Family Comoviridae Research Articles

First Report of Black Currant Reversion Virus and Gooseberry Vein Banding Associated Virus in Currants in Bosnia and Herzegovina

Currants (Ribes spp.) are infected by at least 30 viruses (Koloniuk et al. 2018; Teifion Jones 2002), yet two are associated with the most important virus diseases of the crop: black currant reversion virus (BRV) for currant reversion and gooseberry vein banding associated virus (GVBaV) for the homonymous disease (Teifion Jones et al. 2001). BRV belongs to subgroup C of the genus Nepovirus of the family Comoviridae, whereas GVBaV is a member of genus Badnavirus, family Caulimoviridae (Petrzik et al. 2012). To this date, there is no information on the presence of either viruses in currant in Bosnia and Herzegovina (BiH). Surveys were carried out to assess the occurrence and diversity of the two viruses using high-throughput sequencing (HTS). Thirteen currant specimens (one red, one white, and 11 black) were collected in spring 2018 from commercial orchards in three localities (Travnik, Teslic, and Bugojno). Only three plants exhibited virus-like symptoms: the red currant (Ribes rubrum) from Travnik displayed leaf and flower malformation; the white currant and one black currant (R. nigrum) from Teslic showed yellow patterns and chlorosis on the upper canopy. RNA was extracted from seven samples (white, red, and black currants; both symptomatic and asymptomatic) using the Spectrum Plant Total RNA Kit (Sigma-Aldrich, Germany) and further depleted of ribosomal RNA using the KAPA RNA Hyper+RiboErase HMR kit. Libraries were generated and sequenced on the Illumina NextSeq 500/550 platform in separate reactions. Sequence analysis using Virfind (Ho and Tzanetakis 2014) revealed the presence of BRV in the red currant plant with typical disease symptoms and an asymptomatic black currant (47 and 28 contigs respectively, from 105 to 1,584 bp) and GVBaV in an asymptomatic plant (17 contigs from 350 to 1,903 bp). Nucleic acids were extracted from all 13 samples using the Poudel et al. (2013) protocol that facilitated detection of both DNA and RNA viruses. Reverse transcription PCR (RT-PCR) and PCR analyses were performed with two pairs of virus-specific primers for BRV (F, 5′-GTAATACGCTGGTGTCTC-3′/R, 5′-GAAAGGACATTTCAGACTC-3′ and F, 5′-ATTTCGAGCTGTATGGTCG-3′/R, 5′-CTCGGAAGCAGTAGACCT-3′ [Lemmetty et al. 2001]) and for GVBaV (F, 5′-ACATCAAAGGGAAGGACAAC-3′/R, 5′-TCTAAAAGCATCCACTACCAC-3′ and F, 5′-TCAGACAGGCTCTCAACAATAC-3′/R, 5′-TTCTAAAAGCATCCACTACCAC-3′) (Jones et al. 2001). These assays identified an additional GVBaV-positive sample. All amplicons were sequenced, and BLAST analysis of the BRV sequences (GenBank accession nos. MK501976 to MK501978) and GVBaV (GenBank accession nos. MK519228 to MK519230) revealed 92 to 98% and 96 to 99% nucleotide identity to GenBank accessions AF321572 and JQ388488, respectively. The positive samples were further assessed for the presence of the viruses using northern-blot hybridization with a digoxigenin-labeled probe that targeted the nontranslated region of BRV RNA2 and conserved motifs in the ribonuclease H domain of GVBaV. The results were in line with HTS and PCR detection and with the symptoms expressed in the three symptomatic plants. In addition, the episomal form of GVBaV was confirmed by positive results in RT-PCR using DNase-treated total nucleic acids and rolling circle amplification. To our knowledge, this is the first time that BRV and GVBaV were detected in currants in BiH. Given the lack of a currant certification program in the country, this information will be used in the development of best management practices for control of the two viruses and their associated diseases in both field and nursery operations.

