresented pathways and gene ontology (GO) gene sets (P &amp;lt; 0.05; False Discovery Rate (FDR) &amp;lt; 0.25). Main results and the role of chance High heterogeneity between donors was observed, regardless of their fertility phenotype. PCA analysis indicated clustering based on donor rather than SP treatment or phenotype. Moreover, the number of significantly DEGs ranged from 629 to 2332. Treatment with SP resulted in identification of 105 significant DEGs (p &amp;lt; 0.05) among all donors (fertile and subfertile) from which 80 DEGs were upregulated and 25 DEGs were downregulated. Several of these DEGs were also reported to be affected by SP in other 2D epithelial cultures studies. Interesting DEGs include progesterone-associated endometrial protein (PAEP; log2FC 2.0 ± 1.0), interleukin-6 (IL6; log2FC 4.5 ± 1.5), insulin-like growth factor-binding protein 3 (IGFBP3; log2FC 1.1 ± 0.2) and mucin 6 (MUC6; log2FC 3.7 ± 1.6). GSEA analysis identified gene set enrichment of pathways and biological processes related to hormone- and immune regulation, reproduction, and cellular organisation in all endometrial organoids treated with SP. Preliminary RNAseq validation with qPCR showed comparable expression patterns for 8 genes (e.g. PAEP and IL6). Moreover, expression of these genes was uniform when using a distinct SP batch (n = 6; fertile males). No clear differential response between fertile and subfertile organoids upon SP exposure was observed. Limitations, reasons for caution The apical-inside organisation of the organoids (i.e. SP interaction from the basolateral side) should be taken into account, since in vivo interaction will be apically. Moreover, high heterogeneity between donors was observed between and within the fertility phenotypes. Therefore, conclusions based on fertility phenotypes should be drawn with caution. Wider implications of the findings Understanding the effect of SP on the endometrium will shed light on male-female reproductive tract crosstalk, which is omitted during ART. Future research should focus on identifying key regulatory SP molecules and functional studies should include apical SP interaction. Potentially providing therapeutic options for improving success rates in ART. Trial registration number Not applicable