Imino Proton Exchange Rates Research Articles

Impact of 3-deazapurine nucleobases on RNA properties.

Deazapurine nucleosides such as 3-deazaadenosine (c3A) are crucial for atomic mutagenesis studies of functional RNAs. They were the key for our current mechanistic understanding of ribosomal peptide bond formation and of phosphodiester cleavage in recently discovered small ribozymes, such as twister and pistol RNAs. Here, we present a comprehensive study on the impact of c3A and the thus far underinvestigated 3-deazaguanosine (c3G) on RNA properties. We found that these nucleosides can decrease thermodynamic stability of base pairing to a significant extent. The effects are much more pronounced for 3-deazapurine nucleosides compared to their constitutional isomers of 7-deazapurine nucleosides (c7G, c7A). We furthermore investigated base pair opening dynamics by solution NMR spectroscopy and revealed significantly enhanced imino proton exchange rates. Additionally, we solved the X-ray structure of a c3A-modified RNA and visualized the hydration pattern of the minor groove. Importantly, the characteristic water molecule that is hydrogen-bonded to the purine N3 atom and always observed in a natural double helix is lacking in the 3-deazapurine-modified counterpart. Both, the findings by NMR and X-ray crystallographic methods hence provide a rationale for the reduced pairing strength. Taken together, our comparative study is a first major step towards a comprehensive understanding of this important class of nucleoside modifications.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Influence of the Absolute Configuration of NPE‐Caged Cytosine on DNA Single Base Pair Stability

Photolabile protecting groups are a versatile tool to trigger reactions by light irradiation. In this study, we have investigated the influence of the absolute configuration of the 1-(2-nitrophenyl)ethyl (NPE) cage group on a 15-base-pair duplex DNA. Using UV melting, we determined the global stability of the unmodified and the selectively (S)- and (R)-NPE-modified DNA sequences, respectively. We observe a differently destabilizing effect for the two NPE stereoisomers on the global stability. Analysis of the temperature dependence of imino proton exchange rates measured by NMR spectroscopy reveals that this effect can be attributed to decreased base pair stabilities of the caged and the 3'-neighbouring base pair, respectively. Furthermore, our NMR based structural models of the modified duplexes provide a structural basis for the distinct effect of the (S)- and the (R)-NPE group.

Hydrogen Exchange Study of DNA Duplexes Containing the Consensus Binding Site for Arabidopsis thaliana SPL14 Transcription Factor

To understand the DNA binding mechanism ofAtSPL14 protein, the imino proton exchange rates weremeasured for the DNA duplex containing the consensusDNA-binding site for the AtSPL14 transcription factor(referred to as wt-SPL14 duplex, Fig. 1). To further under-stand the correlation between the base pair stability/dynamicsand DNA binding affinity of the AtSPL14, the exchange rateconstants of the imino protons for the wt-SPL14 duplexwere compared with those of the mutant SPL14 duplexes(see Fig. 1), which display different binding affinities forAtSPL14 protein. Experimental SectionAll DNA oligonucleotides were purchased from M-bio-tech Co. (Seoul, Korea). The oligonucleotides were purifiedby reverse-phase HPLC and desalted by Sephadex G-25 column.DNA duplexes were prepared by dissolving two strands at a1:1 stoichiometric ratio in an NMR buffer (90% H

Individual Basepair Stability of DNA and RNA Studied by NMR-Detected Solvent Exchange

In this study, we have optimized NMR methodology to determine the thermodynamic parameters of basepair opening in DNA and RNA duplexes by characterizing the temperature dependence of imino proton exchange rates of individual basepairs. Contributions of the nuclear Overhauser effect to exchange rates measured with inversion recovery experiments are quantified, and the influence of intrinsic and external catalysis exchange mechanisms on the imino proton exchange rates is analyzed. Basepairs in DNA and RNA have an approximately equal stability, and the enthalpy and entropy values of their basepair dissociation are correlated linearly. Furthermore, the compensation temperature, Tc, which is derived from the slope of the correlation, coincides with the melting temperature, and duplex unfolding occurs at that temperature where all basepairs are equally thermodynamically stable. The impact of protium-deuterium exchange of the imino hydrogen on the free energy of RNA basepair opening is investigated, and it is found that two A·U basepairs show distinct fractionation factors.

