Regulation Of Fatty Acid Metabolism Research Articles

Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

Prolonged AMPK Activation Increases the Expression of Fatty Acid Transporters in Cardiac Myocytes and Perfused Hearts

Recently, fatty acid transport across the plasma membrane has been shown to be a key process that contributes to the regulation of fatty acid metabolism in the heart. Since AMP kinase activation by 5-aminoimidazole-4-carboxamide-1-beta-D: -ribofuranoside (AICAR) stimulates fatty acid oxidation, as well as the expression of selected proteins involved with energy provision, we examined (a) whether AICAR induced the expression of the fatty acid transporters FABPpm and FAT/CD36 in cardiac myocytes and in perfused hearts and (b) the signaling pathway involved. Incubation of cardiac myocytes with AICAR increased the protein expression of the fatty acid transporter FABPpm after 90 min (+27%, P < 0.05) and this protein remained stably overexpressed until 180 min. Similarly, FAT/CD36 protein expression was increased after 60 min (+38%, P < 0.05) and remained overexpressed thereafter. Protein overexpression, which occurred via transcriptional mechanisms, was dependent on the AICAR concentration, with optimal induction occurring at AICAR concentrations 1-5 mM for FABPpm and at 2-8 mM for FAT/CD36. The AICAR (2 h, 2 mM AICAR) effects on FABPpm and FAT/CD36 protein expression were similar in perfused hearts and in cardiac myocytes. AICAR also induced the plasmalemmal content of FAT/CD36 (+49%) and FABPpm (+42%) (P < 0.05). This was accompanied by a marked increase in the rate of palmitate transport (2.5 fold) into giant sarcolemmal vesicles, as well as by increased rates of palmitate oxidation in cardiac myocytes. When the AICAR-induced AMPK phosphorylation was blocked, neither FAT/CD36 nor FABPpm were overexpressed, nor were palmitate uptake and oxidation increased. This study has revealed that AMPK activation stimulates the protein expression of both fatty acid transporters, FAT/CD36 and FABPpm in (a) time- and (b) dose-dependent manner via (c) the AMPK signaling pathway. AICAR also (d) increased the plasmalemmal content of FAT/CD36 and FABPm, thereby (e) increasing the rates of fatty acid transport. Thus, activation of AMPK is a key mechanism regulating the expression as well as the plasmalemmal localization of fatty acid transporters.

A Mediator subunit, MDT-15, integrates regulation of fatty acid metabolism by NHR-49-dependent and -independent pathways inC. elegans

The Caenorhabditis elegans Nuclear Hormone Receptor NHR-49 coordinates expression of fatty acid (FA) metabolic genes during periods of feeding and in response to fasting. Here we report the identification of MDT-15, a subunit of the C. elegans Mediator complex, as an NHR-49-interacting protein and transcriptional coactivator. Knockdown of mdt-15 by RNA interference (RNAi) prevented fasting-induced mRNA accumulation of NHR-49 targets in vivo, and fasting-independent expression of other NHR-49 target genes, including two FA-Delta9-desaturases (fat-5, fat-7). Interestingly, mdt-15 RNAi affected additional FA-metabolism genes (including the third FA-Delta9-desaturase, fat-6) that are regulated independently of NHR-49, suggesting that distinct unidentified regulatory factors also recruit MDT-15 to selectively modulate metabolic gene expression. The deregulation of FA-Delta9-desaturases by knockdown of mdt-15 correlated with dramatically decreased levels of unsaturated FAs and multiple deleterious phenotypes (short life span, sterility, uncoordinated locomotion, and morphological defects). Importantly, dietary addition of specific polyunsaturated FAs partially suppressed these pleiotropic phenotypes. Thus, failure to properly govern FA-Delta9-desaturation contributed to decreased nematode viability. Our findings imply that a single subunit of the Mediator complex, MDT-15, integrates the activities of several distinct regulatory factors to coordinate metabolic and hormonal regulation of FA metabolism.