Detection and identification of a new isolate of Grapevine fanleaf Virus naturally infecting Grapevine plants in Egypt using qReal Time-PCR

Grapevine fanleaf virus (GFLV) is a member of the genus Nepovirus in the family Comoviridae, a widely distributed virus responsible for grapevine (Vitis vinifera) degeneration. This virus causes serious economic losses by reducing grape crop yield. The Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (qReal Time-PCR) assay was carried out on (GFLV) recovered from infected grapevines leaves at Alexandria, Egypt. A 606 bp fragment of the GFLV RNA-2 coat protein (CP) gene was amplified and then sequenced. Results of reactions of diagnostic hosts were observed on Gomphrena globosa, which developed systemic mottling, leaves twisting and necrotic spots during spring, whereas Chenopodium amaranticolor induced systemic mottling and leaf deformation, and its sap seemed relatively insensitive to the inhibitors of infection. Mottling of Glycine max was detected after inoculation, but inoculation of Nicotiana glutinosa didn't induce any symptoms. This study aimed to detect and identify a new isolate of GFLV-DA3 from Egypt using biological and molecular tools.

Construction and biological characterization of an Agrobacterium-mediated infectious cDNA of squash mosaic virus

Squash mosaic virus (SqMV), a member of the species Squash mosaic virus in the genus Comovirus (family Comoviridae), is an important seed-borne virus that causes serious economic losses in cucurbit crops. Here, we constructed infectious cDNA clones of SqMV genomic RNAs (RNA1 and RNA2) under the control of the cauliflower mosaic virus (CaMV) 35S promoter by Gibson assembly. The infectious cDNA clones of SqMV could infect zucchini squash (Cucurbita pepo) plants systemically by agrobacterium-mediated inoculation. The virus progeny from the infectious clones showed no difference from the wild type in terms of pathogenicity and symptom induction. It could be mechanically transmitted to zucchini squash (Cucurbita pepo), pumpkin (Cucurbita moschata), cucumber (Cucumis sativus), and muskmelon (Cucumis melo) but not watermelon (Citrullus lanatus) or Nicotiana benthamiana. This is the first report of construction of a SqMV infection clone and will facilitate the investigation of viral pathogenesis and host interactions.

First Confirmed Report of Tobacco ringspot virus in Cucurbits Crops in Oklahoma.

Cucurbits are major cash crops of vegetable growers in Oklahoma, particularly watermelon, which is the official state vegetable. In 2010, during a survey for cucurbit viruses (1), symptomatic leaf samples of cucumber (Cucumis sativus), cantaloupe (Cucumis melo), pumpkin, (Cucurbita pepo), squash (Cucumis maxima), and watermelon (Citrullus lanatus) showing mild to severe mosaic, mottling, and chlorotic spots were collected in Atoka, Blaine, Jefferson, and Tulsa counties. A total of 161 samples were tested by dot-immunobinding assay (DIBA) (2) using Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae) specific antiserum. Fourteen samples of cantaloupe, pumpkin, and watermelon from Blaine, Jefferson, and Tulsa counties were positive serologically to TRSV. At least one to two samples from each representative cucurbit collected in the field above were used as a source for mechanical inoculation. Sap was extracted from symptomatic leaves using 0.1 M K2HPO4 buffer (pH 7.2) and rub-inoculated to two squash (cv Elite) seedlings at cotyledonary stage pre-dusted with Carborundum. Seven to 10 days post-inoculation, all inoculated plants produced typical TRSV symptoms including chlorotic spots, systemic ringspot, severe leaf deformation, mottling, and stunting. Sap and total RNA was extracted from 10 mechanically inoculated squash seedlings and tested by DIBA and reverse transcription (RT)-PCR using specific TRSV primers (F: 5'-TACAGTGAGGATGCATG-3' and R: 5'-AGTAGCTGCGACAAGCCA-3'). All of the tested samples were positive by DIBA except the negative control. Similarly, all samples from mechanically inoculated plants were also positive by PCR showing the expected 1,039-bp PCR product when analyzed by agarose gel electrophoresis. Total RNA obtained from mock-inoculated squash seedlings used as a control was negative by PCR. Amplified PCR product (1,039 bp) was directly sequenced from three infected squash seedlings. Sequence analysis confirmed that the virus shared 90 to 92% nucleotide and 94% amino acid identities with RNA2 of TRSV isolate from the U.S. (Accession No AY363727) available in the GenBank database. Total RNA extracted from original tissues of 14 DIBA positive samples collected from field were also positive by RT-PCR. The presence of TRSV could pose a serious threat to many vegetable crops, particularly cucurbits and other agricultural crops, due to its wide host range (3). This report confirms the suspected occurrence of TRSV in 1956 from watermelon in Oklahoma (4).