Long Lifetime of Hydrogen-Bonded DNA Basepairs by Force Spectroscopy

Electron-tunneling data suggest that a noncovalently-bonded complex of three molecules, two recognition molecules that present hydrogen-bond donor and acceptor sites via a carboxamide group, and a DNA base, remains bound for seconds. This is surprising, given that imino-proton exchange rates show that basepairs in a DNA double helix open on millisecond timescales. The long lifetime of the three-molecule complex was confirmed using force spectroscopy, but measurements on DNA basepairs are required to establish a comparison with the proton-exchange data. Here, we report on a dynamic force spectroscopy study of complexes between the bases adenine and thymine (A-T, two-hydrogen bonds) and 2-aminoadenine and thymine (2AA-T, three-hydrogen bonds). Bases were tethered to an AFM probe and mica substrate via long, covalently linked polymer tethers. Data for bond-survival probability versus force and the rupture-force distributions were well fitted by the Bell model. The resulting lifetime of the complexes at zero pulling force was ∼2 s for two-hydrogen bonds (A-T) and ∼4 s for three-hydrogen bonds (2AA-T). Thus, DNA basepairs in an AFM pulling experiment remain bonded for long times, even without the stabilizing influence of base-stacking in a double helix. This result suggests that the pathways for opening, and perhaps the open states themselves, are very different in the AFM and proton-exchange measurements.

NMR Study of Hydrogen Exchange in the DNA Decamer Duplexes Containing the -10 galP1 Promoter Sequence

Most Escherichia coli promoters are consists of two 6-bp sequence elements which are centered at ~10 and 35 nucleotides upstream of the transcription initiation point. The conserved region 4.2 and 2.4 of the RNA polymerase σ subunit recognize −10 and −35 promoter elements, respectively. The open complex between σ subunit and promoter elements, in which the promoter DNA is locally melted, is competent to initiate RNA synthesis according to the DNA sequence of template strand. Promoter opening is temperature-dependent; the most −10/−35 promoter complexes display closed forms below 15 C, whereas promoter complexes on the extended −10 galP1 promoter remain open at 5 C. The reason for this unusual behavior of the −10 galP1 promoter is not completely understood. The conserved A·T base pair at the −11 position of the promoters plays very important role in the initiation of E. coli transcription. The in vitro transcription with the −10 galP1 promoter was not initiated when this A base was substituted to other bases. To understand the function of the A-11 base in the transcription initiation process, the imino proton exchange rates were measured for the DNA decamer duplex containing the wild-type −10 galP1 promoter sequence (position: −14 ~ −5) (referred to as wt galP1, Fig. 1). The exchange rate constants of the imino protons for the wt galP1 duplex were compared with those of the modified galP1 promoters at the −11 position (see Fig. 1). This comparison indicates that some differences in the base pair dynamics are correlated with function of the −10 galP1 promoter during transcription initiation.