Glucose-induced repression of PPARα gene expression in pancreatic β-cells involves PP2A activation and AMPK inactivation

Tight regulation of fatty acid metabolism in pancreatic beta-cells is important for beta-cell viability and function. Chronic exposure to elevated concentrations of fatty acid is associated with beta-cell lipotoxicity. Glucose is known to repress fatty acid oxidation and hence to augment the toxicity of fatty acids. The peroxisome proliferator activated receptor alpha (PPARalpha) is a key activator of genes involved in beta-cell fatty acid oxidation, and transcription of the PPARalpha gene has been shown to be repressed by increasing concentrations of glucose in beta-cells. However, the mechanism underlying this transcriptional repression by glucose remains unclear. Here we report that glucose-induced repression of PPARalpha gene expression in INS-1E cells is independent of beta-cell excitation and insulin secretion but requires activation of protein phosphatase 2A in a process involving inactivation of the AMP-activated protein kinase (AMPK). Pharmacological activation of AMPK at high glucose concentrations interferes with glucose repression of PPARalpha and PPARalpha target genes in INS-1E cells as well as in rat islets. Specific knock-down of the catalytic AMPK-subunit AMPKalpha2 but not AMPKalpha1 using RNAi suppressed PPARalpha expression, thereby mimicking the effect of glucose. These results indicate that activation of protein phosphatase 2A and subsequent inactivation of AMPK is necessary for glucose repression of PPARalpha expression in pancreatic beta-cells.

Transcriptional response to alcohol exposure in Drosophila melanogaster

Whole-genome transcriptional analysis following alcohol exposure in flies identifies key enzymes in conserved metabolic pathways that may contribute to human alcohol sensitivity.

Effects of PPAR-α and -γ Agonists on Fatty Acid Metabolism of Muscle Cells in Hyperlipidemic and Hyperglycemic Conditions

Background: Studies for the regulation of fatty acid metabolism are deficient relatively in skeletal muscle and heart. The investigations in pathological conditions for malonyl-CoA decarboxylase (MCD) and for the relation of MCD and PPAR-․-γ agonists are insufficient in particular. Methods: In the current study, fully differentiated H9c2 muscle cells were exposed to pathological conditions such as hyperlipidemic (0.1 mM Palmitate) and hyperglycemic (16.5 mM Glucose) condition with 5 uM PPAR-γ agonist (rosiglitazone) and 10 uM PPAR- agonist (WY14,643) and then experiments such as MCD activity assay, MCD real-time RT-PCR, MCD reporter gene assay, MCD Western blotting, PPAR- Western blotting, and palmitate oxidation test were carried out. Results: Only PPAR- agonist increased MCD activity. In the result of real-time RT-PCR, both PPAR- and PPAR-γ agonists elevated MCD mRNA expression in hyperlipidemic condition. MCD protein expression was decreased in hyperlipidemic condition, however, increased in rosiglitazone, or WY14,643 treated conditions. Rosiglitazone, and WY14,643 treated groups showed incresed MCD protein expression in hyperglycemic condition. Hyperlipidemic control group and PPAR-․ﾇ-γ agonists treated groups presented about 3.8 times more increased palmitate oxidation level than normolipidemic control group in hyperlipidemic condition. PPAR- agonist treated group showed 49% more increased palmitate oxidation rate than hyperlipidemic control group in primary cultured rat skeletal muscle cells. The amount of palmitate oxidation from differentiated H9c2 muscle cells that had overexpressed PPAR- structural genes was more increased than control group. Conclusion: This study suggests that PPAR- agonist ameliorates the defects induced by hyperlipidemic condition through the regulation of MCD. In summary, a closely reciprocal relation among PPAR- agonist, MCD, and fatty acid oxidation existed distinctly in hyperlipidemic condition, but not in hyperglycemic condition.

The use of levo-carnitine in children with renal disease: a review and a call for future studies

Carnitine is an amino acid derivative that has a key role in the regulation of fatty acid metabolism and ATP formation. Carnitine deficiency has been described in various conditions, including chronic kidney disease (CKD) and end stage renal disease (ESRD). The deficiency of this micronutrient is postulated to lead to adverse effects across multiple organ systems. There is a paucity of information on carnitine deficiency and its effects in the pediatric CKD and ESRD populations. Currently, there is no evidence supporting the routine use of carnitine supplementation in children with ESRD. In this article, we review the pathophysiology, pharmacokinetics and the potential effects of levo-carnitine supplementation with a focus on the pediatric CKD and ESRD populations. Finally, potential future directions of research are discussed.

