Expected Polymerase Chain Reaction Product Research Articles

Polymorphisms in the promoter regions of RHD and RHCE genes in the Chinese Han population.

The Rh blood group system is the most polymorphic human blood group system. Previous studies have investigated variants in the RHD and RHCE promoter. The relevance of these variants to the Chinese Han population is further clarified in this study. In total, 317 donors (223 Rh D-positive [D+], including 20 Del and 94 Rh D-negative [D-]) were randomly selected. The promoter regions and exon 1 of RHD and RHCE were amplified through polymerase chain reaction (PCR)whose products were directly sequenced using forward and reverse primers. Expected PCR products of the RHD promoter and exon 1 were amplified in 223 D+ individuals, including 20 Del individuals, and were absent in 81 of 94 D- individuals. Expected PCR products of RHCE were observed in all donors. Two single nucleotide variants (SNVs) were observed in the RHD promoter region. Moreover, 11 SNVs were observed in the promoter and exon 1 of RHCE. rs4649082, rs2375313, rs2281179, rs2072933, rs2072932, rs2072931 and rs586178 with strong linkage disequilibria were significantly different between the D+ and D- groups. [A;C] was the most common haplotype in the RHD promoter (NC_000001.11:g.[-1033A>G;-831C>T]). [G;T;T;A;T;A;C;G;A;C;G] was the most predominant haplotype in both total and D- groups. In D+ individuals, [A;C;T;G;C;G;C;G;C;C;C] was the most frequent haplotype in the RHCE promoter (NC_000001.11:g.[-1080A>G;-958C>T;-390T>C;-378G>A;-369C>T;-296G>A;-144C>G;-132G>A;-122C>A;28C>T;48C>G]). We speculate that the SNVs/haplotypes found in this article cannot significantly affect gene expression. The present study findings should help elucidate the molecular basis of the polymorphic expression of RHD and RHCE promoter regions.

Development and Characterization of Expressed Sequence-tagged Simple Sequence Repeat Markers for Denphal-type Dendrobium Cultivars and Transferability to Dendrobium Species

Denphal-type Dendrobium is the most popular orchid for cut flower and potted plant trade. To improve commercial traits, many novel cultivars have been produced through hybridization by commercial breeders. However, the genetic relationship of most cultivars is unclear, thus hindering the progress of Denphal-type Dendrobium breeding programs. Therefore, the development of molecular markers is encouraged to identify different cultivars. In this study, based on the transcriptome database of the Denphal-type Dendrobium ‘Red Bull’, the polymorphisms expressed sequence tag-derived simple sequence repeat (EST-SSR) were developed from 100 pairs EST-SSRs that were randomly selected from the EST-SSR database. The genetic relationship of 42 Denphal-type Dendrobium cultivars was analyzed according to the developed EST-SSRs. Then, the transferability of EST-SSRs was analyzed by performing a relationship analysis of 40 Dendrobium species. The results showed that a total of 5174 potential EST-SSR markers were identified with 4486 unigene sequences, and 5289 primer pairs were successfully designed. Of the selected 100 pairs of EST-SSRs, a total of 86 pairs produced the expected polymerase chain reaction products of the primary screening, 58 pairs produced the expected fragment size, and 20 pairs showed polymorphisms. Furthermore, the dendrogram of 42 cultivars showed that at a genetic distance of 0.15, the cultivars collected were grouped into five clusters of three major clusters and two minor clusters; all these clusters had the same characters of each cluster. The transferability analysis showed that 18 of the 20 EST-SSR markers among the 40 Dendrobium species were polymorphic. Overall, this study developed EST-SSR markers and will be valuable to facilitating genetic diversity in Denphal-type Dendrobium cultivars and Dendrobium species.

Molecular Authentication of Twelve Meat Species Through a Promising Two-Tube Hexaplex Polymerase Chain Reaction Technique.