First Report of Arabis mosaic virus on Grapevine in Spain.

Arabis mosaic virus (ArMV; genus Nepovirus, family Comoviridae) is one of several nepoviruses responsible for infectious degeneration disease of grapevines in Europe (3). The first occurrence in Spain, in the summer of 2007, was found in Val de Salnés, Rias Baixas appellation, Galice on 25-year-old vines of the Albariño variety grafted onto an unidentified rootstock and showing leaf yellowing. The second finding was in the spring of 2008 in Barriobusto, Rioja appellation, Basque Country on 30-year-old vines of Tempranillo variety grafted onto 41B rootstock. In this case, no obvious foliar symptoms were observed but fruit set was very poor. Positive ELISA results were obtained at two different laboratories using antibodies to ArMV obtained from two companies (BIOREBA, Reinach, Switzerland and Sediag, Longvic, France). At a third lab, the presence of ArMV was further confirmed by reverse transcription (RT)-nested PCR using the primers described by Bertolini et al. (1). External primers ArMV 1 and ArMV 2 amplified a fragment of 340 bp from the coat protein region of the virus and internal primers ArMV i1 and ArMV i2 amplified a fragment of 203 bp. The specificity of the amplicons was subsequently confirmed by sequencing and comparison with other ArMV isolates available in the GenBank, EMBL, and DDBJ databases. Alignment performed using Blastn showed 85% nucleotide sequence identity with ArMV isolate NW (Accession No. AY017339). ELISA revealed co-infection with GLRaV-1 in Galice, GLRaV-3 in Rioja, and GFkV at both sites; these other viruses being common in their respective appellations. ArMV could be mechanically transmitted from rooted cuttings onto Chenopodium amaranticolor with an average of a 46% success rate (1:10 tissue/buffer ratio; [2]), but the range was very wide (0 to 100%) and dependent on the individual source vine. No statistical differences were found between nicotine or phosphate buffer for extraction or when using shoot tips or root tips as a source of virus (Fisher's exact test). Infection in C. amaranticolor was symptomless, but detectable by ELISA, and systemic. The Galician grapevine was an isolated plant, replanted on the spot of a dead one. Xiphinema diversicaudatum, the nematode vector of ArMV, was found in the vineyard soil. Only two ArMV-positive vines were found among 1,993 plants analyzed in Galice from 2005 to 2007 (no field data available for the second finding). In Rioja, one positive vine was found in a random sample of 74 vines from two different vineyards. Further testing of the neighboring vines indicated that one of the adjacent plants was also infected. This minimal spread since the vineyard was planted is suggestive of a lack of vectored transmission. In Spain as a whole, the virus seems to be rare and associated with the Atlantic biogeographic region. Both vineyards were planted before certified material became widely available. Currently, statutory testing of grapevine propagation material should prevent further spread.

First Report of Nasturtium as a Natural Host of Cherry leaf roll virus on Amsterdam Island.