Mutant mice lacking acetyl-CoA carboxylase 1 are embryonically lethal

Acetyl-CoA carboxylases (ACC1 and ACC2) catalyze the carboxylation of acetyl-CoA to form malonyl-CoA, an intermediate metabolite that plays a pivotal role in the regulation of fatty acid metabolism. We previously reported that ACC2 null mice are viable, and that ACC2 plays an important role in the regulation of fatty acid oxidation through the inhibition of carnitine palmitoyltransferase I, a mitochondrial component of the fatty-acyl shuttle system. Herein, we used gene targeting to knock out the ACC1 gene. The heterozygous mutant mice (Acc1(+/-)) had normal fertility and lifespans and maintained a similar body weight to that of their wild-type cohorts. The mRNA level of ACC1 in the tissues of Acc1(+/-) mice was half that of the wild type; however, the protein level of ACC1 and the total malonyl-CoA level were similar. In addition, there was no difference in the acetate incorporation into fatty acids nor in the fatty acid oxidation between the hepatocytes of Acc1(+/-) mice and those of the wild type. In contrast to Acc2(-/-) mice, Acc1(-/-) mice were not detected after mating. Timed pregnancies of heterozygotes revealed that Acc(-/-) embryos are already undeveloped at embryonic day (E)7.5, they die by E8.5, and are completely resorbed at E11.5. Our previous results of the ACC2 knockout mice and current studies of ACC1 knockout mice further confirm our hypotheses that malonyl-CoA exists in two independent pools, and that ACC1 and ACC2 have distinct roles in fatty acid metabolism.

Effect of partial substitution of dietary fish oil by vegetable oils on desaturation and β-oxidation of [1- 14C]18:3 n−3 (LNA) and [1- 14C]20:5 n−3 (EPA) in hepatocytes and enterocytes of European sea bass ( Dicentrarchus labrax L.)

The increasing worldwide aquaculture output and concomitant decrease in the stocks of feed-grade fish used for fish oil production has made fish oil replacement in feeds a priority for the aquaculture industry. The regulation of fatty acid metabolism in fish is important in order to determine strategies for the best use of plant oils in diets for commercially important cultured fish species. We have studied the desaturation/elongation and β-oxidation of 14C-linolenic (LNA) and 14C-eicosapentaenoic (EPA) acids in hepatocytes and pyloric caecal enterocytes in European sea bass fed diets with partial substitution (60%) of fish oil (FO) with vegetable oils (rapeseed, linseed and palm oil) blended in different proportions, for 64 weeks. The rate of desaturation of 14C-LNA was very low in hepatocytes from all treatments and no significant differences were observed among treatments. The rate of desaturation of 14C-LNA in enterocytes was higher than that in hepatocytes but still low (less than 5% of total radioactivity recovered). The desaturation of 14C-EPA in enterocytes was also higher than in hepatocytes, but again was low and no significant differences were found among treatments. The rates of β-oxidation of 14C-LNA and 14C-EPA were much higher than the rates of desaturation in both hepatocytes and enterocytes; however, no significant differences were observed in either hepatocytes or enterocytes among treatments. The rates of β-oxidation of 14C-LNA were considerably higher than those of 14C-EPA in both hepatocytes and enterocytes. In conclusion, European sea bass (a carnivorous marine fish) showed very low desaturation and elongation of LNA to EPA and DHA, and EPA to DHA, higher β-oxidation of LNA than EPA, and all desaturation and oxidation activities were significantly higher in enterocytes than in hepatocytes. A second major conclusion is that no clear quantitative nutritional effects on the desaturation/elongation and β-oxidation activities in either hepatocytes or enterocytes of sea bass were observed upon the inclusion of vegetable oils in the diet.

Differential regulation of hepatic gene expression by starvation versus refeeding following a high-sucrose or high-fat diet

