Etrog Citron Research Articles

First Report of Citrus Leaf Blotch Virus on Nagami Kumquat in Turkey.

Kumquat, known as the smallest of citrus fruits, has seen an increase in the number of commercial orchards in recent years. In May of 2022, a PCR-based survey for citrus virus diseases was conducted in commercial Nagami kumquat (Fortunella margarita (Lour.) Swingle) orchards in the Cukurova region of Turkey. During the survey, five trees with bud union disorder symptoms were found in two different kumquat orchards in the Erdemli district of Mersin province. Young leaf samples from the five trees showing bud union disorder symptoms and two symptomless trees were collected from 6-year-old kumquat. Common citrus viruses and viroids, such as citrus psorosis virus, citrus exocortis viroid, and hop stunt viroid, were not detected in PCR tests performed on all collected samples. The samples were also tested for citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae), a virus associated with a bud union crease in kumquat (Vives et al.2001). Total RNA was isolated from collected leaf samples using the RNeasy Plant Mini Kit (Qiagen, USA). In the RT-PCR assay, two separate specific primer pairs were used to determine the presence of CLBV. The coat protein gene (CP), was amplified with primers KU-18 (5'-TTAAGATTACAGACACGAAGG- 3') and KU-19 (5' CTGTTTTTGAATTTTGCTCG-3'), and the RNA-dependent RNA polymerase gene (RdRp) was amplified with KU-27(5'-GATGCAAGCCAGGATGAATAC-3') and KU-15 (5'-CAGACACTCCAAGACCTTTCC-3') primers (Vives et al. 2002). All of symptomatic samples yielded amplicons of the expected size (456-bp RdRp and 438-bp CP). No amplicons were obtained from symptomless samples. Two PCR products were sequenced to confirm their identity by direct sequencing (GenBank accession no: OQ718432, OQ718433, PP726107, PP726108). Consensus sequences of these two genes showed 96% and 97% nt identity with CP and RdRP genes of the CLBV sequence in GenBank (MT038390, EU857539), respectively. For biological indexing, four RT-PCR-positive samples were used as inoculum sources. Four of Etrog citron (C. medica) and four of Dweet tangor (C. tangerina) seedlings were graft-inoculated for each source, and two seedlings for each cultivar were used as a negative control. Two months later, chlorotic blotching symptoms were observed on Dweet tangor leaves. Six months later, Etrog citron exhibited stem pitting symptoms. None of the negative control seedlings developed any symptoms. RT-PCR was performed to confirm the presence of CLBV in the virus-inoculated seedlings, and amplicons of the expected sizes (456-bp RdRp and 438-bp CP) were obtained. To the best of our knowledge, this is the first report of the CLBV infection in citrus in Turkey. CLBV is thought to have originated from infected grafting material in the country, although it is not known where it may have originated. Further research is needed to determine the distribution of CLBV and its potential to impact commercial citrus production in Turkey.

Assessment of the health status of citrus propagation material against hop stunt viroid through biological and molecular diagnosis

Hop stunt viroid (HSVd) is the causal agent of citrus cachexia, which can lead to significant crop losses. As part of a preventive management strategy, it is essential to use healthy plants from a certification program. This study aimed to, healthiness of 17 citrus cultivars was evaluated against HSVd using both biological and molecular diagnostics. For biological diagnosis, Etrog citron (Citrus medica L.) clone Arizona 861 S1 was used as an indicator plant, incorporating negative and positive controls for HSVd infection. For molecular diagnosis, reverse transcription polymerase chain reaction (RT-PCR) technique was employed with specific primers for viroid detection. Results indicated that six months after inoculation, the positive control exhibited symptoms associated with viroid infection, such as necrosis in the petiole and stem, leaf epinasty, and necrosis in the midvein. In contrast, both the negative control and evaluated citrus cultivars showed no symptoms. These findings were supported by molecular analysis, which allowed the amplification of a viroid genome region only in the positive control. Both biological and molecular diagnosis confirmed the absence of HSVd in the citrus varieties assessed. This study will allow the evaluation of the citrus plant collections used in the foundation category as a source of buds for plant multiplication of registered and certified seeds for citrus propagation nurseries in Colombia.

Effects of RNA silencing during antagonism between citrus exocortis viroid and citrus bark cracking viroid in Etrog citron (Citrus medica).