Frequent meat frauds have aroused significant social attention. The aim of this study is to construct a two-tube hexaplex polymerase chain reaction (PCR) method offering accurate molecular authentication of twelve meat species in actual adulteration event. Deoxyribonucleic acid (DNA) sequencing demonstrates that designed primers can specifically amplify target species from genomic DNA mixture of six species in each tube reaction, which showed 100% accuracy of horse (148 bp), pigeon (218 bp), camel (283 bp), rabbit (370 bp), ostrich (536 bp), and beef (610 bp) as well as turkey (124 bp), dog (149 bp), chicken (196 bp), duck (277 bp), cat (380 bp), and goose (468 bp). A species-specific primer pair produced the target band in the presence of target genomic DNA but not non-target species. Through multiplex PCR assays with serial concentration of the DNA mixture of six species in each PCR reaction, the detection limit (LOD) of the two-tube hexaplex PCR assay reached up to 0.05–0.1 ng. Using genomic DNA isolated from both boiled and microwave-cooked meat as templates, PCR amplification generated expected PCR products. These findings demonstrate that the proposed method is specific, sensitive and reproducible, and is adequate for food inspection. Most importantly, this method was successfully applied to detect meat frauds in commercial meat products. Therefore, this method is of great importance with a good application foreground.

First Report of Cucurbit aphid-borne yellows virus Infecting Cucurbita pepo in Oklahoma

A survey of cucurbit fields was conducted in the September 2017 growing season in Oklahoma. A total of 121 symptomatic leaf samples (103 from pumpkin and 18 from squash) showing mosaic, mottling, and chlorosis and 10 asymptomatic samples from pumpkin (Cucurbita pepo) were collected from grower’s fields located in various counties. All samples were tested against the polyclonal antisera (AC Diagnostics, Fayetteville, AR) of 10 known cucurbit-infecting viruses including Papaya ringspot virus (PRSV), Watermelon mosaic virus (WMV), Zucchini mosaic virus (ZYMV), and Cucurbit aphid-borne yellows virus (CABYV, genus Polerovirus, family Luteoviridae) by dot-immunobinding assay (DIBA) as described previously (Ali et al. 2012). Eleven out of 121 symptomatic samples (eight samples from Blaine County and three from Payne County) of pumpkin reacted positively against the antisera of CABYV by DIBA, and the remaining samples were positive to WMV, PRSV, and ZYMV. None of the asymptomatic samples were positive against the 10 viruses in the DIBA. To further confirm the CABYV infection in these pumpkin samples, four of the eleven CABYV-DIBA-positive pumpkin samples (one from Payne County and three from Blaine County) were randomly selected, and total RNA was extracted using TRI reagent (Molecular Research). Reverse transcription polymerase chain reaction (PCR) was carried out using a pair of primers (CABYV-CP-F, 5′-ATGAATACGGCCGCGGCTAGAAATC-3′; CABYV-CP-R, 5′-CTATTTCGGGTTCTGGACCTGGCA-3′) that are specific to the coat protein (CP) gene of CABYV (Choi et al. 2015). Expected PCR products of approximately 600 bp were observed in all four Oklahoma samples (designated as isolates BL-4, BL-8, BL-45, and PY-46) when PCR products were analyzed on 1% agarose gel electrophoresis. An aliquot (5 µl) of PCR product from each sample was cleaned with 2 µl of ExoSAP-IT (Affymetrix). The cleaned PCR products were directly sequenced using ABI sequencer (3130XL genetic analyzer, Hitachi) at the core facility in the Department of Biological Science, University of Tulsa. The complete sequence of the CP gene of all four Oklahoma CABYV isolates (accession nos. MG590258, MG590259, MG590260, and MG590261) showed sequence identities from 98.0 to 98.3% with CABYV isolates from China (accession no. EU636992) and South Korea (accession no. KR231959) using the BLASTn algorithm, and the sequence identity among the four Oklahoma CABYV isolates ranged from 99.6 to 99.8%. Our results indicate the first report of CABYV infecting cucurbits in Oklahoma. CABYV was first described in France in 1992 (Lecoq et al. 1992), and in the United States it was first reported in California in 1993 (Lemaire et al. 1993). Cucurbits are economically important cash crops worldwide; therefore, the presence of CABYV poses a threat for cucurbit production in Oklahoma.