Objectives The objective of this work was to determine the effects of starvation versus refeeding following a high-sucrose diet (HS) or high-fat diet (HF) on fatty acid metabolism in mice. Methods The mice were fed an AIN-76 control diet (CD), a modified HS, or an HF. The three dietary groups were subdivided into three groups each: those fed experimental diets for 12 wk, mice starved for 48 h after 12 wk on an experimental diet, and those with the same starvation treatment but with 72 h of refeeding after starvation, respectively. Results Serum total cholesterol levels of CD and HF groups decreased and then increased under starvation and refeeding states, respectively. Refeeding HS and HF increased serum levels of low-density lipoprotein (LDL) cholesterol compared with refeeding of the CD group. Starvation significantly increased hepatic levels of total cholesterol in the HS and HF groups compared with the CD group. Hepatic acyl coenzyme A (CoA) synthetase (ACS) levels in the CD and HS groups but not the HF group increased and then decreased under starved and refed states, respectively; an opposite regulation was observed in the HF group. Levels of hepatic acetyl-CoA carboxylase (ACC) in the HS and HF groups were significantly increased by refeeding. Hepatic levels of carnitine palmitoyltransferase-I mRNA were significantly enhanced by starvation and refeeding in the HS group but decreased in CD and then increased in the HF group. Conclusions Changes in dietary energy nutrients, fasting, and refeeding affect hepatic ACS, CPT-I, and ACC mRNA expression, and these results will serve to enhance our understanding of the molecular mechanisms underlying regulation of fatty acid metabolism.

Down-regulated expression of PPARα target genes, reduced fatty acid oxidation and altered fatty acid composition in the liver of mice transgenic for hTNFα

The present study investigated the hepatic regulation of fatty acid metabolism in hTNFα transgenic mice. Reduced hepatic mRNA levels and activities of carnitine palmitoyltransferase-II (CPT-II) and mitochondrial HMG-CoA synthase were observed, accompanied by decreased fatty acid oxidation, fatty acyl-CoA oxidase and fatty acid synthase (FAS) activities and down-regulated gene expression of mitochondrial acetyl-CoA carboxylase 2 (ACC2). The mRNA levels of peroxisome proliferator-activated receptor α (PPARα) and PPARδ were reduced. The hepatic fatty acid composition was altered, with increased amounts of saturated and polyunsaturated fatty acids. The relative amounts of Δ 9 desaturated fatty acids were decreased, as was Δ 9desaturase mRNA. The CPT-I mRNA level remained unchanged. The PPARα targeted genes CPT-II and HMG-CoA synthase are potential regulators of mitochondrial fatty acid oxidation and ketogenesis in hTNFα transgenic mice, and the increased propionyl-CoA level found is a possible inhibitor of these processes. Reduced mitochondrial and peroxisomal fatty acid oxidation may explain the increased hepatic triglyceride level induced by TNFα. This is not due to de novo fatty acid synthesis as both FAS activity and gene expression of ACC2 were reduced.

Recombinant human interleukin-6 infusion during low-intensity exercise does not enhance whole body lipolysis or fat oxidation in humans

The present study examined the role of the cytokine IL-6 in the regulation of fatty acid metabolism during exercise in humans. Six well-trained males completed three trials of 120 min of cycle ergometry at 70% peak O(2) consumption (Vo(2 peak); MOD) and 40% Vo(2 peak) with (LOW + IL-6) and without (LOW) infusion of recombinant human (rh)IL-6. The dose of rhIL-6 during LOW + IL-6 elicited IL-6 concentration similar to those during MOD but without altering the circulating hormonal milieu seen in MOD. Palmitate rate of appearance (R(a)), rate of disappearance (R(d)), and oxidation were measured by means of a constant infusion of [U-(13)C]palmitate (0.015 micromol.kg(-1).min(-1), prime NaHCO(3), 1 micromol/kg). Palmitate R(a), R(d), and oxidation were not affected by rhIL-6 infusion, remaining similar to LOW at all times. Palmitate R(a) and oxidation were significantly greater in the MOD trial (P < 0.05) compared with the LOW + IL-6 and LOW trials. Our data show that a low dose of rhIL-6, administered during low-intensity exercise without altering the hormonal milieu, does not alter fatty acid metabolism. These data suggest that the increase in fatty acid utilization seen during exercise at moderate compared with low intensity is not mediated via alterations in plasma IL-6.

Rational proteomics IV: modeling the primary function of the mammalian 17β-hydroxysteroid dehydrogenase type 8

Significant sequence homology has been detected between prokaryotic β-ketoacyl-[acyl carrier protein] reductases (BKR) and eukaryotic 17β-hydroxysteroid dehydrogenases type 8 (17β-HSD_8). Three-dimensional models of ternary complexes of human 17β-HSD_8 with NAD cofactor and two chemically distinct substrates, the BKR substrate {CH3-(CH2) 12-CO-CH 2-CO-S-[ACP]} and the HSD substrate {estradiol} have been constructed (the atomic coordinates are available on request; e-mail: pletnev@hwi.buffalo.edu). The more extensive and specific interactions of 17β-HSD_8 with the BKR substrate compared to interactions with estradiol raise a serious question about the enzyme's primary function in vivo and suggest that it is likely to be involved in the regulation of fatty acid metabolism rather than in the steroid-dependent activity that has been demonstrated in vitro.