Citrus exocortis viroid (CEVd) and citrus bark cracking viroid (CBCVd) are two important viroids that infect citrus plants and frequently occur as mixed infections in orchards. However, the mechanism of antagonism between the two viroids in mixed infections remains unclear. The CEVd/CBCVd-citron system and small RNA sequencing (sRNA-seq) were used to study the antagonism. When CBCVd was inoculated before CEVd, the CEVd titre was significantly reduced and the symptoms were attenuated. Viroid-derived sRNAs (vd-sRNAs) from CEVd and CBCVd were predominantly 21-nucleotide (nt) and 22-nt in length and had similar 5' base biases. Homologous sequences of the two viroids in the terminal right (TR) region are rich in vd-sRNAs, and the high frequency vd-sRNAs selected from the CBCVd TR region can be used to degrade the transcripts of CEVd invivo directly. These results suggest that RNA silencing may play an important role in the antagonism of the two viroids, thus deepening our understanding of the molecular interaction of long noncoding RNAs in woody plants.

Molecular characterization of divergent isolates of Citrus bent leaf viroid (CBLVd) from citrus cultivars of Punjab, Pakistan.

Citrus viroid infection is emerging as a serious threat because of its efficient systemic movement within the host plant and its quick spread due to contaminated pruning tools. A survey was conducted to investigate the primary distribution and molecular characterization of Citrus bent leaf viroid (CBLVd) and its variants in different citrus cultivars. A total of 154 symptomatic citrus samples were collected and detected by RT‒PCR with newly designed specific primers with the incidence of 36.33%. During biological indexing study on Etrog citron, expressions of reduced leaf size, yellowing with a light green pattern, and bending were observed. Amplified products were sequenced and analyzed using a nucleotide BLAST search, which showed 98% homology with other CBLVd isolates. The results of the phylogenetic tree analysis showed the presence of two main groups (A and B), with the predominant variants of CBLVd, i.e., CVd-I-LSS (Citrus viroid Low Sequence Similarity) sequences, clustering in subgroup A1 along with newly detected CVd-I-LSS from Palestinian sweet lime (Citrus limettioides), which has been identified as a new host of CVd-I-LSS in Pakistan. Further analysis of the sequences in subgroup A1 showed that the variant of CVd-I-LSS infecting citrus cultivars had a close relationship with isolates reported from China, Japan, and Iran, which may have resulted from the exchange of planting material. This study also unveiled the variability in nucleotide sequences of CBLVd, which made it unable to be detected by old primers. The results of this study indicate that the widespread presence of divergent variants of CBLVd is a major concern for the citrus industry in Pakistan and other countries where virulent isolates of CBLVd are prevalent. These findings suggest the need for future research on effective management and quarantine measures to stop the spread of CBLVd.

Identification and primary distribution of Citrus viroid V in citrus in Punjab, Pakistan.

Citrus plants are prone to infection by different viroids which deteriorate their vigor and production. Citrus viroid V (CVd-V) is among the six citrus viroids, belongs to genus Apscaviroid (family Pospiviroidae) which induces symptoms of mild necrotic lesions on branches and cracks on trunk portion. A survey was conducted to evaluate the prevalence of CVd-V in core and non-core citrus cultivated areas of Punjab, Pakistan. A total of 154 samples from different citrus cultivars were tested for CVd-V infection by RT-PCR. The results revealed 66.66% disease incidence of CVd-V. Citrus cultivars Palestinia Sweet lime, Roy Ruby, Olinda Valencia, Kaghzi lime, and Dancy were identified as new citrus hosts of CVd-V for the first time from Pakistan. The viroid infection was confirmed by biological indexing on indicator host Etrog citron. The reported primers used for the detection of CVd-V did not amplify, rather showed non-specific amplification, which led to the designing of new primers. Whereas, new back-to-back designed primers (CVd-V AF1/CVd-V AR1) detected CVd-V successfully and obtained an expected amplified product of CVd-V with 294bp. Sequencing analysis confirmed the new host of CVd-V showing 98-100% nucleotide sequence homology with those reported previously from other countries while 100% sequence homology to the isolates reported from Pakistan. Based on phylogenetic analysis using all CVd-V sequences in GenBank, two main CVd-V groups (I and II) were identified, and newly identified isolates during this study fall in the group I. The study revealed that there are some changes in the nucleotide sequences of CVd-V which made difficult for their detection using reported primers. All isolates of Pakistan showed high sequence homology with other isolates of CVd-V from Iran and USA whereas; the isolates from China, Japan, Tunisia, and Africa are distantly related. It is evident that CVd-V is spreading in all citrus cultivars in Pakistan.