Nested-PCR assay for detection of Schistosoma japonicum infection in domestic animals

BackgroundSchistosomiasis japonica is a common zoonosis. Domestic animals are the primary source of infection and play an important role in disease transmission. The prevalence and infectivity of this disease in domestic animals in China have significantly decreased and, for this reason, diagnostics with a higher sensitivity have become increasingly necessary. It was reported that polymerase chain reaction (PCR)-based methods could be used to detect schistosome infection in humans and animals and presented a high sensitivity and specificity. The present study aimed to develop a PCR-based method for detection of Schistosoma japonicum infection in domestic animals.MethodsA specific nested-PCR assay was developed to detect S. japonicum infection in domestic animals via amplification of a 231-bp DNA fragment of retrotransposon SjR2. The developed assay was first used in sera and dry blood filter paper (DBFP) from goats and buffaloes at different time points of infection. Then, 78 DBFPs from 39 artificially-infected bovines at 14 and 28 days post-infection and 42 DBFPs from schistosome-negative bovines from the city of Huangshan in the Anhui province were used to evaluate the diagnostic validity. Furthermore, this assay was used to detect S. japonicum infection in domestic animals in Dongzhi and Wangjiang counties.ResultsThe expected PCR product was detected in eggs and adult worms of S. japonicum and blood samples from S. japonicum-infected goats and water buffaloes, but not from Fasciola and Haemonchus contortus worms. The nested-PCR assay could detect the target S. japonicum DNA in DBFPs from goats and buffaloes after day 3 post-infection. The sensitivity in buffaloes at 14 and 28 days post-infection was 92.30% (36/39) and 100% (39/39), respectively. The specificity was 97.60% (41/42). The positivity rates in Dongzhi and Wangjiang counties were 6.00% and 8.00% in bovines and 22.00% and 16.67% in goats, respectively. The positivity rates in goats in both counties were higher than those in bovines with a significant difference in Dongzhi County but not in Wangjiang County (P < 0.05 and P = 0.23, respectively).ConclusionsOur results suggest that the developed nested-PCR assay may be used for the diagnosis of S. japonicum infection in domestic animals, and the control of S. japonicum infection in goats should be paid more attention.

Prevalence and molecular epidemiology of porcine cysticercosis in naturally infected pigs (Sus scrofa) in Punjab, India.

Porcine cysticercosis is a serious zoonosis in resource-poor countries. Despite the evidence showing that the disease is endemic in the Punjab region of India, molecular characterisation of Taenia solium cysticercosis from naturally infected pigs has not been carried out. The authors examined a total of 519 pigs slaughtered in small slaughter shops (shops that sell meat from animals that are slaughtered on the premises as the customer waits) in the urban slums of Punjab state in northern India. The expected polymerase chain reaction products with molecular sizes of 286 bp, 420 bp, 1150 bp and 333 bp corresponding to the targeted large subunit ribosomal RNA (rRNA), cytochrome oxidase 1, internal transcribed spacer 1, and diagnostic antigen Ts14 genes, respectively, were amplified from the cysts collected from all 22 infected carcasses. The detection limits for the respective primers (except those targeting the Ts14 gene) were estimated. The analytical sensitivities of both the TBR and JB primers (targeting the rRNA and cytochrome oxidase genes, respectively) were found to be higher (10 pg) than that of the internal transcribed spacer 1 gene (1 ng) primers. Ten representative samples from cytochrome oxidase 1 gene amplified products were sequenced in both directions for phylogenetic analysis. Sequencing demonstrated that all cysticerci were of the Asian genotype of T. solium and not of the African/Latin American genotype or T. asiatica. The results confirm the presence of T. solium porcine cysticercosis in Punjab state and there is therefore an urgent need for science-based policies for prevention and control of this serious zoonosis.