Desensitization of cyclic GMP-mediated regulation of fatty acid metabolism in hepatocytes from ethanol-fed rats

The mechanisms by which ethanol causes accumulation of hepatic triacylglycerols are complex. It has been proposed that nitric oxide/cyclic GMP signaling pathway may be involved in regulation of fatty acid metabolism in the liver. Here, we investigated if this mechanism may have a role in adaptation to ethanol consumption. Hepatocytes were isolated from rats fed with an ethanol-containing liquid diet and pair-fed control rats, and incubated with a range of concentrations of 8-bromo-cyclic GMP. In both types of cells, this cyclic GMP analog inhibited in parallel fatty acid synthesis de novo and acetyl-CoA carboxylase activity. Addition of 8-bromo-cyclic GMP also decreased the rate of palmitate esterification to triacylglycerols and phospholipids, whereas palmitate oxidation was increased. However, in all these metabolic effects, hepatocytes from ethanol-fed rats were significantly less sensitive to the addition of 8-bromo-cyclic GMP. In order to know if this may be a more general mechanism of adaptation to ethanol, we also studied the effects on glucose metabolism. Similarly, hepatocytes from ethanol-fed rats showed a decreased sensitivity in the inhibition by 8-bromo-cyclic GMP of glycogen synthesis, fatty acid synthesis and the synthesis of glycerol backbone of hepatic triacylglycerols. These data suggest that ethanol consumption induces a desensitization of the regulatory effects mediated by cyclic GMP in fatty acid metabolism, contributing to triacylglycerol accumulation in the liver.

Age, ration level, and exercise affect the fatty acid profile of chinook salmon ( Oncorhynchus tshawytscha) muscle differently

This study was undertaken to investigate the effect of sustained physical exercise (SS, swimming speed) on the fatty acid profile of muscle in PIT-tagged all-female chinook salmon ( Oncorhynchus tshawytscha) in relation to their age and ration level (RL; i.e., maximum ration, RL100 or 75% of maximum, RL75). Accordingly, body weight (BW), specific growth rate (SGR), and total muscle lipid content (TLC) were considered as covariates in data analyses. In addition, plasma levels of thyroid hormones (thyroxine, T 4 and 3,5,3′-triiodo- l-thyronine, T 3) were compared to the muscle fatty acid (FA) compositions of individual fish to determine if there were any associations between thyroidal status and FA percentages. During the 300-day study, body weight increased from 75 to 440 g. Fish age explained most of the changes found in muscle FA composition [that is, R 2 was 0.23 for saturated fatty acids (SAFAs), 0.65 for monounsaturated fatty acids (MUFAs), and 0.71 for polyunsaturated fatty acids (PUFAs) with p<0.0007 in all cases]. Reduction in RL had less influence on FA composition ( p>0.15 for SAFA, and R 2 was 0.27 for MUFA and 0.34 for PUFA, with p<0.0001 in each of the latter cases). SS only affected MUFA significantly ( p<0.07 with R 2=0.09). The observed effects of fish age and SS on FA composition were to a large degree uninfluenced by BW, SGR, or TLC, while the effects of RL were markedly diminished when these covariates were included in the statistical model. Thus, the changes in body weight and/or lipid content were viewed as being the direct cause for the alteration in muscle FA profile seen with the main factor RL. The effect of SS was pronounced only if fish with a reduced RL were compared. In this situation, the level of PUFA, especially docosahexaenoic acid (DHA; 22:6 n-3), decreased and MUFA increased. Plasma T 4 was unrelated to muscle FA levels, but plasma T 3 was correlated positively with muscle MUFA and negatively with PUFA. We conclude that in order for exercise to affect chinook salmon fillet FA composition, it has to be combined with restricted feeding. The data also imply that in accordance with higher vertebrates, T 3 is also involved in the regulation of FA metabolism in fish.