Cherry leaf roll virus (CLRV) is a well-known virus belonging to the genus Nepovirus, but unlike most members of this genus, it is not known to be transmitted by nematodes but only through seeds and pollen. Since its first description in 1955 on Prunus avium L. in England (1), CLRV has been shown to have a worldwide distribution and a wide natural host range. During a survey of plant viruses in the French sub-Antarctic islands, samples from nasturtium plants (Tropaeolum majus), an introduced plant species, showing symptoms of leaf mosaic, deformation, and veinal necrosis were collected on Amsterdam Island. Upon mechanical transmission with sap extracts, necrotic ringspot and oak-leaf symptoms typical of Nepovirus infection were observed on the leaves of inoculated Nicotiana clevelandii and N. tabacum plants. Inoculation of healthy nasturtium plants resulted in mosaic and pin-point necrosis symptoms. Electron microscopy on negatively stained sap extracts revealed the presence of icosahedral virions, 28 to 30 nm in diameter, in the symptomatic Nicotiana leaves. Amplification by reverse transcription (RT)-PCR with a polyvalent test, which identifies viruses belonging to the family Comoviridae (2), yielded the expected 248-bp fragment. Sequencing of the cloned amplicon showed 80% nucleotide and 90% amino acid identity with a part of the RNA dependent RNA polymerase (RdRp) of CLRV (CAE83562). To confirm the presence of CLRV, an approximate 4.6-kbp cDNA fragment was PCR amplified from double-stranded RNAs purifed from infected Nicotiana plants using the sense primer 5'-GTGGGACTGCCATGCACCTACTC-3' and an oligo-T25 as antisense primer. This PCR product (GenBank Accession No. GU167974) spans the region between the VPg gene and the polyA tail at the 3' end of the genome and thus provides approximately 2.8 kb of new internal sequence information on RNA1 of CLRV. The presence of CLRV in the initial nasturtium samples was confirmed with a CLRV-specific RT-PCR assay that amplifies the 3' non-coding region of the CLRV genome (3). Sequence of the amplified fragment showed it to be identical to the corresponding part of the 3' non-coding region of 4.6-kbp clone obtained from the CLRV isolate mechanically transmitted to the N. tabacum and N. clevelandii plants. Experimental infection of nasturtium by CLRV has been reported (4), but to the best of our knowledge these results represent the first report of natural infection of T. majus by CLRV. Given its seed transmissible character in many hosts, CLRV likely was introduced in infected seeds of T. majus imported to the remote sub-Antarctic Amsterdam Island.

First Report of Tobacco ringspot virus in Joe-Pye Weed (Eupatorium purpureum) in Mississippi.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3') designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a "bud blight" isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region.

Biological, serological and molecular comparison between isolates of Cowpea severe mosaic virus

ABSTRACT Cowpea, Vigna unguiculata, can be affected by several diseases, and those caused by viruses are considered of great importance. Cowpea severe mosaic virus (CPSMV), which belongs to the family Comoviridae, genus Comovirus, stands out for its severity and degree of incidence. Its genetic variability can give rise to different strains around the world, including in Brazil. The objective of the present research was to establish a biological, serological and molecular comparison between five CPSMV isolates obtained from naturally infected plants in different States of the Northeast of Brazil. Isolates were obtained from cowpea: CPSMV-AL (State of Alagoas), CPSMV- CE (Ceara); CPSMV-MC (Piaui), CPSMV-PE (Pernambuco) and an isolate obtained from Crotalaria paulinea, in the State of Maranhao - CPSMV-CROT. A host range study evidenced biological differences among the virus isolates, especially in cowpea genotypes. The isolates were showed to be serologically and molecularly related by polymerase chain reaction �� PCR, using degenerated primers which amplified two conserved regions in the coat protein and in the replicase genes. Cloning and sequence of CPSMV-PE made possible its comparison with other CPSMV isolates and other virus species from the genus Comovirus.

Cheravirus and Sadwavirus: two unassigned genera of plant positive-sense single-stranded RNA viruses formerly considered atypical members of the genus Nepovirus (family Comoviridae)

Cheravirus and Sadwavirus: two unassigned genera of plant positive-sense single-stranded RNA viruses formerly considered atypical members of the genus Nepovirus (family Comoviridae)

Cell-to-cell trafficking, subcellular distribution, and binding to coat protein of Broad bean wilt virus 2 VP37 protein

