Expression Of Pluripotency Factors Research Articles

Abstract 2789: NCAPG promotes triple-negative breast cancer stemness by a positive feedback loop with HIF-1α

Abstract Objective: Triple-negative breast cancer (TNBC) is life-threatening because of limited therapies and lack of effective therapeutic targets. NCAPG, an oncogenic marker, might be served as a new target for TNBC treatment. Here, we aimed to elucidate the role of NCAPG played in TNBC and the underlying mechanism. Design: GEO data was used to investigate the potential targets for TNBC. Patient samples and TCGA data were used to demonstrate the clinical significance. Cell migration, self-renewal ability, chemoresistance and expression of pluripotency factors were tested to detect the stemness of TNBC cells. Immunoprecipitation, ubiquitination assay and chromatin immunoprecipitation assay were utilized to investigate the mutual regulation mechanism of NCAPG and HIF-1α. Results: NCAPG was significantly overexpressed in TNBC compared with other subtypes of breast cancer and was positively correlated with poor overall survival. Elevated NCAPG expression could enhance cancer stem-like cell properties of TNBC cells. Mechanically, NCAPG positively regulated HIF-1α protein stability by interacting with HIF-1α and competitively abrogating the E3 ligase FBXW7-mediated ubiquitination and degradation towards HIF-1α. NCAPG, as a direct target gene of HIF-1α, could be in turn transcriptionally upregulated by HIF-1α. Conclusion: NCAPG promotes TNBC stemness by a HIF-1α/NCAPG positive feedback loop. NCAPG is a promising target for TNBC treatment. Citation Format: Huimin Zhang, Peiling Xie, Rui An. NCAPG promotes triple-negative breast cancer stemness by a positive feedback loop with HIF-1α [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2789.

LINC00909 up-regulates pluripotency factors and promotes cancer stemness and metastasis in pancreatic ductal adenocarcinoma by targeting SMAD4

BackgroundPancreatic cancer stem cells are crucial for tumorigenesis and cancer metastasis. Presently, long non-coding RNAs were found to be associated with Pancreatic Ductal Adenocarcinoma stemness characteristics but the underlying mechanism is largely known. Here, we aim to explore the function of LINC00909 in regulating pancreatic cancer stemness and cancer metastasis.MethodsThe expression level and clinical characteristics of LINC00909 were verified in 80-paired normal pancreas and Pancreatic Ductal Adenocarcinoma tissues from Guangdong Provincial People’s Hospital cohort by in situ hybridization. RNA sequencing of PANC-1 cells with empty vector or vector encoding LINC00909 was experimented for subsequent bioinformatics analysis. The effect of LINC00909 in cancer stemness and metastasis was examined by in vitro and in vivo experiments. The interaction between LINC00909 with SMAD4 and the pluripotency factors were studied.ResultsLINC00909 was generally upregulated in pancreatic cancer tissues and was associated with inferior clinicopathologic features and outcome. Over-expression of LINC00909 enhanced the expression of pluripotency factors and cancer stem cells phenotype, while knock-down of LINC00909 decreased the expression of pluripotency factors and cancer stem cells phenotype. Moreover, LINC00909 inversely regulated SMAD4 expression, knock-down of SMAD4 rescued the effect of LINC00909-deletion inhibition on pluripotency factors and cancer stem cells phenotype. These indicated the effect of LINC00909 on pluripotency factors and CSC phenotype was dependent on SMAD4 and MAPK/JNK signaling pathway, another downstream pathway of SMAD4 was also activated by LINC00909. Specifically, LINC00909 was localized in the cytoplasm in pancreatic cancer cells and decreased the stability the SMAD4 mRNA. Finally, we found over-expression of LINC00909 not only accelerated tumor growth in subcutaneous mice models, but also facilitated tumorigenicity and spleen metastasis in orthotopic mice models.ConclusionWe demonstrate LINC00909 inhibits SMAD4 expression at the post-transcriptional level, which up-regulates the expression of pluripotency factors and activates the MAPK/JNK signaling pathway, leading to enrichment of cancer stem cells and cancer metastasis in pancreatic cancer.