Requirement of PPARα in maintaining phospholipid and triacylglycerol homeostasis during energy deprivation

The peroxisome proliferator-activated receptor alpha (PPARalpha) has been implicated as a key control of fatty acid catabolism during the cellular fasting. However, little is known regarding changes of individual fatty acids in hepatic triacylglycerol (TG) and phospholipid (PL) as a result of starvation. In the present work, the effects of 72 h fasting on hepatic TG and PL fatty acid profiles in PPARalpha-null (KO) mice and their wild-type (WT) counterparts were investigated. Our results indicated that mice deficient in PPARalpha displayed hepatomegaly and hypoketonemia following 72 h starvation. Histochemical analyses revealed that severe fatty infiltration was observed in the livers of KO mice under fasted conditions. Furthermore, 72 h fasting resulted in a 2.8-fold higher accumulation of hepatic TG in KO mice than in WT mice fasted for the same length of time. Surprisingly, the total hepatic PL contents in fasted KO mice decreased by 45%, but no significant change in hepatic PL content was observed in WT mice following starvation. Gas chromatographic analysis indicated that KO mice were deprived of arachidonic (20:4n-6) and docosahexaenoic (22:6n-3) acids during fasting. Taken together, these results show that PPARalpha plays an important role in regulation of fatty acid metabolism as well as phospholipid homeostasis during energy deprivation.

PPAR-γ receptor agonists-a review of their role in diabetic management in Trinidad and Tobago.

The PPAR-γ receptor agonists, as a relatively new and perhaps still not very widely used class of antidiabetic agent in the Caribbean and particularly the Trinidadian context, possess pharmacologic properties that certainly have been shown to have impact on many of the inflammatory, metabolic, biochemical and structural macrovascular aberrations that occur in the type 2 diabetic. Activation of PPAR(gamma) nuclear receptors regulates the transcription of insulin-responsive genes involved in the control of glucose production, transport, and utilization. PPAR(gamma)-responsive genes also participate in the regulation of fatty acid metabolism, an important contributory pathogenic factor in this subset of patients. The unique mode of action of this class of therapeutic agent addresses a range of anomalies occurring at the cellular and sub-cellular level that are injurious to the diabetic. My aim in addressing the issue of the potential impact of PPAR-γ receptor agonists on cardiovascular disease (CVD) morbidity and mortality in the diabetic, is first, to seek to enhance both an awareness of, and greater familiarity among our own physicians, with this class of drug, and secondly, to effect a timely review of the recent literature as it relates to the tremendous possibilities for the potential clinical gains that might accrue from their use, in so far as this may serve to ameliorate the ravages of the CVD disease that all too tragically attends the type 2 diabetic, and more specifically those with the insulin resistance syndrome. (Mol Cell Biochem 263: 189-210, 2004).

PC22 THE INFLUENCE OF BIRTH WEIGHT ON ADIPOSE TISSUE (AT), SKELETAL MUSCLE (SM) AND LUNG UNCOUPLING PROTEIN (UCP) 2 AND 3 EXPRESSION IN NEONATAL PIGS

Introduction: Epidemiological studies have demonstrated that infants of low birth weight show poor neonatal growth and increased susceptibility to adult diseases such as diabetes and in later life. Pigs provide an ideal model to examine the influence of size at birth due to the natural variance in piglet weight within a litter. UCP 2 and 3 have been implicated in the regulation of fatty acid metabolism, reactive oxygen species production, and UCP2 in protection against bacterial infection. This study examined whether birth weight influences the expression of UCP2 and 3 in fat, muscle and lung and its endocrine regulation in neonatal pigs Methods: Piglets from 11 litters were ranked according to body weight at birth and 3 animals from each were assigned to small (SFD n=11), normal (NFD n=11) or large for dates (LFD n=11) groups. Piglets were euthanased with an overdose of barbiturate (100 mg kg−1 pentobarbital sodium: Euthatal) on days 7 (n=15) and 14 (n=18) to obtain AT, SM and lung. UCP2 and 3 expression in AT, SM and lung were measured using RT-PCR as described previously (Mostyn et al., 2002). GLM analysis was carried out to investigate statistical differences; results are presented as means „b standard errors. Results: The SFD group weighed less than the LFD group throughout the study. LFD piglets had lower lung/kg body weight measurements on d7 (day 7, SFD, 2.2 ± 0.2; NFD, 2.08 ± 0.2; LFD 1.65 ± 0.1 (p<0.05)) but not day 14. In AT UCP2 and 3 expression on day 7 was found to be significantly lower in the SFD group (SFD, 34.4 ± 10.9; NFD, 69.48 ± 12.8; LFD 77.64 ± 9.0 % of reference (p<0.05)) similar trends were observed on day 14, but did not reach significance. UCP3 expression in SM was significantly higher than that of AT, but was similar between groups on both days. UCP2 in lung was higher in the LFD group on days 7 and 14. Conclusion: In conclusion, low birth weight is associated with reduced expression of UCP3 in subcutaneous AT but not SM and an increased expression of UCP2 in the lung. UCP2 and 3 expression is differentially regulated by size at birth. These changes may represent programming of the UCPs which may be detrimental for piglets with a low birth weight. It remains to be established if these differences perpetuate into later life and perform any physiologically important functions.

