Expression Of C-kit Proto-oncogene Research Articles

G4 Sensing Pyridyl-Thiazole Polyamide Represses c-KIT Expression in Leukemia Cells.

Specific sensing and functional tuning of nucleic acid secondary structures remain less explored to date. Herein, we report a thiazole polyamide TPW that binds specifically to c-KIT1 G-quadruplex (G4) with sub-micromolar affinity and ∼1 : 1 stoichiometry and represses c-KIT proto-oncogene expression. TPW shows up to 10-fold increase in fluorescence upon binding with c-KIT1 G4, but shows weak or no quantifiable binding to other G4s and ds26 DNA. TPW can increase the number of G4-specific antibody (BG4) foci and mark G4 structures in cancer cells. Cell-based assays reveal that TPW can efficiently repress c-KIT expression in leukemia cells via a G4-dependent process. Thus, the polyamide can serve as a promising probe for G-quadruplex recognition with the ability to specifically alter c-KIT oncogene expression.

Synthetic Makaluvamine Analogs Decrease c-Kit Expression and Are Cytotoxic to Neuroendocrine Tumor Cells.

In an effort to discover viable systemic chemotherapeutic agents for neuroendocrine tumors (NETs), we screened a small library of 18 drug-like compounds obtained from the Velu lab against pulmonary (H727) and thyroid (MZ-CRC-1 and TT) neuroendocrine tumor-derived cell lines. Two potent lead compounds (DHN-II-84 and DHN-III-14) identified from this screening were found to be analogs of the natural product makaluvamine. We further characterized the antitumor activities of these two compounds using pulmonary (H727), thyroid (MZ-CRC-1) and pancreatic (BON) neuroendocrine tumor cell lines. Flow cytometry showed a dose-dependent increase in apoptosis in all cell lines. Induction of apoptosis with these compounds was also supported by the decrease in myeloid cell leukemia-1 (MCL-1) and X-chromosome linked inhibitor of apoptosis (XIAP) detected by Western blot. Compound treatment decreased NET markers chromogranin A (CgA) and achaete-scute homolog 1 (ASCL1) in a dose-dependent manner. Moreover, the gene expression analysis showed that the compound treatment reduced c-Kit proto-oncogene expression in the NET cell lines. Induction of apoptosis could also have been caused by the inhibition of c-Kit expression, in addition to the known mechanisms such as damage of DNA by topoisomerase II inhibition for this class of compounds. In summary, makaluvamine analogs DHN-II-84 and DHN-III-14 induced apoptosis, decreased neuroendocrine tumor markers, and showed promising antitumor activity in pulmonary, thyroid, and pancreatic NET cell lines, and hold potential to be developed as an effective treatment to combat neuroendocrine tumors.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3′-terminal under the bottom G-quartet. The 3′-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Mutation-free expression of c-Kit proto-oncogene in primary adenocarcinoma of uterine cervix

Mutation-free expression of c-Kit proto-oncogene in primary adenocarcinoma of uterine cervix

A promising hypothesis of c-KIT methylation/ expression paradox in c-KIT (+) squamous cell carcinoma of uterine cervix ----- CTCF transcriptional repressor regulates c-KIT proto-oncogene expression.

We recently reported one interesting case showing mutation-free c-KIT proto-oncogene overexpression and paradoxical hypermethylation in 54 cases of primary squamous cell carcinoma of uterine cervix (SCC). However, its molecular mechanisms still remain unknown. We propose the hypothesis that increased methylation at the CpG islands on the promoter near the first exon region might interfere with the binding of CTCF repressor with c-KIT promoter that regulates c-KIT proto-oncogene expression in such case. Further studies focusing on the status of epigenetic modifications of mutation-free c-KIT (+) tumors are encouraged.