A Simulation of the Use of High Throughput Sequencing as Pre-Screening Assay to Enhance the Surveillance of Citrus Viruses and Viroids in the EPPO Region

Citrus are affected by many viruses and viroids, some globally widespread and some restricted to particular countries or areas. In this study, we simulated the use of high throughput sequencing (HTS) and the bioinformatic analysis of small interfering RNAs (siRNA) as a pre-screening method to guide bioindexing and molecular detection to enhance the surveillance survey of some key or emerging citrus viruses, such as non-European citrus tristeza virus isolates (non-EU CTV), citrus tatter leaf virus, citrus leprosis virus, citrus yellow mosaic virus, and citrus bark cracking viroid, present in the EPPO lists, and the citrus yellow vein clearing virus. The HTS’s ability to detect other citrus viroids was also evaluated. The results demonstrate that HTS provides a comprehensive phytosanitary status of citrus samples either in single and multiple infections of viruses and viroids. It also provides effective information on citrus tristeza virus mixed infections despite not being able to identify the non-EU variants of the virus. Bioindexing checks each single virus infection but does not differentiate viroids on the Etrog citron indicator and is time-consuming. Molecular assays are valuable as confirmation tests of viruses and viroids but many pairs of primers are needed for a full screening and new or non-target pathogens remain undetected. In addition, the genomes of two isolates of the citrus yellow vein clearing virus and the citrus tatter leaf virus, detected in a sample from China, are described.

Genetic diversity of the coat protein gene and biological variation of citrus yellow vein clearing virus infecting different citrus species

Citrus is one of the most important fruit crops globally and rising incidence of citrus yellow vein clearing virus (CYVCV) in citrus orchards is an increasing concern in India. CYVCV and Indian citrus ringspot virus (ICRSV) are assigned to the only two known species in the genus Mandarivirus. Both viruses naturally infect several citrus plants. ICRSV produces ringspots symptoms in Kinnow mandarin, whereas CYVCV induces vein clearing symptoms on Etrog citron and lemon. Leaf samples and bud sticks of different citrus cultivars, exhibiting diverse symptoms were collected during 2012–2014 from 18 locations of India. The genetic variability was assessed through analysis of the coat protein (CP) gene sequences. Out of the 15 CP gene sequences, 13 sequences were of 978 nucleotides (nts) and showed 96–99% sequence identity with CYVCV-Y1 isolate (JX040635.1). However, sequences from the isolates HI and DLI shared only 78% and 73% nucleotide sequence identity with CYVCV and ICRSV, respectively, and that may represent distinct CYVCV isolates in the genus Mandarivirus. In phylogenetic analysis also HI and DLI isolates clustered neither with CYVCV nor with ICRSV isolates.

First report of citrus bent leaf viroid from Morocco

Citrus is one of the most economically important fruit crop in Morocco, with a total production of 2.2 million tonnes during 2016/17. Citrus bent leaf viroid (CBLVd) from the Pospiviroidae family and the Apscaviroid genus is one of the widely distributed citrus viroids, with no specific symptoms associated with its infection but responsible for leaf bending on Etrog citron. Najar et al. Phytophatol Mediterr 56: 409–420, (2017) reported that CBLVd affected, in mixed infection with other citrus viroids, the canopy volume and fruit quality of the Tunisian citrus cultivar Maltaise demi sanguine. In summer 2013, a field survey for the presence of CBLVd was conducted in commercial orchards of the Gharb region of Morocco. Twenty five samples without symptoms of viroid infection were randomly collected from one citrus orchard of Common Clementine (Citrus clementina hort. ex Tanaka). The rootstocks of these samples were not known. Total RNA were extracted from leaves around the tree canopy using RNeasy Plant Mini Kit (Qiagen, Germany) and assayed by reverse-transcription polymerase reaction chain (RT-PCR) with two sets of primers, CBLVd-F1/ CBLVd-R1 (Bernard and Duran-Vila 2006) and YI4F/YI4R (Khoo et al. J Pl Pathology 99: 293, 2017); amplicons of the expected sizes (327 bp and 234 bp, respectively) were obtained from 15 samples. The resulting amplicons of 327 bp were sequenced in both directions and three sequences were deposited in GenBank under accession numbers MH200818, MH200819 and MH200820. Nucleotide blast analysis indicated 99% sequence identity with the Japanese isolate P2 (AB006735; Hataya et al. Arch Virol 143: 971–980, 1998), confirming the presence of CBLVd in the tested samples. The neighbour-joining phylogenetic analysis showed that the Moroccan CBLVd isolates were clustered in the same group as shown in Fig. 1. To the best of our knowledge, this study represents the first report of CBLVd in Morocco. Additional investigations on the occurrence and geographical distribution are being undertaken in Morocco’s main citrus growing areas.