Broad bean wilt virus 2 (BBWV 2) is a member of the genus Fabavirus of the family Comoviridae. To date, a movement protein (MP) of BBWV 2 has not been described. Here we demonstrate that the green fluorescent protein (GFP)-VP37 fusion protein can move from initial bombarded cells to neighboring cells in Nicotiana benthamiana epidermal leaves. In addition, the GFP-VP37 fusion protein localizes as a halo around the nucleus and as punctate spots on the cell periphery in N. benthamiana epidermal leaf cells and BY-2 suspension cells. Fluorescence near the nucleus also was co-localized with the endoplasmic reticulum in BY-2 cells. Fibrous networks were found in GFP-VP37 agro-infiltrated N. benthamiana epidermal leaf cells. Deletion analyses indicated that the C-terminal region of the VP37 protein is essential for localization at the cell periphery. Using a blot overlay assay and bimolecular fluorescence complementation assay, the purified 6×His-tagged VP37 protein was shown to bind specifically to the small coat protein of BBWV 2. The above results indicate that VP37 is a movement protein.

Multiple interspecies recombination events within RNA2 of Grapevine fanleaf virus and Arabis mosaic virus

Sequence alignments and SISCAN analyses inferred multiple interspecies recombination events within RNA2 of strains GHu of Grapevine fanleaf virus (GFLV) and Ta of Arabis mosaic virus (ArMV), two closely related subgroup A nepoviruses in the family Comoviridae. Interspecies recombination events were identified in the 5' untranslated region, the putative homing protein and movement protein genes but not in the coat protein gene and 3' untranslated region. These findings suggest a dynamic relationship between GFLV and ArMV, and a differential selection pressure on RNA2-encoded proteins with constraints in terms of function and co-adaptation that limit interspecies recombination to certain gene segments.

First Report of the Occurrence of Grapevine fanleaf virus in Washington State Vineyards.

Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5'-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231-2250) and reverse primer (5'-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533-2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV.

Cheravirus and Sadwavirus: two unassigned genera of plant positive-sense single-stranded RNA viruses formerly considered atypical members of the genus Nepovirus (family Comoviridae)

The genus Nepovirus (family Comoviridae) was known both for a good level of homogeneity and for the presence of atypical members. In particular, the atypical members of the genus differed by the number of capsid protein (CP) subunits. While typical nepoviruses have a single CP subunit with three structural domains, atypical nepoviruses have either three small CP subunits, probably corresponding to the three individual domains, or a large and a small subunit, probably containing two and one structural domains, respectively. These differences are corroborated by hierarchical clustering based on sequences derived from both genomic RNAs. Therefore, these atypical viruses are now classified in two distinct genera, Cheravirus (three CP subunits; type species Cherry rasp leaf virus) and Sadwavirus (two CP subunits; type species Satsuma dwarf virus).

No-Choice Preference of <I>Cerotoma trifurcata</I> (Coleoptera: Chrysomelidae) to Potential Host Plants of Bean Pod Mottle Virus (<I>Comoviridae</I>) in Iowa

To better understand the naturally occurring host range of Bean pod mottle virus (family Comoviridae, genus Comovirus, BPMV) and its principal vector Cerotoma trifurcata (Förster) (Coleoptera: Chrysomelidae), 18 field-collected perennial plant species were tested for the presence of BPMV. By using no-choice assays, we determined the preference of these plants by bean leaf beetle, by measuring their level of herbivory relative to soybean, Glycine max (L.). New food hosts for adult bean leaf beetles include Lespedeza capitata (Michaux), Lotus corniculatus L., Trifolium alexandrinum L., Trifolium ambiguum Bieberstein, and Trifolium incarnatum L. Desmodium illinoense Gray is discovered as a new naturally occurring host for BPMV.