Halal authenticity of gelatin using species-specific PCR

Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients.

First detection of Arcobacter sp. in Eurasian collared doves (Streptopelia decaocto).

Data about the presence of Arcobacter in wild birds are currently lacking. In this study cloacal swabs from 95 collared doves (Streptopelia decaocto), submitted to the Department of Veterinary Medical Sciences (Bologna, Italy) between 2011 and 2013 from various urban and suburban areas of the Emilia-Romagna region (Northern Italy), were tested for the presence of Arcobacter sp. by a rRNA 23S nested Polymerase Chain Reaction (PCR). Eighteen out of 95 (19%) samples showed the expected PCR product. Further cultural and molecular studies are needed to assess the Arcobacter prevalence in wild birds and elucidate their potential epidemiological role as source of animal and human infections.

Molecular characterization of African swine fever virus from domestic pigs in northern Tanzania during an outbreak in 2013.

African swine fever (ASF) is an acute, highly contagious and deadly viral hemorrhagic fever of domestic pigs caused by African swine fever virus (ASFV), a double-stranded DNA virus of the family Asfarviridae. In this study, molecular diagnosis and characterization of outbreak ASFV in northern Tanzania, was performed on spleen, lymph node, kidney, and heart samples collected in June and July 2013 from domestic pigs that died during a hemorrhagic disease outbreak. Confirmatory diagnosis of ASF was performed using polymerase chain reaction (PCR) by partial amplification of B646L gene of ASFV encoding the major capsid protein p72 using PPA1/PPA2 primers. PCR using PPA1/PPA2 primers produced an expected PCR product size, confirming ASF outbreak in northern Tanzania. In addition, nucleotide amplification and sequencing, and phylogenetic reconstruction of the variable 3′-end of the B646L gene and complete E183L gene encoding the inner envelope transmembrane protein p54 showed that the 2013 outbreak ASFV from northern Tanzania were 100 % identical and clustered into ASFV B646L (p72) and E183L (p54) genotype X. Furthermore, the tetrameric amino acid repeats within the central variable region (CVR) of the B602L gene coding for the J9L protein had the signature BNBA(BN)5NA with a single novel tetramer NVDI (repeat code N). The results of the present study confirm an ASF outbreak in northern Tanzania in the year 2013 and show that the present outbreak ASFV is closely related to other ASFV from ticks, warthogs, and domestic pigs previously reported from Tanzania.

Identification of a novel herpesvirus associated with cutaneous ulcers in a fisher (Martes pennanti)

On December 8, 2008, a male fisher (Martes pennanti) housed in a quarantine enclosure at the St-Félicien Zoo was found dead with multiple skin ulcers on the muzzle and plantar pads. At necropsy, no major findings were found, and a specific cause of death was not determined microscopically. However, at the borders of ulcerated sites, there were increased numbers of koilocytes, with perinuclear vacuolation and nuclear enlargement. A pan-herpesvirus nested polymerase chain reaction (PCR) assay was conducted, and an expected PCR product of 230 nucleotides was obtained within tissues collected from around the skin ulcers. Other tissues, including intestines and pool of lung, liver, and kidney, tested negative. The obtained PCR amplicon was sequenced and was highly related to the partial viral DNA polymerase (DPOL) gene of Mustelid herpesvirus 1. Virus isolation was negative, and no virion was detected by electron microscopy. The pathogenic potential of this novel herpesvirus and its role in the death of the fisher are unknown.