Conserved mechanisms of self-renewal and pluripotency in mouse and human ESCs regulated by simulated microgravity using a 3D clinostat

Embryonic stem cells (ESCs) exhibit unique attributes of boundless self-renewal and pluripotency, making them invaluable for fundamental investigations and clinical endeavors. Previous examinations of microgravity effects on ESC self-renewal and differentiation have predominantly maintained a descriptive nature, constrained by limited experimental opportunities and techniques. In this investigation, we present compelling evidence derived from murine and human ESCs, demonstrating that simulated microgravity (SMG)-induced stress significantly impacts self-renewal and pluripotency through a previously unidentified conserved mechanism. Specifically, SMG induces the upregulation of heat shock protein genes, subsequently enhancing the expression of core pluripotency factors and activating the Wnt and/or LIF/STAT3 signaling pathways, thereby fostering ESC self-renewal. Notably, heightened Wnt pathway activity, facilitated by Tbx3 upregulation, prompts mesoendodermal differentiation in both murine and human ESCs under SMG conditions. Recognizing potential disparities between terrestrial SMG simulations and authentic microgravity, forthcoming space flight experiments are imperative to validate the impact of reduced gravity on ESC self-renewal and differentiation mechanisms.

Association of DAZL expression with risk of recurrence in clinical stage 1 testicular germ cell tumors.

523 Background: One model for testicular germ cell tumor (TGCT) formation posits that these tumors arise from a failure of germ cell determination characterized by persistent pluripotency and apoptotic escape. Risk assessment for relapse in clinical stage 1 (CS1) TGCT is dictated by clinical factors; molecular biomarkers to improve patient stratification for post-orchiectomy care are lacking. In this study, we examined the relationship between protein expression of pluripotency and apoptosis factors and risk of relapse in clinical stage 1 TGCT. Methods: Orchiectomy specimens from 73 patients treated for clinical stage 1 TGCT at one institution (27 seminoma, 46 non-seminoma) were subjected to immunohistochemistry (IHC) to assess protein expression of DAZL, POU5F1, BAK1, DDX4, NANOG, and PMAIP1. Samples were dichotomized as negative or positive for target protein expression. Patients with CS1 TGCT managed with surveillance were annotated for baseline clinical characteristics and whether they experienced relapse within two years of orchiectomy. Exact logistic regression estimated odds ratios (OR) and 95% confidence intervals were calculated for the association between protein expression and relapse. Results: At two years, 17% of patients in our cohort experienced relapse. DAZL expression (score > 0) was detected in 43% of seminoma samples and 13% of embryonal carcinomas. After adjusting for histology, tumors negative for DAZL expression were more likely to recur within two years (adjusted OR for recurrence 0.08, 95% CI 0 – 0.81, p = 0.03). The direction of this relationship was consistent in seminoma when adjusted for tumor size (adjusted OR 0.14, 95% CI 0-1.83, p = 0.18) and non-seminoma after adjustment for embryonal predominance and lymphovascular invasion (adjusted OR 0.53, 95% CI 0-3.10, p = 0.30). No notable findings were observed for POU5F1, BAK1, DDX4, NANOG, and PMAIP1. Validation studies in two independent cohorts from other institutions are ongoing. Conclusions: The absence of DAZL expression by IHC is associated with a greater risk of relapse in CS1 TGCT. As DAZL promotes germ cell commitment by suppressing the pluripotency program, absence of DAZL expression may promote an oncogenic germ cell phenotype and more aggressive tumor behavior. Validation in larger patient cohorts is required to credential DAZL as a biomarker for clinical stage 1 relapse on surveillance.

Generation and characterization of two fibroblast-derived Baboon induced pluripotent stem cell lines

Cross-species comparisons studying primate pluripotent stem cells and their derivatives are crucial to better understand the molecular and cellular mechanisms behind human disease and development. Within this context, Baboons (Papio anubis) have emerged as a prominent primate model for such investigations. Herein, we reprogrammed skin fibroblasts of one male individual and generated two induced pluripotent stem cell (iPSC) lines, which exhibit the characteristic ESC-like morphology, demonstrated robust expression of key pluripotency factors and displayed multilineage differentiation potential. Notably, both iPSC lines can be cultured under feeder-free conditions in commercially available medium, enhancing their value for cross-species comparisons.