Erratum to: c-Kit proto-oncogene expression in endometrial hyperplasia and endometrial cancer

Erratum to: c-Kit proto-oncogene expression in endometrial hyperplasia and endometrial cancer

C-Kit proto-oncogene expression in endometrial hyperplasia and endometrial cancer

To evaluate the expression of c-kit (CD117) in endometrial hyperplasia and endometrial cancer. Expression of c-kit in 10 normal endometrium, 18 simple endometrial hyperplasia, 16 complex endometrial hyperplasia (10 cases with atypia and 6 cases without atypia), and 6 endometrial cancer were investigated by immunohistochemistry. c-Kit expression decreased as the lesion progressed to endometrial cancer. Immunostaining was mostly focal and weak in the normal endometrium and was mostly diffuse and strong in the simple and complex endometrial hyperplasia. Simple and complex hyperplastic endometrial tissues express diffuse cytoplasmic staining for c-kit and the expression decreases with the progression of the lesion.

Changes in interstitial cell of Cajal-like cells density in congenital ureteropelvic junction obstruction

PurposeThe authors examined the number of interstitial cells of Cajal-like cells (ICC-LCs) in obstructed ureteropelvic junction (UPJ) in comparison with normal UPJ specimens and age-related changes.Materials and methodsA total of 20 human formalin fixed, paraffin-embedded specimens of intrinsic UPJO from children at the mean age of 8.1 years (age range: 8 months–16.8 years) and 5 control samples from children at the mean age of 2.3 years (range 2.4 months–7.4 years) were investigated immunohistochemically for the expression of c-kit proto-oncogene by light microscopy with computerized image analysis. The results were examined by Fisher’s exact test, Yates’ chi-square test, and t test for Pearson’s correlation coefficient. A P value less than 0.05 was considered statistically significant.ResultsThe number of ICC-LCs-dense fields was significantly higher in UPJO specimens in comparison with the normal group (P = 0.0004). The number of ICC-LCs-sparse fields was significantly lowered in UPJO specimens in comparison with the normal group (P = 0.0122). There was no significant difference in the number of ICC-LCs-medium fields in obstructed and normal UPJ specimens. The number of ICC-LCs was decreasing significantly with increasing age of the patients with UPJO (P = 0.0038).ConclusionsThe higher density of c-kit-positive ICC-LCs in UPJ may manifest the compensation of altered peristalsis in UPJO. The number of ICC-LCs-dense fields decreasing with age may show the failure of compensation and regression of the compensatory changes.

Expression of stem cell factor receptor c-kit in human nontumoral and tumoral hepatic cells

The aim of this study was to examine and compare the stem cell factor receptor c-kit expression in hepatocellular carcinoma (HCC) with the corresponding peritumoral tissue. To confirm the immunohistochemical results in the investigated HCC tissues, HCC cell lines were analyzed for c-kit expression. Expression of c-kit (SCF receptor) has been evaluated in 72 HCC and in the corresponding surrounding nontumorous tissue. Additionally, immunohistochemical analysis reverse transcription-polymerase chain reaction was also used to examine the mRNA expression of c-kit protooncogene in tumor homogenates. Furthermore, three HCC cell lines (HUH-7, HepG2, and SK-Hep1) were used for gene-expression analysis of c-kit mRNA. C-kit expression was detected immunohistochemically in 70% of HCC with different degrees of intensity. Moreover, c-kit expression could also be found in about 90% of the corresponding peritumoral noncirrhotic as well as in cirrhotic liver tissues. C-kit mRNA was detectable in 83% of HCC and in 75% of the corresponding peritumoral noncirrhotic as well as in 100% of corresponding peritumoral cirrhotic samples. In addition, two of the three HCC cell lines (HUH-7 and SK-Hep1) showed a well detectable PCR-product for c-kit. Hepatocytes express the c-kit receptor at different grade of intensity under normal and altered pathological conditions. The presence of c-kit on HCC cell lines supports the assumption that SCF might play a role in the regulation of proliferative activity of tumorous and nontumorous hepatic cells.