First Report of Japanese Beetle (Popillia japonica) as a Vector of Southern bean mosaic virus and Bean pod mottle virus

The Japanese beetle, Popillia japonica (Coleoptera: Scarabaeidae), was introduced into the United States in New Jersey in 1916 and now commonly occurs in the eastern and mid-western United States. The Japanese beetle has a wide host range and feeds on more than 300 plant species within 79 families (2), but it has not been reported to be a vector of plant viruses. Southern bean mosaic virus (SBMV; genus Sobemovirus) and Bean pod mottle virus (BPMV; family Comoviridae, genus Comovirus) are transmitted by several species of leaf-feeding beetles in the families Coccinelidae and Chrysomelidae (1). Japanese beetles, collected in northwestern Arkansas with a JB Jumbo insect trap (Great Lakes IPM, Inc., Vestaburg, MI), were tested to determine if they are able to transmit SBMV and BPMV. The beetles were given a 24-h acquisition access (individually in plastic petri dishes) to detached trifoliolate leaves of Phaseolus vulgaris 'Black Valentine' systemically infected with either BPMV or SBMV. Beetles that had fed on the infected bean leaves (as evidenced by feeding damage to the leaves) were caged individually in clear plastic cups on healthy 'Black Valentine' bean seedlings for a 24-h transmission access period. The test plants were grown in the greenhouse for 2 weeks after which they were evaluated for virus infection. In the first trial, BPMV was not transmitted (0 of 11 bait plants with feeding damage), whereas SBMV was efficiently transmitted (6 of 6 bait plants with feeding damage) as determined by agar-gel double-diffusion serology of test plants using polyclonal antibodies to SBMV and BPMV. In a second trial, with a different set of beetles, the transmission rate for BPMV was 3 of 46 (6.5%) and 33 of 43 (77%) for SBMV, and the test plants were evaluated for virus infection using Protein A ELISA. The higher transmission efficiency of SBMV by Japanese beetles when compared with BPMV is characteristic of these two viruses when they are transmitted by other leaffeeding beetles (1). These results are in contrast to an earlier report that Japanese beetles were not able to transmit BPMV from infected soybeans to healthy soybeans in Illinois (3). To our knowledge, this is the first report that the Japanese beetle, an introduced insect with a wide host range in the United States, is a vector of plant viruses.

Molecular Identification, Reverse Transcription-Polymerase Chain Reaction Detection, Host Reactions, and Specific Cytopathology of Artichoke yellow ringspot virus Infecting Onion Crops

ABSTRACT An isometric virus ca. 25 nm in diameter with angular contour was isolated from onion plants showing yellow leaf striping and necrotic tips. The virus was mechanically transmitted onto 28 species of indicator plants belonging to five families, viz. Amaranthaceae, Chenopodiaceae, Cucurbitaceae, Leguminosae, and Solanaceae where it causes ring spots, malformations, and/or tip necrosis. Cytopathological studies in infected Nicotiana benthamiana tissues revealed cytoplasmic inclusions resembling those caused by Artichoke yellow ringspot virus (AYRSV), a member of the family Comoviridae. Host range and symptomatology of the onion virus were also similar to AYRSV. A high seed transmission rate (20%) was found in onion. Reverse transcription-polymerase chain reaction using degenerate primers specific for the family Comoviridae allowed amplification of RNA-dependent RNA polymerase sequences, which upon sequence analysis and comparison with AYRSV isolates from Cynara scolymus (AYRSV-AtG) and Vicia faba (AYRSV-F) were highly similar, thus providing evidence that the nepovirus AYRSV is infecting onion in the field.

A comprehensive open reading frame phylogenetic analysis of isometric positive strand ssRNA plant viruses

Rigorous large-scale whole genome comparisons are capable of providing more comprehensive and potentially more accurate descriptions of viral relationships, allowing for the effective validation and modification of current taxonomy. Using a set of 5 togaviruses as an outgroup, a comprehensive phylogeny for 115 isometric positive ssRNA plant viruses was generated based on the simultaneous comparison of over 480 ORFs found within completely sequenced genomes. With the exception of a diverse group of viruses representing the family Comoviridae, the single tree generated contained well supported branches corresponding to well established groups of viruses, including Bromoviridae, Umbravirus, Sobemovirus, and Tymoviridae. In addition, evidence for specific relationships between groups were also observed, specifically Tombusviridae + Umbravirus, and Luteoviridae + Sobemovirus. Various well established subgroups of viruses were also well resolved within the tree. In addition, some recent proposals involving the creation of new genera or the inclusion of newly described viruses into established genera were supported, while others were not. The evidence for frequent gene sharing and the potential consequences to viral taxonomy are discussed.