Enhanced Base-Pair Opening in the Adenine Tract of a RNA Double Helix

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the kinetics and energetics of base-pair opening in two nucleic acid double helices. One is the RNA duplex 5'-r(GCGAUAAAAAGGCC)-3'/5'-r(GGCCUUUUUAUCGC)-3', which contains a central tract of five AU base pairs. The other is the homologous DNA duplex with a central tract of five AT base pairs. The rates and the equilibrium constants of the opening reaction of each base pair are measured from the dependence of the exchange rates of imino protons on ammonia concentration, at 10 °C. The results reveal that the tract of AU base pairs in the RNA duplex differs from the homologous tract of AT base pairs in DNA in several ways. The rates of opening of AU base pairs in RNA are high and increase progressively along the tract, reaching their largest values at the 3'-end of the tract. In contrast, the opening rates of AT base pairs in DNA are much lower than those of AU base pairs. Within the tract, the largest opening rate is observed for the AT base pair at the 5'-end of the tract. These differences in opening kinetics are paralleled by differences in the stabilities of individual base pairs. All AU base pairs in the RNA are less stable than the AT base pairs in the DNA. The presence of the tract enhances these differences by increasing the stability of AT base pairs in DNA while decreasing the stability of AU base pairs in RNA. Due to these divergent trends, along the tracts, the AU base pairs become progressively less stable than AT base pairs. These findings demonstrate that tracts of AU base pairs in RNA have specific dynamic and energetic signatures that distinguish them from similar tracts of AT base pairs in DNA.

Studying base pair open–close kinetics of tRNA Leu by TROSY-based proton exchange NMR spectroscopy

The millisecond conformational flexibility is functionally important for nucleic acids and can be studied through probing the base pair open–close kinetics by proton exchange nuclear magnetic resonance (NMR) spectroscopy. Here, the traditional imino proton exchange NMR experiments were modified with transverse relaxation optimized spectroscopy and were applied to accurately measure imino proton exchange rates of all base pairs in Escherichia coli tRNA Leu (CAG), and their dependence on magnesium ion concentration. Finally, we correlated millisecond conformational flexibility with aminoacylation of tRNA Leu and proposed that the flexibility of the acceptor stem and the core region might contribute to aminoacylation of tRNA Leu.

Direct observation of the temperature-induced melting process of the Salmonella fourU RNA thermometer at base-pair resolution.

In prokaryotes, RNA thermometers regulate a number of heat shock and virulence genes. These temperature sensitive RNA elements are usually located in the 5′-untranslated regions of the regulated genes. They repress translation initiation by base pairing to the Shine–Dalgarno sequence at low temperatures. We investigated the thermodynamic stability of the temperature labile hairpin 2 of the Salmonella fourU RNA thermometer over a broad temperature range and determined free energy, enthalpy and entropy values for the base-pair opening of individual nucleobases by measuring the temperature dependence of the imino proton exchange rates via NMR spectroscopy. Exchange rates were analyzed for the wild-type (wt) RNA and the A8C mutant. The wt RNA was found to be stabilized by the extraordinarily stable G14–C25 base pair. The mismatch base pair in the wt RNA thermometer (A8–G31) is responsible for the smaller cooperativity of the unfolding transition in the wt RNA. Enthalpy and entropy values for the base-pair opening events exhibit linear correlation for both RNAs. The slopes of these correlations coincide with the melting points of the RNAs determined by CD spectroscopy. RNA unfolding occurs at a temperature where all nucleobases have equal thermodynamic stabilities. Our results are in agreement with a consecutive zipper-type unfolding mechanism in which the stacking interaction is responsible for the observed cooperativity. Furthermore, remote effects of the A8C mutation affecting the stability of nucleobase G14 could be identified. According to our analysis we deduce that this effect is most probably transduced via the hydration shell of the RNA.

Imino proton exchange rates imply an induced-fit binding mechanism for the VEGF 165-targeting aptamer, Macugen

The 2′-fluoro/2′- O-methyl modified RNA aptamer Macugen is a potent inhibitor of the angiogenic regulatory protein, VEGF 165. Macugen binds with high affinity to the heparin-binding domain (HBD) of VEGF 165. Hydrogen exchange rates of the imino protons were measured for free Macugen and Macugen bound to the HBD or full-length VEGF to better understand the mechanism for high affinity binding. The results here show that the internal loop and hairpin loop of Macugen are highly dynamic in the free state and are greatly stabilized and/or protected from solvent upon protein binding.