Expression of C-Kit Proto-Oncogene in Canine Mastocytoma: A Kinetic Study Using Real-Time Polymerase Chain Reaction

KIT receptor, the c-kit gene product, is thought to play a major role in canine mastocytoma, one of the most common neoplastic diseases in dogs. In the present study, the expression of c-kit proto-oncogene in blood and in tumor biopsies from 41 dogs with histologically confirmed mastocytoma at different grades of cellular differentiation and 5 negative control dogs was investigated using real-time (quantitative) reverse transcription-polymerase chain reaction (RRT-PCR). The animals were followed up for over 1 year after surgery in order to characterize the kinetics of c-kit expression in blood. Transcript mRNAs extracted from blood at different time points after surgery and from tumor tissue surgically removed from each dog were used in a quantitative RRT-PCR assay targeting the extracellular coding region of the c-kit gene. Tissues constitutively expressing c-kit (brain and spleen) were used as positive controls. Levels of expression of c-kit were higher in tumor biopsies than in blood; the blood level decreased in the patients between 1 and 3 months after surgery. No KIT expression was detected in blood from the 5 dogs not affected by mastocytoma (negative controls). The RRT-PCR appears to be a suitable method for sensitive and quantitative detection of c-kit gene expression in canine blood and neoplastic tissues. Although c-kit expression levels measured by RRT-PCR do not correlate with prognosis, they confirm that surgery remains the main treatment to reduce circulating mastocytes and that circulating mast cells can be detected even in benign highly differentiated forms of mastocytoma such as grade I.

Expression of c-kit (CD117) in neuroendocrine tumours - a target for therapy?

C-kit is a tyrosine kinase receptor which is expressed in a wide variety of tumour cells such as gastrointestinal stromal tumours (GISTs), germ cell tumours, malignant trans-formation of mast cells, breast adenocarcinomas, malignant melanomas and small cell lung cancers. Imatinib mesylate is a tyrosine kinase inhibitor initially developed against the bcr-abl fusion protein of CML, but also shows therapeutic inhibitory activity against c-Kit expressed in GISTs. Treatment of patients with neuroendocrine tumours (NETs) at present is limited. Our aim was to test NETs for c-Kit expression and hence identify patients for the consideration of therapy with imatinib mesylate. NET patient specimens (n=85) were assessed for expression of c-KIT proto-oncogene (CD117) by immunohistochemistry using two antibodies, a polyclonal antibody and a monoclonal. Of the samples 24% stained positive with the polyclonal antibody and 64% with the monoclonal antibody. This study highlights problems related to screening using c-kit antibodies for immunocytochemistry. It is possible that the polyclonal antibody is less specific. Studies need to be performed to determine if c-kit expression by NETs can be translated into therapeutic benefit by agents such as imatinib mesylate.

Expression of c-kit protooncogene in human hepatocellular carcinoma

The expression of the c-kit protooncogene in human hepatocellular carcinoma (HCC) was investigated. Immunohistochemical staining (IHC) and RT-PCR were employed to examine the protein and mRNA expression of c-kit protooncogene, respectively. IHC results demonstrated that 22 of 86 (25.6%) HCC tissue sections expressed c-kit protein. The c-kit mRNA transcript was further confirmed in all 22 IHC c-kit positive HCC tissue samples by RT-PCR. Moreover, the relationship between c-kit expression in HCC and prognosis of patients was statistically analyzed and a correlation was established. The group of patients whose HCC specimens showed positive c-kit staining exhibited better survival as compared to those patients with negative c-kit expression ( p=0.021). These results suggest that c-kit expression may be a good prognostic indicator for HCC.