The complete sequence of a Spanish isolate of Broad bean wilt virus 1 (BBWV-1) reveals a high variability and conserved motifs in the genus Fabavirus

The genome of a Spanish isolate of Broad bean wilt virus-1 (BBWV-1) was completely sequenced and compared with available sequences of other isolates of the genus Fabavirus (BBWV-1 and BBWV-2). This consisted of two RNAs of 5814 and 3431 nucleotides, respectively, and their organization was similar to that of other members of the family Comoviridae. Its mean nucleotide identity with a BBWV-1 American isolate was 81.5%, and between 59.8 and 63.5% with seven BBWV-2 isolates. Our analysis showed sequence stretches in the 5' non-coding regions which are conserved in both genomic RNAs and in BBWV-1 and BBWV-2 isolates.

Genes diferentes podem conferir resistência ao Cowpea severe mosaic virus em caupi

O caupi (Vigna unguiculata) é uma importante leguminosa cultivada principlamente por pequenos agricultores da região Nordeste. Doenças ocasionadas por vírus podem constituir o principal fator limitante da produção do caupi, destacando-se, nesse aspecto, o mosaico severo, causado pelo Cowpea severe mosaic virus (CpSMV), família Comoviridae, gênero Comovirus. A resistência tem sido considerada como a melhor alternativa no controle dessa virose e diversas fontes promissoras têm sido relatadas, como as cultivares Macaibo e CNC 0434, e a linhagem L254.008. As investigações sobre a base genética da resistência ao CpSMV nesses materiais têm conduzido a resultados semelhantes, sendo a resistência herdada como uma característica monogênica recessiva. No entanto, até então, nenhum trabalho havia investigado o alelismo dos genes de resistência dessas fontes. No presente trabalho foram realizados estudos visando esclarecer essa questão nas três fontes de resistência; 'Macaibo', 'CNC0434' e L254.008. Plantas dos referidos genótipos foram cruzadas de maneira direta e recíproca originando seis populações F1 e F2. Inoculações controladas dessas populações com o isolado CpSMV-Re1 permitiram concluir que o gene de resistência de 'Macaibo' é o mesmo de 'CNC-0434', distinto daquele encontrado na linhagem L254.008.

Gentian mosaic virus: A New Species in the Genus Fabavirus

ABSTRACT A viral isolate, designated N-1 and obtained from a gentian (Gentiana scabra) plant that exhibited mosaic symptoms, was transmitted mechanically to nine plant species in six families. These plants are known as hosts of fabaviruses. The N-1 isolate was composed of isometric particles 30 nm in diameter and included two RNA molecules of approximately 6.0 and 3.6 kb in length, as estimated by agarose gel electrophoresis. The RNAs were encapsidated separately in two of the three types of particle. Each particle contained two distinct proteins with Mr values of 39.3 x 10(3) and 26.6 x 10(3), as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Analysis of complete nucleotide sequences of the RNAs suggested that each encoded a single large polyprotein, in which putative functional proteins were arranged in a manner similar to those in Broad bean wilt virus 1 (BBWV-1) and Broad bean wilt virus 2 (BBWV-2), which are members of the genus Fabavirus (family Comoviridae). Analysis of the deduced amino acid sequences of the proteins indicated that those of isolate N-1 shared 38 to 66% identity with those of BBWV-1 and BBWV-2 but only 16 to 42% identity with those of a comovirus, Cowpea mosaic virus. Phylogenetic analysis, based on the amino acid sequences of RNA polymerase, placed isolate N-1 in a separate lineage from BBWV-1 and BBWV-2. In indirect-enzyme-linked immunosorbent assay, isolate N-1 exhibited distant serological relationship to BBWV-1, BBWV-2, and Lamium mild mosaic virus, another fabavirus. Our results suggest that N-1 represents a new species of Fabavirus. We propose the name Gentian mosaic virus for this new species.