Altered expression of nuclear hormone receptors and coactivators in mouse heart during the acute-phase response.

Severe sepsis results in the decreased uptake and oxidation of fatty acids in the heart and cardiac failure. Some of the key proteins required for fatty acid uptake and oxidation in the heart have been shown to be downregulated after endotoxin (LPS) administration. The nuclear hormone receptors, peroxisome proliferator-activated receptor (PPAR) and thyroid receptor (TR), which heterodimerize with the retinoid X receptor (RXR), are important regulators of fatty acid metabolism and decrease in the liver after LPS administration. In the present study, we demonstrate that LPS treatment produces a rapid and marked decrease in the mRNA levels of all three RXR isoforms, PPARalpha and PPARdelta, and TRalpha and TRbeta in the heart. Moreover, LPS administration also decreased the expression of the coactivators CREB-binding protein (CBP)/p300, steroid receptor coactivator (SRC)-1, SRC-3, TR-associated protein (TRAP)220, and PPARgamma coactivator (PGC)-1, all of which are required for the transcriptional activity of RXR-PPAR and RXR-TR. In addition, the mRNA levels of the target genes malic enzyme, Spot 14, sarcoplasmic reticulum Ca2+-ATPase, or SERCA2, the VLDL receptor, fatty acyl-CoA synthetase, fatty acid transporter/CD36, carnitine palmitoyltransferase Ibeta, and lipoprotein lipase decrease in the heart after LPS treatment. The decrease in expression of RXRalpha, -beta, and -gamma, PPARalpha and -delta, and TRalpha and -beta, and of the coactivators CBP/p300, SRC-1, SRC-3, TRAP220, and PGC-1 and the genes they regulate, induced by LPS in the heart, could account for the decreased expression of key proteins required for fatty acid oxidation and thereby play an important role in cardiac contractility. These alterations could contribute to the myocardial dysfunction that occurs during sepsis.

Cytochrome P450 eicosanoids regulate fatty acid metabolism via PPARα

Cytochrome P450 (CYP) eicosanoids regulate vascular tone, renal tubular transport, cellular proliferation and inflammation. CYP epoxygenases produce stereo- and regioisomeric epoxyeicosatrienoic acids (EETs) which are hydrated by soluble epoxide hydrolase (sEH) into dihydroxyeicosatrienoic acids (DHETs). CYP epoxygenases and sEH are selectively induced or repressed upon activation of peroxisome proliferator-activated receptor alpha (PPARα) by fatty acids and xenobiotics. We hypothesize that CYP eicosanoids can bind to and activate PPARα, thereby regulating their own levels as well as the levels of PPARα target genes. In transactivation assays, 14,15-DHET was the most potent activator of PPARα. In addition, 14,15-DHET strongly activated PPARγ. EETs also activated PPARα and PPARγ but were half as potent as 14,15-DHET. Gel shift assays showed that EETs and DHETs induced PPARα-specific binding to its response element. The effects of 14,15-DHET on fatty acid metabolism were examined in HepG2 cells by RT-PCR. Expression of acyl-CoA synthetase was increased 3-fold, and carnitine palmitoyltransferase 1A increased 2-fold. In contrast, hydroxy methylglutaryl CoA expression was unaffected. In conclusion, 14,15-DHET has been identified as a potent endogenous activator of PPARα and plays a role in the regulation of fatty acid metabolism in the human liver. Funded by NIH grants HL53994 and GM07175 and a predoctoral fellowship from the PhRMA Foundation. Clinical Pharmacology & Therapeutics (2004) 75, P45–P45; doi: 10.1016/j.clpt.2003.11.169