Characterization of reticuloendotheliosis virus isolates obtained from broiler breeders, turkeys, and prairie chickens located in various geographical regions in the United States

Nine reticuloendotheliosis virus (REV) isolates obtained from broiler breeders, turkeys, and prairie chickens located in three different geographical regions in the USA, and three isolates obtained from known contaminated live-virus vaccines were characterized using polymerase chain reaction (PCR) and indirect immunofluorescence (IFA) assays. All isolates were propagated in chicken embryo fibroblasts obtained from a specific pathogen free breeder flock. PCR analysis of all 12 isolates resulted in the amplification of the 291-bp REV long-terminal repeat region (LTR); none of the isolates exhibited a different pattern or shift from the expected PCR product of REV LTR. The subtype of the REV isolates was determined by IFA using REV-specific monoclonal antibodies, 11B118.22, 11C237.8, and 11D182. Results from sub-typing indicated that all nine isolates from broiler breeders, turkeys, and prairie chickens belonged to subtype 3, and are antigenically related to the chick syncytial virus (CSV) strain of REV, the prototype of subtype 3 REV. In contrast, the three isolates from contaminated vaccines were classified as subtype 2, and were antigenically related to spleen necrosis virus (SNV) strain of REV, the prototype of subtype 2 REV. Three isolates representing REV isolated from broiler breeders, turkeys, and prairie chickens were cloned and further evaluated by DNA sequence analysis of the envelope gene. Results from DNA sequence analysis confirmed those from sub-typing and indicated that the three REV isolates representing those from broiler breeders, turkeys, and prairie chickens are closely related to CSV of REV, with an amino acid homology of 98% or greater as compared with SNV with an amino acid homology of 95% or less. Data from this study clearly indicate that subtype 3 is the most common subtype of REV circulating in three different avian species, namely broiler breeders, turkeys and prairie chickens, located in three different geographical regions in the United States.

Molecular Characterization of Aster Yellows Phytoplasma Associated with Valerian and Sowthistle Plants by PCR–RFLP Analyses

AbstractIn Alberta, Canada, valerian grown for medicinal purposes and sowthistle, a common weed, showed typical aster yellows symptoms. Molecular diagnosis was made using a universal primer pair (P1 / P7) designed to amplify the entire 16S rRNA gene and the 16 / 23S intergenic spacer region in a direct polymerase chain reaction (PCR) assay. This primer pair amplified the DNA samples from valerian and sowthistle and reference controls (AY‐27, CP, PWB, AY of canola, LWB). They produced the expected PCR products of 1.8 kb, which were diluted and used as templates in a nested PCR. Two primer pairs R16F2n / R2 and P3 / P7 amplified the DNA templates giving PCR products of 1.2 and 0.32 kb, respectively. No PCR product was obtained with either set of primers and DNA isolated from healthy plants. Restriction fragment length polymorphism (RFLP) was used to analyse the partial 16S rDNA sequences (1.2 kb) of all phytoplasma DNA samples after restriction with four endonucleases (AluI, HhaI, MseI and RsaI). The restriction patterns of these strains were found to be identical with the RFLP pattern of the AY phytoplasma reference control (AY‐27 strain). Based on the RFLP data, the two strains are members of subgroup A of the AY 16Sr1 group. We report here the first molecular study on the association of AY phytoplasmas with valerian and sowthistle plants.

Detection of a novel spotted fever group rickettsia in Amblyomma parvum ticks (Acari: Ixodidae) from Argentina

The present study evaluated the rickettsial infection in Amblyomma parvum ticks collected in Northwestern Córdoba Province, Argentina. Each tick was subjected to DNA extraction and tested by polymerase chain reaction (PCR) targeting fragments of the rickettsial genes gltA and ompB. Nine (69.2%) out of 13 adult ticks yielded expected PCR products for the two rickettsial genes. Products from the ompB PCR were sequenced, generating DNA sequences 100% identical for the nine PCR-positive ticks. Three of these ticks were tested in another battery of PCR targeting fragments of the rickettsial genes gltA, htrA, and ompA. Products from the gltA, htrA, and ompA PCRs were sequenced generating DNA sequences 100% identical for the three PCR-positive ticks. The rickettsia detected in the A. parvum ticks was designated as Rickettsia sp. strain Argentina. Phylogenetic analyses performed with partial sequences of the rickettsial genes gltA, htrA, ompB, and ompA showed that Rickettsia sp. strain Argentina belonged to the spotted fever group, being distinct from all known Rickettsia species and genotypes available in GenBank, representing possibly a new Rickettsia species. This was the first evidence of rickettsial infection in the tick A. parvum, and the third report of rickettsial infection among the Argentinean tick fauna. The role of Rickettsia sp. strain Argentina as a human pathogen is unknown. Further studies are needed to obtain tissue-cultured isolates of Rickettsia sp. strain Argentina, in order to better characterize it and to determine its taxonomic status as a new species.