Hydrogen Exchange Rates of the DNA Oligomer Duplex, d[CGCGCGCCATAAC]/d[GTTATGGCGCGCG] Determined by NMR Spectroscopy

The measurement of hydrogen exchange rates has been an important tool for studying the macromolecular conformation or dynamics. The imino proton resonances of nucleic acids are good probes of the hydrogen exchange study for studying the dynamics of each base pair. The exchange rates of imino protons depend on not only the base pair stability but also solvent accessibility. Hydrogendeuterium (H/D) exchange method is widely used to measure the exchange rates of slowly exchanging imino protons, whereas the exchange rates of fast-exchanging imino protons can be determined by water magnetization transfer method of NMR. NMR hydrogen exchange experiment can provide the information on the thermodynamics and kinetics for basepair opening in the nucleic acids. Lots of results of these experiments determined in various DNAs, RNAs and DNA-protein complexes were reported. Analysis of the hydrogen exchange of imino protons generally was based in the two-state (open/closed) model for the base pair where hydrogen exchange only occurs from the open state. The opening/closing rate constants and/or equilibrium constant for base-pair opening can often be determined by measuring the exchange as a function of the concentration of external catalysts such as ammonia or TRIS. Left-handed Z-DNA is a higher-energy form of the double helix produced at an alternating CG sequence region and is stabilized by high salt concentration or negative super-coiling. Recently, X-ray crystal structure of the B-Z junction induced by the Z-DNA binding protein, where the alternating CGCGCG exhibited left-handed Z-DNA whereas a nonalternating AT-rich region maintained B-form helix, was reported. They also found the continuous stacking of bases between B-DNA and Z-DNA segments with the breaking of one base pair at the junction. This result indicates that the one base pair at the B-Z junction should be destabilized and then its bases might be extruded to allow the B-Z conformational change at the CGCGCG region. Here, we measured the imino proton exchange rates for a bzDNA-13 DNA duplex formed by an 15-nt bzA-15mer, d[GTCGCGCGCCATAAC] and a 13-nt bzB-13mer, d[GTTATGGCGCGCG] (Fig. 1A) by water magnetization transfer method to understand the dynamic character of base pairs. Experimental Section

Hydrogen-Deuterium Exchange of Tetrahymena Group I Ribozyme

Tetrahymena group I intron has served as good model system for conformation or dynamics study of large RNA. The Tetrahymena L-21 ScaI ribozyme is derived from the self-splicing group I intron. The internal guide sequence (IGS) in the ribozyme forms the P1 duplex with a substrate and then specific site of substrate was cleaved by attack of an exogenous guanosine. X-ray crystal structures of group I intron from several species have been solved and useful in the understanding of previous biochemical and biophysical study. The dynamics study of ribozyme is motivated by the desire to understand the conformational states and flexibility of ribozyme relating RNA function. The measurement of hydrogen exchange rates has been an important tool for studying the macromolecular conformation or dynamics. The imino proton resonances of nucleic acids are good probes of the hydrogen exchange study for studying the dynamics of each base pair. The exchange rates of imino protons depend on not only the base pair stability but also solvent accessibility. Hydrogen-deuterium (H/D) exchange method is widely used to measure the exchange rates of slowly exchanging imino protons whereas the exchange rates of fast-exchanging imino protons can be determined by water magnetization transfer method of NMR. It is very difficult to study the dynamics or conformational change of the Tetrahymena ribozyme by using NMR spectroscopy because whole ribozyme is too large (greater than 120 kDa). The NMR study on the dynamics or flexibility of the ribozyme can provide lots of information about the long-range molecular interaction, tertiary folding, or enzymatic kinetics in the large-sized ribozyme. The problem caused from resonance assignment may be solved by incorporation of the site-specific isotope-labeling method. However, it is still unclear which NMR method successfully provides the answer for the question on the dynamics or structure of the 120-kDa ribozyme. Here, we first challenged the H/D exchange study of 120-kDa ribozyme by NMR in order to investigate the dynamics property of very large RNA molecule. The success of this experiment suggests that the Tetrahymena ribozyme can be studied on its dynamics or conformational change in the molecular level when the sitespecific isotope-labeled ribozyme is prepared. The purified Tetrahymena group I ribozyme was kindly gifted by Prof. Daniel Herschlag (Stanford University). Ribozyme was buffer exchanged into 10 mM Mg NMR buffer (10 mM sodium phosphate pH 6.6, 100 mM NaCl, 10 mM MgCl2, 0.1 mM EDTA in 90% H2O/10% D2O). All NMR experiments were performed on Varian Inova 500 or 600 MHz spectrometer equipped a triple resonance or cold probe. The NMR data were processed using FELIX2004 (Accelrys) as described previously. 1D proton spectra were collected using a gradient 11 echo pulse sequence for water suppression. The ribozyme sample in 90% H2O/10% D2O NMR buffer was exchanged into100% D2O NMR buffer by using a 1mL bed volume G-25 size exclusion spin column. 1D imino proton spectra were acquired as function of time after deuterium exchange. The intensities of some slowly exchanging imino proton resonances were fit to the simple exponential decay I(t) = I0e −t/τex + c in Sigma plot, where I(t) and I0 are peak intensities at time t and zero, respectively, and τex is the exchange time. 9