USP36 plays an oncogenic role in colorectal cancer cells.

Cancer stem cells (CSCs) have emerged as crucial contributors to tumor relapse and chemoresistance, making them promising targets for treating cancers like colorectal cancer (CRC). However, the mechanisms governing CSC maintenance in CRC remain poorly characterized. In this study, we investigated the potential role of ubiquitin-specific protease 36 (USP36) in CRC. Our bioinformatic analysis revealed a significant upregulation of USP36 expression in CRC, and high USP36 levels were associated with poor prognosis in CRC patients. Furthermore, we observed an increase in USP36 expression in CRC cell lines. Knockdown of USP36 resulted in reduced viability, cell cycle arrest, increased apoptosis, and impaired migration and invasion in CRC cells. Additionally, the colony formation and sphere formation ability, as well as the expression of stem cell markers and pluripotent transcription factors, were substantially reduced in USP36-deficient CRC cells. These findings emphasize the role of USP36 as an oncogene in CRC, highlighting its potential as a therapeutic target for the treatment of CRC.

Exogenous OCT4 and SOX2 Contribution to In Vitro Reprogramming in Cattle.

Mechanisms of cell reprogramming by pluripotency-related transcription factors or nuclear transfer seem to be mediated by similar pathways, and the study of the contribution of OCT4 and SOX2 in both processes may help elucidate the mechanisms responsible for pluripotency. Bovine fibroblasts expressing exogenous OCT4 or SOX2, or both, were analyzed regarding the expression of pluripotency factors and imprinted genes H19 and IGF2R, and used for in vitro reprogramming. The expression of the H19 gene was increased in the control sorted group, and putative iPSC-like cells were obtained when cells were not submitted to cell sorting. When sorted cells expressing OCT4, SOX2, or none (control) were used as donor cells for somatic cell nuclear transfer, fusion rates were 60.0% vs. 64.95% and 70.53% vs. 67.24% for SOX2 vs. control and OCT4 vs. control groups, respectively; cleavage rates were 66.66% vs. 81.68% and 86.47% vs. 85.18%, respectively; blastocyst rates were 33.05% vs. 44.15% and 52.06% vs. 44.78%, respectively. These results show that the production of embryos by NT resulted in similar rates of in vitro developmental competence compared to control cells regardless of different profiles of pluripotency-related gene expression presented by donor cells; however, induced reprogramming was compromised after cell sorting.

Characterization of Epithelial Stem Cells and Mesenchymal Stem Cells from Human Hair Follicle

Hair follicle mesenchymal stem cells (HF-MSCs) and epithelial stem cells (HF-EpSCs) play a key role in hair growth and regeneration. The isolation, culture and characterization of HF-MSCs and HF-EpSCs will provide clues for in vitro tissue models and regenerative medicine applications. In this study, HF-MSCs and HF-EpSCs from the hair bulge were harvested using the tissue culture method. HF-MSCs exhibited a fibroblast shape and expressed highly the mesenchymal markers CD44, CD73, CD90 and CD105 and a lack of hematopoietic markers CD45, CD34, CD11b, CD19 and HLA-DR. They showed the potential for differentiation into adipogenic, osteogenic and chondrogenic lineages. HF-EpSCs possessed the keratinocyte shape and expressed typical markers for epithelial stem cells such as CD200, CK15 and CK19. The stemness marker CD49f was preferentially expressed in HF-EpSCs over HF-MSCs. Moreover, the expression of pluripotent factors including c-myc, oct-4, sox-2, klf-4 and nanog at the mRNA level was higher in HF-EpSCs compared to the expression in HF-MSCs. In conclusion, we successfully isolated mesenchymal and epithelial stem cells via culturing the hair follicle bulge tissues and preliminarily evaluated the stemness and plasticity of these two populations. This information will provide clues for further studies on hair regeneration in vitro and in vivo.

In-Silico Evaluation of Novel Honokiol Derivatives against Breast Cancer Target Protein LKB1.