FIRST REPORT OF CITRUS BENT LEAF VIROID IN MALAYSIA

Citrus are among eight major fruits crops grown in Malaysia, with a total production of 36,450 tons in 2013. Citrus bent leaf viroid (CBLVd, genus Apscaviroid, family Pospiviroidae), is widely distributed in citrus with no specific symptoms associated with its infection but responsible for leaf bending on Etrog citron. Leaf samples of citrus species such as calamondin [Citrofortunella microcarpa (Bunge) Wijnands], kaffir lime (Citrus hystrix DC.), key lime [C. aurantifolia (Cristm.) Swingle], mandarin orange (C. reticulata Blanco), pomelo (C. maxima Merr.), sweet orange [C. sinensis (L.) Osbeck] with stunting, leaf yellowing and epinasty were collected from different states in Malaysia. The rootstocks of these samples were not known. Total nucleic acids were extracted from leaves around the tree canopy and tested by RT-PCR with two sets of primers, CBLV-CM/CBLV-CP (Ashulin et al., 1991) and the newly designed YI4F/YI4R (5’-CGGAGACTTCTTGTGGTTCC-3’ and 5’-CTTGGAAGTCCGCTCGACTA-3’, respectively). Altogether 21 of 133 citrus samples were positive for CBLVd. The resulting amplicons of 328 bp and 234 bp in size were cloned. Sequence analysis revealed 95-99% identity with CBLVd isolate Jp (accession No. AB006734), confirming the presence of CBLVd (KU194472, KX823338-KX823343) in the tested samples. No particular symptoms were observed in the test samples correlated with the presence of CBLVd, thus the observed symptoms may not be induced by this viroid. To the best of our knowledge, this is the first report of CBLVd in Malaysia. Additional investigations on geographical distribution, epidemiology and economic impact are essential to formulate CBLVd management strategies in Malaysia.

Citrus leaf blotch virus in Cuba: first report and partial molecular characterization

Citrus leaf blotch virus (CLBV) infection has been detected in citrus cultivars from several countries including the USA, Spain, Italy, Japan and New Zealand. To investigate whether CLBV is present in Cuba, a survey was conducted in seven commercial citrus fields of the country during 2007–2013. In all, 1940 trees were inspected and samples of two symptomatic and 18 asymptomatic sources were tested by biological indexing and molecular techniques for virus detection. Bark patches from the two symptomatic Nagami and Round kumquat sources induced chlorotic blotching and vein clearing in Dweet tangor, and only for the Round kumquat inoculums, stem pitting in Etrog citron. RT-PCR assays using specific primers to amplify fragments of polymerase (RdRp), movement (MP) and coat protein (CP) genes of CLBV yielded amplicons with the expected sizes using RNA from both sources as a template. Viral RNA was further detected by a non-radioactive dot-blot hybridization assay using a mixture of specific probes derived from a Spanish isolate of CLBV. Sequences from RdRp, MP, and CP amplicons showed identical nucleotide identities for the two Cuban isolates, and higher than 95.9 % with isolates from Spain, New Zealand and the USA.