Detection of recombinant DNA of genetically modified (GM) soybeans in heat-treated GM soybeans and commercial natto

We examined the detection of recombinant DNA of genetically modified (GM) soybeans in heat-treated GM soybeans and commercial natto. Genomic DNA was extracted from heat-treated GM soybeans and natto using the cetyltrimethylammonium bromide (CTAB) or alkaline lysis methods. First, primer pairs amplifying the junction region between CTP and CP4EPSPS in recombinant soybean were designed; they gave PCR products of band sizes, 100, 110, 120, 130, 140, and 150 bp. When DNA solution extracted from heat-treated GM soybeans by the alkaline lysis method was applied to polymerase chain reaction (PCR), PCR products of the expected 100, 110, 120, 130, 140, and 150 bp were detected by agarose gel electrophoresis. However, PCR products were not detected in DNA extracted from heat-treated GM soybeans by the CTAB method, and no PCR products were detected in either extract from natto. Next, PCR using primer pairs amplifying the junction region between NOS and part of CP4EPSPS were designed; they gave PCR products of 100, 110, 120, 130, 140, and 150 bp. The expected PCR products from all DNA extracts were detected (heat-treated GM soybeans by CTAB, 100–140 bp; heat-treated GM soybeans by alkaline lysis, 100–150 bp; natto by CTAB, 100–130 bp; and natto by alkaline lysis, 100–150 bp). These results indicate that judicious selection of DNA extraction methods and target sequences is important to detect DNA from natto and recombinant DNA can be detected in natto.

Temperate and lytic cyanophages from the Gulf of Mexico

The unicellular cyanobacterial species Synechococcus and Prochlorococcus are known to be vital components of marine ecosystems, especially in the vast oligotrophic areas. Lytic cyanophages infecting unicellular phytoplankton are prevalent and have been demonstrated to act as important constraints on community composition contributing to the seasonal succession in genotypes. Lysogeny in Synechococcus has been documented experimentally in natural environments by prophage induction. At this time it is completely unknown how prevalent lysogeny is among Synechococcus populations. This study was performed to document important features such as size, morphology and the incidence of the T4-like capsid portal protein gene (g20) in a group of lytic Synechococcus cyanophages (35 isolates) isolated from the Gulf of Mexico. A group of Synechococcus isolates (24 strains) were isolated concurrently to investigate the virulence and cross-infectivity of the lytic cyanophages and to determine the frequency of lysogeny by detection of inducible prophage. The host range of the cyanophages toward these Synechococcus strains ranged from 1 of 25 (host of isolation only) to 17 of 25 (68%). Of the 35 cyanophage isolates the large majority were myoviruses (94%) and only two (6%) were of the podovirus type. The expected polymerase chain reaction product for g20 was detected in 20 of the phages (63%). The presence of a detectable g20 was associated with low-infectivity cyanophages at the 90% confidence interval. The Synechococcus strains varied in their resistance to lytic infection from 11% to resistance to all of the phage isolates utilized in testing. The prevalence of inducible prophage-like particles was determined in the Synechococcus strains using mitomycin C and enumerating viruses by epifluorescence microscopy. A statistically significant increase in viruses was detected in 11 of the strains (46%) in response to mitomycin C. There was no observed relationship between the occurrence of prophage induction in the Synechococcus isolates and their resistance to lytic infection. One putative lysogen was induced by continuous high light and contained a prophage-like particle with a single-stranded DNA (ssDNA) genome. Such a prophage-like particle is unlike any prophage described to date, implying that the process of lysogeny is unique in certain marine Synechococcus strains.