Bone metastasis from epithelial ovarian carcinoma

THE LANCET Oncology Vol 3 August 2002 http://oncology.thelancet.com 513 47 Tu S-M, Reyes A, Troncoso P, et al. Prostate cancer with testicular or penile metastases: clinical, pathological, and immunohistochemical features. Cancer, in press. 48 Arber DA, Tamayo R, Weiss LM. Paraffin section detection of the c-kit gene product (CD117) in human tissues: value in the diagnosis of mast cell disorders. Hum Pathol 1998; 28: 498–504. 49 Strohmeyer T, Reese D, Press M, et al. Expression of c-kit protooncogene and its ligand stem cell factor (SCF) in normal and malignant human testicular tissue. J Urol 1995; 153: 511–15. 50 Natkunam Y, Rouse RV, Zhu S, et al. Immunoblot analysis of CD34 expression in histologically diverse neoplasms. Am J Pathol 2000; 156: 21–27. Personal view Stem-cell origins of cancer

Expression of the c-kit proto-oncogene in rat hepatic allografts during acute rejection.

The role of the c-kit proto-oncogene in organ allograft rejection is not known. We investigated the level of c-kit expression following allogeneic transplantation of ACI rat liver grafts into LEW recipients. We studied c-kit mRNA and protein expression in groups of transplant recipients receiving hepatic isografts, hepatic allografts, or hepatic allografts after donor-specific blood transfusion (DST). Pretransplantation DST significantly prolonged survival of hepatic allografts. Infiltrates expressing c-kit were observed in allografts to untreated rats but not in groups receiving isografts or allografts following DST. Northern analysis also demonstrated abundant c-kit mRNA transcripts in the untreated allograft group in contrast to the isograft and the DST-treated groups. In addition, significantly more transcripts for interleukin-12 (IL-12), which is synergistic with c-kit, were present in untreated than in DST-treated allograft groups. In contrast, transforming growth factor beta (TGF-beta), which inhibits c-kit synthesis, was expressed abundantly in hepatic allografts to DST-treated rats but not in allografts to untreated animals. Transcripts for IL-10, which inhibits IL-12 production, were significantly more plentiful in hepatic allografts following DST than in those without DST. The results suggest that c-kit proto-oncogene expression in infiltrating cells is associated with rat hepatic allograft rejection.

Control of differentiation, transformation, and apoptosis in granulosa cells by oncogenes, oncoviruses, and tumor suppressor genes.

I. Introduction II. Protooncogene Expression and Follicular Cell Development A. Expression of myc, jun, and fos in granulosa cells B. Expression of c-kit protooncogene and its ligand steel/kit in the ovary III. Tumor Suppressor Genes, Death Genes, and Survival Genes in Granulosa Cells A. Expression of Fas antigen and its ligand in the ovary B. Modulation of gene expression IV. Immortalization of Primary Granulosa Cells by Oncogenes and Oncoviruses A. Establishment of immortalized granulosa cells expressing gonadotropin receptors V. Mechanism of Induction of Differentiation in Oncogene-Transformed Cells A. Expression of adrenal 4-binding protein/steroidogenic factor-1 B. Expression of steroidogenic acute regulatory protein C. Expression of sterol carrier protein 2 and the peripheral benzodiazepine receptor D. Induction of steroidogenesis in immortalized granulosa cells E. Expression of inhibin, activin, and follistatin F. Involvement of the cytoskeleton in granulosa cell differentiation, transformation, an...

Expression of c-kit protooncogene is stimulated by cAMP in differentiated F9 mouse teratocarcinoma cells

Protooncogene c-kit, a transmembrane tyrosine kinase receptor, was recently shown to map to the dominant white spotting locus (W) of the mouse. W mutations affect melanogenesis, gametogenesis and hematopoiesis during development and in adult life. In order to determine the regulation of the c-kit gene in cell differentiation, we investigated its expression during the differentiation of F9 cells. Undifferentiated F9 cells and F9 cells treated with retinoic acid (RA) alone or dbcAMP alone showed little expression of c-kit mRNA if any. The subsequent addition of dbcAMP to F9 cells treated with RA markedly increased the expression of c-kit mRNA. Furthermore, the effect of dbcAMP on c-kit expression is reversible. In differentiated cells treated with RA, c-kit gene expression is induced by agents such as forskolin or theophylline, which are known to elevate cellular cAMP level. These results indicate that the expression of the c-kit gene is regulated by the level of intracellular cAMP in differentiated F9 cells induced by RA.