FIRST IDENTIFICATION OF CITRUS EXOCORTIS VIROID (CEVd) AND CITRUS DWARF VIROID (CVd-III) IN CITRUS ORCHARDS IN SYRIA

Following the first finding of Hop stunt viroid (HSVd) in Syria (Abou Kubaa et al., 2011), a survey of citrus was conducted during the summer 2013 to investigate the presence of other viroids in the country. Leaf samples were collected from 65 stunted trees from four commercial orchards located in Lattakia and Tartous, the most important citrus-producing areas in Syria. Each sample consisted of young leaves taken from four sides of each tree. The samples were tested for the presence of Citrus exocortis viroid (CEVd) and Citrus dwarf viroid (CVd-III). Total plant RNAs were extracted from leaves according to Foissac et al. (2001), and used as templates for reverse transcription (RT)-PCR using specific primers for both viroids. PCR products of the expected size (297 bp and 370 bp) for CVd-III and CEVd, respectively, were cloned and sequenced. Furthermore, previously infected budwood from five infected citrus trees were graft inoculated onto an Etrog citron (Citrus medica) indicator plants and maintained in a temperature controlled greenhouse. Biological indexing evidenced mild epinasty, leaf curling and typical stunting symptoms, confirming the presence of viroids. Results of RT-PCR showed that 24 out of 65 samples were infected by citrus viroids, including ten and eight that reacted positively to CEVd and CVd-III, respectively, and six that showed mixed infection by both viroids. The retrieved sequences were deposited in GenBank under accession numbers LN681197 and LN681196 for CVd-III and CEVd, respectively. To our knowledge, this is the first molecular identification of CEVd and CVd-III in citrus trees in Syria.

Phloem restriction of viroids in three citrus hosts is overcome by grafting with Etrog citron: potential involvement of a translocatable factor.

Viroid systemic spread involves cell-to-cell movement from initially infected cells via plasmodesmata, long-distance movement within the phloem and again cell-to-cell movement to invade distal tissues including the mesophyll. Citrus exocortis viroid (CEVd), hop stunt viroid, citrus bent leaf viroid, citrus dwarfing viroid, citrus bark cracking viroid and citrus viroid V remained phloem restricted when singly infecting Citrus karna, Citrus aurantium and Poncirus trifoliata, but not Etrog citron, where they were additionally detected in mesophyll protoplasts. However, when CEVd-infected C. karna was side-grafted with Etrog citron--with the resulting plants being composed of a C. karna stock and an Etrog citron branch--the viroid was detected in mesophyll protoplasts of the former, thus indicating that the ability of Etrog citron to support viroid invasion of non-vascular tissues was transferred to the stock. Further results suggest that a translocatable factor from Etrog citron mediates this viroid trafficking.

First Report of Citrus yellow vein clearing virus on Lemon in Yunnan, China.

Eureka lemon (Citrus limon) is an economically important crop in China. In 2009, a new disease was observed on Eureka lemon in an orchard of Ruili city in Yunnan Province. Nearly 10% of the plants were symptomatic with yellow vein clearing on lateral veins, combined with leaf crinkling and warping of young leaves. Water-soaked appearances were also seen on the adaxial leaf veins. The symptoms were present on mature leaves, resulting in almost 20% yield reduction. The symptoms on leaves were more severe in spring and autumn than in summer. This disease was transmitted by grafting from infected Eureka lemon to six lemon (C. limon) varieties (Femminello, Fino, Villafranca, Verna, Kutdiken, and Monachello) and two sour orange (C. aurantium) varieties (Daidai, Morocco), with inoculated plants showing similar symptoms. Variable symptoms were observed on other hosts, including severe yellowing and vein clearing on Dweet tangor (C. reticulata × C. sinensis), slight vein clearing on Tongshui 72-1 sweet orange (C. sinensis) and Marsh grapefruit (C. paradisi), but no symptoms were observed on Etrog citron (C. medica), Mexican lime (C. aurantifolia), or Ponkan (C. reticulata). When infected branches from Etrog citron, Mexican lime, and Ponkan were grafted onto healthy Morocco sour orange, typical yellowing and vein clearing symptoms were observed. In the mechanical transmission trials using eight herbaceous plant species, leaf rolling, shrinking, and pointed necrosis were observed on Vigna unguiculata, slight leaf rolling symptoms were observed on Capsicum frutescens, whereas Lycopersicum esculenum, Nicotiana benthamiana, Momordica charantia, Solanum melongena, Cucumis sativus, and Sesamum indicum remained symptomless. Symptom expression was influenced by temperature, being visible between 18 and 24°C but disappearing over 32°C. Crude extracts from young symptomatic lemon leaves were negatively stained for transmission electron microscopy observation (1) and showed filamentous virus particles of 13 to 15 × 400 to 1,000 nm. The described combination of symptoms in citrus species and herbaceous indicators, and virus morphology revealed by electron microscopy, suggested presence of Citrus yellow vein clearing virus (CYVCV). RNA extractions were made from 52 samples of Eureka lemon with yellow vein clearing symptoms. A one-step RT-PCR using primer pair (sense: 5'-TACCGCAGCTATCCATTTCC-3' and antisense: 5'-GCAGAAATCCCGAACCACTA-3'), designed from coat protein gene of CYVCV genome (GenBank Accession No. JX040635) (1), was performed. All of the symptomatic samples yielded the expected cDNA fragment and no amplicon was obtained from healthy plants. Three PCR amplicons were selected for cloning and sequencing. BLAST analysis showed that these nucleotide sequences (KJ859679 to 81) had greater than 97% nucleotide identity with the corresponding region of CYVCV reference genome (2), and therefore, this disease was associated with CYVCV. Symptoms resembling CYVCV infection were observed in China before (3); however, to our knowledge, this is the first proven report of CYVCV present in China. The identification of the pathogen now allows for appropriate field management and control measures.