Structural Energetics and Base-Pair Opening Dynamics in Sarcin−Ricin Domain RNA

The sarcin-ricin domain is a universal element of the RNA from the large ribosomal subunit. The domain is part of the binding site for elongation factors and is specifically cleaved by the toxins alpha-sarcin and ricin. In this work, we have mapped the energetics and dynamics of individual structural motifs in a 29-mer RNA oligomer containing the sarcin-ricin domain. The stability of individual base pairs in the structure was characterized from measurements of the exchange rates of imino protons using nuclear magnetic resonance spectroscopy at 10 degrees C. The measurements also provided the rates of opening and closing for selected base pairs. The results reveal that the structural stabilization free energies in the sarcin-ricin domain are broadly distributed between 2.9 and 10.6 kcal/mol. One of the least stable sites in the structure is the noncanonical G-A base pair located next to the phosphodiester bond that is cleaved by alpha-sarcin. The low stability of this base pair supports the proposal that cleavage by alpha-sarcin occurs by a base flipping mechanism. The opening dynamics of other base pairs is affected by elements of the structure such as the bulged-G motif and its cross-strand stacking. Participation in these motifs increases the lifetimes of the bases in an open, solvent-accessible conformation.

Sequence-Dependence of the Energetics of Opening of AT Basepairs in DNA

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the energetics of opening of AT/TA basepairs in the DNA dodecamer 5′-d(GCTATAAAAGGG)-3′/5′-d(CCCTTTTATAGC)-3′. The dodecamer contains the TATA box of the adenovirus major late promoter. The equilibrium constants for opening of each basepair are measured from the dependence of the exchange rates of imino protons on ammonia concentration. The enthalpy, entropy, and free energy changes in the opening reaction of each basepair are determined from the temperature dependence of the exchange rates. The results reveal that the opening enthalpy changes encompass a wide range of values, namely, from 17 to 29 kcal/mol. The largest values are observed for the AT basepairs in 7th and 8th positions. These values, and the exchange rates of the corresponding imino protons, suggest that these two basepairs open in a single concerted reaction. The enthalpy changes for opening of the central six basepairs are correlated to the opening entropy changes. This enthalpy-entropy compensation minimizes the variations in the opening free energies among these central basepairs. Deviations from the enthalpy-entropy compensation pattern are observed for basepairs located close to the ends of the duplex structure, suggesting a different mode of opening for these basepairs.

NMR structure of a cyclic polyamide-DNA complex.