Background Breast cancer is characterized by uncontrolled cell growth in the breast tissue and is a leading cause of death globally. Cytotoxic effects and reduced efficacy of currently used therapeutics insist to look for new chemo-preventive strategies against breast cancer. LKB1 gene has recently been categorized as a tumor suppressor gene where its inactivation can cause sporadic carcinomas in various tissues. Mutations in the highly conserved LKB1 catalytic domain lead to the loss of function and subsequently elevated expression of pluripotency factors in breast cancer. Objectives The utilization of drug-likeness filters and molecular simulation has helped evaluate the pharmacological activity and binding abilities of selected drug candidates to the target proteins in many cancer studies. Methods The current in silico study provides a pharmacoinformatic approach to decipher the potential of novel honokiol derivatives as therapeutic agents against breast cancer. AutoDock Vina was used for molecular docking of the molecules. A 100 nano second (ns) molecular dynamics simulation of the lowest energy posture of 3'-formylhonokiol-LKB1, resulting from docking studies, was carried out using the AMBER 18. Results Among the three honokiol derivatives, ligand-protein binding energy of 3' formylhonokiol with LKB1 protein was found to be the highest via molecular docking. Moreover, the stability and compactness inferred for 3'-formylhonokiol with LKB1 are suggestive of 3' formylhonokiol being an effective activator of LKB1 via simulation studies. Conclusion It was further established that 3'- formylhonokiol displays an excellent profile of distribution, metabolism, and absorption, indicating it is an anticipated future drug candidate.

Epigenetic mechanisms of Müller glial reprogramming mediating retinal regeneration.

Retinal degenerative diseases, characterized by retinal neuronal death and severe vision loss, affect millions of people worldwide. One of the most promising treatment methods for retinal degenerative diseases is to reprogram non-neuronal cells into stem or progenitor cells, which then have the potential to re-differentiate to replace the dead neurons, thereby promoting retinal regeneration. Müller glia are the major glial cell type and play an important regulatory role in retinal metabolism and retinal cell regeneration. Müller glia can serve as a source of neurogenic progenitor cells in organisms with the ability to regenerate the nervous system. Current evidence points toward the reprogramming process of Müller glia, involving changes in the expression of pluripotent factors and other key signaling molecules that may be regulated by epigenetic mechanisms. This review summarizes recent knowledge of epigenetic modifications involved in the reprogramming process of Müller glia and the subsequent changes to gene expression and the outcomes. In living organisms, epigenetic mechanisms mainly include DNA methylation, histone modification, and microRNA-mediated miRNA degradation, all of which play a crucial role in the reprogramming process of Müller glia. The information presented in this review will improve the understanding of the mechanisms underlying the Müller glial reprogramming process and provide a research basis for the development of Müller glial reprogramming therapy for retinal degenerative diseases.

Establishment of iPSC lines and zebrafish with loss-of-function AHDC1 variants: Models for Xia-Gibbs syndrome

Xia-Gibbs syndrome (XGS) is a syndromic form of intellectual disability caused by heterozygous AHDC1 variants, but the pathophysiological mechanisms underlying this syndrome are still unclear. In this manuscript, we describe the development of two different functional models: three induced pluripotent stem cell (iPSC) lines with different loss-of-function (LoF) AHDC1 variants, derived by reprogramming peripheral blood mononuclear cells from XGS patients, and a zebrafish strain with a LoF variant in the ortholog gene (ahdc1) obtained through CRISPR/Cas9-mediated editing. The three iPSC lines showed expression of pluripotency factors (SOX2, SSEA-4, OCT3/4, and NANOG). To verify the capacity of iPSC to differentiate into the three germ layers, we obtained embryoid bodies (EBs), induced their differentiation, and confirmed the mRNA expression of ectodermal, mesodermal, and endodermal markers using the TaqMan hPSC Scorecard. The iPSC lines were also approved for the following quality tests: chromosomal microarray analysis (CMA), mycoplasma testing, and short tandem repeat (STR) DNA profiling. The zebrafish model has an insertion of four base pairs in the ahdc1 gene, is fertile, and breeding between heterozygous and wild-type (WT) animals generated offspring in a genotypic proportion in agreement with Mendelian law. The established iPSC and zebrafish lines were deposited on the hpscreg.eu and zfin.org platforms, respectively. These biological models are the first for XGS and will be used in future studies that investigate the pathophysiology of this syndrome, unraveling its underlying molecular mechanisms.