Virus-viroid interactions: Citrus Tristeza Virus enhances the accumulation of Citrus Dwarfing Viroid in Mexican lime via virus-encoded silencing suppressors.

An assay to identify interactions between Citrus Dwarfing Viroid (CDVd) and Citrus Tristeza Virus (CTV) showed that viroid titer was enhanced by the coinfecting CTV in Mexican lime but not in etrog citron. Since CTV encodes three RNA silencing suppressors (RSSs), p23, p20 and p25, an assay using transgenic Mexican limes expressing each RSS revealed that p23 and, to a lesser extent, p25 recapitulated the effect observed with coinfections of CTV and CDVd.

Identification of a New Enamovirus Associated with Citrus Vein Enation Disease by Deep Sequencing of Small RNAs

To identify the causal agent of citrus vein enation disease, we examined by deep sequencing (Solexa-Illumina) the small RNA (sRNA) fraction from infected and healthy Etrog citron plants. Our results showed that virus-derived sRNAs (vsRNAs): (i) represent about 14.21% of the total sRNA population, (ii) are predominantly of 21 and 24 nucleotides with a biased distribution of their 5' nucleotide and with a clear prevalence of those of (+) polarity, and (iii) derive from all the viral genome, although a prominent hotspot is present at a 5'-proximal region. Contigs assembled from vsRNAs showed similarity with luteovirus sequences, particularly with Pea enation mosaic virus, the type member of the genus Enamovirus. The genomic RNA (gRNA) sequence of a new virus, provisionally named Citrus vein enation virus (CVEV), was completed and characterized. The CVEV gRNA was found to be single-stranded, positive-sense, with a size of 5,983 nucleotides and five open reading frames. Phylogenetic comparisons based on amino acid signatures of the RNA polymerase and the coat protein clearly classifies CVEV within the genus Enamovirus. Dot-blot hybridization and reverse transcription-polymerase chain reaction tests were developed to detect CVEV in plants affected by vein enation disease. CVEV detection by these methods has already been adopted for use in the Spanish citrus quarantine, sanitation, and certification programs.

First report of Citrus viroid V in Turkey.

The recently described Citrus viroid V (CVd-V) (Serra et al., 2008) has the typical features of members of the genus Apscavi- roid. Our viroid-infected citrus collection which had been ana- lyzed by sPAGE and found to be infected with different viroid species was checked again to determine whether CVd-V was present in Turkey. Viroidal RNAs extracted from 20 sweet orange plants were used as templates for RT-PCR with primer pairs P3/P4 [CVV-P3(h) CTGTGGGTCACCCCGCCC and CVV- P4(c) GAACCACAAGGTTGTTCACC] according to Ito and Ohta (2010). After electrophoresis of RT-PCR products in 1% agarose gel followed by ethidium bromide staining, bands of ca. 300 bp in size were detected in amplifications from five sweet or- ange samples. Amplified PCR products were purified using a Qi- agen gel extraction kit and custom sequenced by Iontec Sequenc- ing Service (Turkey). Nucleotide sequence analysis showed that CVd-V was 294 bp in length. Positive detection of CVd-V was confirmed by sPAGE and SSCP analysis. Analysis of the se- quence of the 294 bp amplicon revealed 96% and 98% identity with CVd-V GenBank reference sequences EU433392.1 and AB560862, respectively. Members of the genus Apscaviroid in- fecting citrus are not associated with diseases but they cause mild stunting and synergistic effects in Etrog citron co-infected with CVd-V (Serra et al., 2008). Since all CVd-V-infected sweet or- ange trees analyzed contained also more than three viroid species, the effect of CVd-V was not clear. To the best of our knowledge this is the first report of CVd-V in citrus trees in Turkey.