First Report of Tomato yellow leaf curl virus in South Carolina.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5'GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5'GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of "across-state" distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

An approach for producing transgenic cloned cows by nuclear transfer of cells transfected with human alpha 1-antitrypsin gene

In an attempt to produce transgenic cloned cows secreting alpha 1-antitrypsin (α1-AT) protein into milk, bovine cumulus cells were transfected with a plasmid containing an α1-AT gene and green fluorescent protein (GFP) reporter gene using Fugene 6 ® as a lipid carrier. The GFP-expressing cells were selected and transferred into enucleated bovine oocytes. Couplets were fused, chemically activated and cultured. Developmental competence was monitored and the number of inner cell mass (ICM) and trophectoderm (TE) cells in blastocysts were counted after differential staining. The percentage of blastocysts was lower ( P < 0.05) in transgenic cloned embryos compared to non-transgenic cloned embryos (23% versus 35%). No difference in the numbers of ICM and TE cells between the two groups of embryos was observed. One or two GFP-expressing blastocysts were transferred into the uterus of each recipient cow. Out of 49 recipient cows, three pregnancies were detected by non-return estrus and rectal palpation. However, the pregnancies failed to maintain to term; two fetuses were aborted at Day 60 and 150, respectively, and one fetus at Day 240. The genomic DNA from the aborted fetus was amplified by polymerase chain reaction (PCR) to investigate integration of the transgene in the fetus. The expected PCR product was sequenced and was identical to the sequence of α1-AT transgene. In conclusion, the present study demonstrated that developmental competence of cloned embryos derived from transgenic donor cells was lower than embryos derived from non-transfected donor cells. Although we failed to obtain a viable transgenic cloned calf, integration of α1-AT gene into the fetus presents the possibility of producing transgenic cloned cows by somatic cell nuclear transfer.

Rapid Identification of Potato Scab Causing Streptomyces spp. Using Pathogenicity Specific Primers

The potato scab is caused by several species of Streptomyces. Among these species, only pathogenic strains were found to produce thaxtomin A characterized by necrotic bioassay and HPLC. In this study, identification of the pathogenic strains of Streptomyces was performed through the polymerase chain reaction (PCR) by using specific pathogenicity primer sets derived from the nec1 gene sequences of Streptomyces scabies. The expected PCR products were obtained approximately 580 bp and confirmed by sequencing. This PCR technique can be used effectively to identify the pathogenic Streptomyces species, that cause scab on potato tubers.

Prevalence of Toxoplasma gondii in commercial meat products as monitored by polymerase chain reaction – food for thought?

DNA was extracted from 71 meat samples obtained from UK retail outlets. All of these DNA preparations gave the expected polymerase chain reaction products when amplified with primers specific for the species from which the meat originated. A second polymerase chain reaction analysis, using primers specific for the Toxoplasma gondii SAG2 locus, revealed the presence of this parasite in 27 of the meat samples. Restriction analysis and DNA sequencing showed that 21 of the contaminated meats contained parasites genotyped as type I at the SAG2 locus, whilst six of the samples contained parasites of both types I and II. Toxoplasma- positive samples were subjected to further polymerase chain reaction analysis to determine whether any carried an allele of the dihydropteroate synthase gene that has recently been shown to be causally associated with sulfonamide resistance in T. gondii. In all cases, this analysis confirmed that parasites were present in the samples and, additionally, revealed that none of them carried the drug-resistant form of dihydropteroate synthase. These results suggest that a significant proportion of meats commercially available in the UK are contaminated with T. gondii. Although none of the parasites detected in this study carried the sulfonamide-resistance mutation, a simplified procedure for monitoring this situation merits development.

Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods

In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.