Pharmacological ascorbate potentiates combination nanomedicines and reduces cancer cell stemness to prevent post-surgery recurrence and systemic metastasis

Conventional chemotherapy targets proliferative cancer cells to halt tumor progression or regress tumors. However, the plasticity of tumor cells enables their phenotypical changes to acquire chemo-resistance, leading to treatment failure or tumor recurrence after a successful treatment course. Here, we report the use of high-dose pharmacologic ascorbate to potentiate treatment efficacy of nanoscale coordination polymers (NCPs) delivering two clinical combinations of chemotherapeutics, carboplatin/docetaxel and oxaliplatin/SN38, and to target metabolic plasticity of tumor cells. Combination treatments of high-dose ascorbate and NCPs overcome multi-drug resistance by significantly reducing the abundance of cancer stem cells (CSCs) in solid tumors, as evidenced by reduced expression of tumor pluripotency factors. The clearance of CSCs inhibits post-surgery recurrence and systemic metastasis in multiple mouse models of cancer.

Plpp3, a novel regulator of pluripotency exit and endodermal differentiation of mouse embryonic stem cells.

In recent decades the study of the actions of bioactive lipids such as Lysophosphatidic Acid (LPA) and Sphingosine-1-Phosphate (S1P) has importantly increased since they are involved in regulating many processes, including self-renewal of embryonic stem cells, embryo development and cancer. The Phospholipid Phosphatase type 3 (PLPP3) has been shown key player in regulating the balance of these lipids, and in consequence their signaling. Different lines of evidence suggest PLPP3 could play a role in endoderm development, to approach this hypothesis we use mouse embryonic stem cells (ESC) as a model to study Plpp3 function in self-renewal and the transition towards differentiation. We found that lack of PLPP3 mainly affects endoderm formation during suspension embryoid bodies differentiation. PLPP3-deficient ESC strongly decreases the amount of FOXA2 expressing cells and fail to properly downregulate the expression of pluripotency factors when subjected to an endoderm directed differentiation protocol. Impaired endoderm differentiation correlated with a transient reduction in nuclear localization of YAP1. These phenotypes were rescued by transiently restoring the expression of catalytically active hPLPP3. In conclusion, PLPP3 plays a role in downregulating pluripotency-associated factors and in endodermal differentiation. PLPP3 regulates proper lipid/YAP1 signaling required for endodermal differentiation.

Modulation of Spheroid Forming Capacity and TRAIL Sensitivity by KLF4 and Nanog in Gastric Cancer Cells.

The expression of pluripotency factors, and their associations with clinicopathological parameters and drug response have been described in various cancers, including gastric cancer. This study investigated the association of pluripotency factor expression with the clinicopathological characteristics of gastric cancer patients, as well as changes in the expression of these factors upon the stem cell-enriching spheroid culture of gastric cancer cells, regulation of sphere-forming capacity, and response to cisplatin and TRAIL treatments by Nanog and KLF4. Nanog expression was significantly associated with the emergence of a new tumor and a worse prognosis in gastric cancer patients. The expression of the pluripotency factors varied among six gastric cancer cells. KLF4 and Nanog were expressed high in SNU-601, whereas SOX2 was expressed high in SNU-484. The expression of KLF4 and SOX2 was increased upon the spheroid culture of SNU-601 (KLF4/Nanog-high) and SNU-638 (KLF4/Nanog-low). The spheroid culture of them enhanced TRAIL-induced viability reduction, which was accompanied by the upregulation of death receptors, DR4 and DR5. Knockdown and overexpression of Nanog in SNU-601 and SNU-638, respectively, did not affect spheroid-forming capacity, however, its expression was inversely correlated with DR4/DR5 expression and TRAIL sensitivity. In contrast, KLF4 overexpression in SNU-638 increased spheroid formation, susceptibility to cisplatin and TRAIL treatments, and DR4/DR5 expression, while the opposite was found in KLF4-silenced SNU-601. KLF4 is supposed to play a critical role in DR4/DR5 expression and responses to TRAIL and cisplatin, whereas Nanog is only implicated in the former events only. Direct regulation of death receptor expression and TRAIL response by KLF4 and Nanog have not been well documented previously, and the regulatory mechanism behind the process remains to be elucidated.