The solution structure of a cyclic polyamide ligand complexed to a DNA oligomer, derived from NMR restrained molecular mechanics, is presented. The polyamide, cyclo-gamma-ImPyPy-gamma-PyPyPy-, binds to target DNA with a nanomolar dissociation constant as characterized by quantitative footprinting previously reported. 2D (1)H NMR data were used to generate distance restraints defining the structure of this cyclic polyamide with the DNA duplex d(5'-GCCTGTTAGCG-3'):d(5'-CGCTAACAGGC-3'). Data interpretation used complete relaxation matrix analysis of the NOESY cross-peak intensities with the program MARDIGRAS. The NMR-based distance restraints (276 total) were applied in restrained molecular dynamics calculations using a solvent model, yielding structures with an rmsd for the ligand and binding site of approximately 1 A. The resulting structures indicate some distortion of the DNA in the binding site. The constraints from cyclization lead to altered stacking of the rings in the halves of the cyclic ligand relative to unlinked complexes. Despite this, the interactions with DNA are very similar to what has been found in unlinked complexes. Measurements of ligand amide and DNA imino proton exchange rates indicate very slow dissociation of the ligand and show that the DNA can undergo opening fluctuations while the ligand is bound although the presence of the ligand decreases their frequency relative to the free DNA.

Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.

Site-resolved energetics in DNA triple helices containing G*TA and T*CG triads.

Recognition of specific sites in double-helical DNA by triplex-forming oligonucleotides has been limited until recently to sites containing homopurine-homopyrimidine sequences. G*TA and T*CG triads, in which TA and CG base pairs are specifically recognized by guanine or by thymine, have now extended this recognition code to DNA target sites of mixed base sequences. In the present work, we have obtained a characterization of the stabilities of G*TA and T*CG triads, and of the effects of these triads upon canonical triads, in triple-helical DNA. The three DNA triplexes investigated are formed by the folding of the 31-mers d(GAAXAGGT(5)CCTYTTCT(5)CTTZTCC) with X = G, T, or C, Y = C, A, or G, and Z = C, G, or T. We have measured the exchange rates of imino protons in each triad of the three triplexes using nuclear magnetic resonance spectroscopy. The exchange rates are used to map the local free energy of structural stabilization in each triplex. The results indicate that the stability of Watson-Crick base pairs in the G*TA and T*CG triads is comparable to that of Watson-Crick base pairs in canonical triads. The presence of G*TA and T*CG triads, however, destabilizes neighboring canonical triads, two or three positions removed from the G*TA/T*CG site. Moreover, the long-range destabilizing effects induced by the T*CG triad are larger than those induced by the G*TA triad. These findings reveal the molecular basis for the lower overall stability of G*TA- and T*CG-containing triplexes.

Proton exchange and local stability in a DNA triple helix containing a G.TA triad.

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C(+).GC triad. The results indicate that, in the G.TA triad, the stability of the Watson-Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6-1.8 kcal/mol at 1 degrees C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

Proton exchange and base pair opening in a DNA triple helix.

Nuclear magnetic resonance spectroscopy has been used to characterize opening reactions and stabilities of individual base pairs in two related DNA structures. The first is the triplex structure formed by the DNA 31-mer 5'-AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT-3'. The structure belongs to the YRY (or parallel) family of triple helices. The second structure is the hairpin double helix formed by the DNA 20-mer 5'-AGAGAGAACCCCTTCTCTCT-3' and corresponds to the duplex part of the YRY triplex. The rates of exchange of imino protons with solvent in the two structures have been measured by magnetization transfer from water and by real-time exchange at 10 degrees C in 100 mM NaCl and 5 mM MgCl2 at pH 5.5 and in the presence of two exchange catalysts. The results indicate that the exchange of imino protons in protonated cytosines is most likely limited by the opening of Hoogsteen C+G base pairs. The base pair opening parameters estimated from imino proton exchange rates suggest that the stability of individual Hoogsteen base pairs in the DNA triplex is comparable to that of Watson-Crick base pairs in double-helical DNA. In the triplex structure, the exchange rates of imino protons in Watson-Crick base pairs are up to 5000-fold lower than those in double-helical DNA. This result suggests that formation of the triplex structure enhances the stability of Watson-Crick base pairs by up to 5 kcal/mol. This stabilization depends on the specific location of each triad in the triplex structure.