NARF is a hypoxia-induced coactivator for OCT4-mediated breast cancer stem cell specification.

Hypoxia is a key characteristic of the breast cancer microenvironment that promotes expression of the transcriptional activator hypoxia-inducible factor 1 (HIF-1) and is associated with poor patient outcome. HIF-1 increases the expression or activity of stem cell pluripotency factors, which control breast cancer stem cell (BCSC) specification and are required for cancer metastasis. Here, we identify nuclear prelamin A recognition factor (NARF) as a hypoxia-inducible, HIF-1 target gene in human breast cancer cells. NARF functions as an essential coactivator by recruiting the histone demethylase KDM6A to OCT4 bound to genes encoding the pluripotency factors NANOG, KLF4, and SOX2, leading to demethylation of histone H3 trimethylated at lysine-27 (H3K27me3), thereby increasing the expression of NANOG, KLF4, and SOX2, which, together with OCT4, mediate BCSC specification. Knockdown of NARF significantly decreased the BCSC population in vitro and markedly impaired tumor initiation capacity and lung metastasis in orthotopic mouse models.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

The Application of the SORE6 Reporter in the Studies of Acute Myeloid Leukemia - a Novel Model for Disease Relapses

Most patients diagnosed with acute myeloid leukemia (AML) suffer from disease relapses within two years after the initial remission. Treatment options for relapsed AML are limited and the clinical outcome associated with this stage of disease is dismal. Partly due to the lack of experimental models, the biology underlying AML relapses is not well understood. We hypothesized that the cancer stem-like (CSL) cells, which represent a minority of the neoplastic cell population, are the major contributors of AML relapses. SORE6, a reporter designed to detect the expression and activity of inducible pluripotent stem cell factors, was used to identify/purify CSL cells in two FLT3-mutated AML cell lines, MOLM-13 and MV4-11. Both cell lines contained ~10% of SORE6+ cells at the steady state, as revealed by their expression of the reporter green fluorescence protein. Compared to SORE6- cells, SORE6+ cells had significantly more spheroid formation in the hanging drop assay (75 vs 35%, p=.006), and were significantly more resistant to Ara-C (inhibitory concentration at 50%, 60 vs 25 nM, p=.0005) and Venetoclax (2.6 vs 8.2 nM, p=.002) in the presence of low-dose Ara-C. By western blots, SORE6+ cells were found to express substantially higher levels of Myc/FLT3/pSTAT5 than SORE6- cells. Myc appeared to be a key driver of SORE6 activity, and the reporter activity was effectively suppressed by Myc pharmacologic inhibitors or shRNA. By subjecting a mixture of bar-coded SORE6- and SORE6+ MOLM-13 cells (in 9:1 ratio to mimic that at the steady state) to the lowest concentration of Ara-C that resulted in no detectable viability in the cell culture, we consistently found evidence of cell regeneration after 8-12 days of undetectable cell viability. Regeneration initially occurred slowly, and the cell growth went into a log phase after 1-2 weeks. Using PCR to detect the relative proportion of bar-coded SORE6- and SORE6+ cells, we found that the regenerated cell population contained a substantially higher proportion of SORE6+ cells, with 64% SORE6+ cells in the initial slow-growth phase. In comparison, the proportion of cells originating from SORE6+ cells increased to an average of 86% during the log-growth phase. Importantly, cells in the log-growth phase were found to have a significantly higher resistance to Ara-C and had significantly more spheroid formation in the hanging drop assay compared to untreated cells. To further validate the concept that CSL cells are the key contributors to the AML relapse, we collected pairs of initially diagnostic and relapsed bone marrow specimens derived from the same patients. By immunocytochemistry, we found that relapsed AML blasts were more frequently positive for Myc, a surrogate marker of SORE6 activity, compared to those in the pre-treatment samples. To conclude, using SORE6, we have developed a technically simple experimental model that capitulates some of the key features of AML relapses. Our model has provided direct evidence that CSL cells are key contributors to the disease relapse in AML. We believe that this in-vitro model is valuable in testing the efficacy of new therapeutic agents against AML, especially those designed to target the CSL cell population.

MSCs vs. iPSCs: Potential in therapeutic applications.

Over the past 2decades, mesenchymal stem cells (MSCs) have attracted a lot of interest as a unique therapeutic approach for a variety of diseases. MSCs are capable of self-renewal and multilineage differentiation capacity, immunomodulatory, and anti-inflammatory properties allowing it to play a role in regenerative medicine. Furthermore, MSCs are low in tumorigenicity and immune privileged, which permits the use of allogeneic MSCs for therapies that eliminate the need to collect MSCs directly from patients. Induced pluripotent stem cells (iPSCs) can be generated from adult cells through gene reprogramming with ectopic expression of specific pluripotency factors. Advancement in iPS technology avoids the destruction of embryos to make pluripotent cells, making it free of ethical concerns. iPSCs can self-renew and develop into a plethora of specialized cells making it a useful resource for regenerative medicine as they may be created from any human source. MSCs have also been used to treat individuals infected with the SARS-CoV-2 virus. MSCs have undergone more clinical trials than iPSCs due to high tumorigenicity, which can trigger oncogenic transformation. In this review, we discussed the overview of mesenchymal stem cells and induced pluripotent stem cells. We briefly present therapeutic approaches and COVID-19-related diseases using MSCs and iPSCs.

The Defects of Epigenetic Reprogramming in Dox-Dependent Porcine-iPSCs.

Porcine-induced pluripotent stem cells (piPSCs) are of great significance to animal breeding and human medicine; however, an important problem is that the maintenance of piPSCs mainly depends on exogenous expression of pluripotent transcription factors (TFs), and germline transmission-competent piPSCs have not yet been successfully established. In this study, we explore the defect of epigenetic reprogramming during piPSCs formation, including chromatin accessibility, DNA methylation, and imprinted gene expression, with high-throughput sequencing (ATAC-seq, WGBS, RNA-seq, and Re-seq) methods. We found the somatic features were successfully silenced by connecting closed chromatin loci with downregulated genes, while DNA methylation has limited effects on somatic silence. However, the incomplete chromatin remodeling and DNA demethylation in pluripotency genes hinder pluripotent activation, resulting in the low expression of endogenous pluripotency genes. In addition, the expression of potential imprinted genes was abnormal, and many allelic-biased expressed genes in porcine embryonic fibroblasts (PEFs) were erased, accompanied by establishment of new allelic-biased expressed genes in piPSCs. This study reveals the aberrant epigenetic reprogramming during dox-dependent piPSCs formation, which lays the foundation for research of porcine-iPSC reprogramming and genome imprinting.

A NANOG-pERK reciprocal regulatory circuit regulates Nanog autoregulation and ERK signaling dynamics.

The self-renewal and differentiation potential of embryonic stem cells (ESCs) is maintained by the regulated expression of core pluripotency factors. Expression levels of the core pluripotency factor Nanog are tightly regulated by a negative feedback autorepression loop. However, it remains unclear how ESCs perceive NANOG levels and execute autorepression. Here, we show that a dose-dependent induction of Fgfbp1 and Fgfr2 by NANOG activates autocrine-mediated ERK signaling in Nanog-high cells to trigger autorepression. pERK recruits NONO to the Nanog locus to represstranscription by preventing POL2 loading. This Nanog autorepression process establishes a self-perpetuating reciprocal NANOG-pERK regulatory circuit. We further demonstrate that this reciprocal regulatory circuit induces pERK heterogeneity and ERK signaling dynamics in pluripotent stem cells. Collectively our data suggest that NANOG induces Fgfr2 and Fgfbp1 to activate ERK signaling in Nanog-high cells to establish a NANOG-pERK reciprocal regulatory circuit. This circuit regulates ERK signaling dynamics and Nanog autoregulation in pluripotent cells.