The genetic diversity of Citrus dwarfing viroid populations is mainly dependent on the infected host species

As with viruses, viroids infect their hosts as polymorphic populations of variants. Identifying possible sources of genetic variability is significant in the case of the species Citrus dwarfing viroid (CDVd) which has been proposed as a dwarfing agent for high-density citrus plantings. Here, a natural CDVd isolate (CMC) was used as an inoculum source for long-term (25 years) and short-term (1 year) bioassays in different citrus host species. Characterization of progenies indicated that the genetic stability of CDVd populations was high in certain hosts (trifoliate orange, Troyer citrange, Etrog citron, Navelina sweet orange), which preserve viroid populations similar to the original CMC isolate even after 25 years. By contrast, CDVd variant populations in Interdonato lemon and Volkamer lemon were completely different to those in the inoculated sources, highlighting how influential the host is on the genetic variability of CDVd populations. Implications for risk assessment of CDVd as a dwarfing agent are discussed. The GenBank/EMBL/DDBJ accession numbers for the complete sequences of the Citrus dwarfing viroid variants are JF970266.1 forH2-2, JF970267.1 for H2-7, EU938647.1 for H6-2, EU938651.1 forH6-10, JF970268.1 for H10-7, EU938652.1 for H14-13, EU938653.1for H14-14, JF970269.1 for H14-16, EU938648.1 for H15-9,EU938649.1 for H16-2, JF970265.1 for H16-9, EU938654.1 forH16-13, EU938650.1 for H20-3, JF970270.1 for H20-7, EU938641.1for PR-1, EU938642.1 for PR-3, EU938643.1 for PR-7, EU938644.1for CR-1, EU938639.1 for VR-4, JF12070.1 for VR-15, JF812069.1LS-4, EU938640.1 for LS-10 and JF970264.1 for LS-11.

Microarray analysis of Etrog citron (Citrus medica L.) reveals changes in chloroplast, cell wall, peroxidase and symporter activities in response to viroid infection.

Viroids are small (246-401 nucleotides), single-stranded, circular RNA molecules that infect several crop plants and can cause diseases of economic importance. Citrus are the hosts in which the largest number of viroids have been identified. Citrus exocortis viroid (CEVd), the causal agent of citrus exocortis disease, induces considerable losses in citrus crops. Changes in the gene expression profile during the early (pre-symptomatic) and late (post-symptomatic) stages of Etrog citron infected with CEVd were investigated using a citrus cDNA microarray. MaSigPro analysis was performed and, on the basis of gene expression profiles as a function of the time after infection, the differentially expressed genes were classified into five clusters. FatiScan analysis revealed significant enrichment of functional categories for each cluster, indicating that viroid infection triggers important changes in chloroplast, cell wall, peroxidase and symporter activities.

Comparison of Different Diagnostic Methods for Detection of Hop stunt viroid and Citrus exocortis viroid in Citrus

Viroids such as Hop stunt viroid (HSVd) and Citrus exocortis viroid (CEVd) are important pathogens in citrus plants. A comparative assay was performed to evaluate the viroid diagnostic techniques currently available at the Citrus Sanitation Center of Estacion Experimental Agroindustrial Obispo Colombres. We compared the results obtained in the diagnosis of HSVd and CEVd in citrus using two molecular techniques: s-PAGE and RT-PCR and biological indexing. Biological indexing was performed in a greenhouse under controlled temperature, using Etrog citron Arizona 861-S1 grafted on rough lemon rootstock as the indicator plant. Tissue samples for s-PAGE were obtained from inoculated citrons used in the biological indexing tests, and DNA extraction was performed following published procedures. HSVd and CEVd specific primers were used for RT-PCR, and samples were taken directly from field plants and inoculated citrons. Two nucleic acid extraction methods were compared. A total of 12 viroid isolates collected from orange, citron, grapefruit, citrumelo and lime trees, mostly from North Western Argentina, were used in these assays. The three diagnostic methods compared gave similar results in 11 of 12 samples assayed. Several viroids were detected by s-PAGE and most of them were found as mixtures. HSVd and CEVd were identified by RT-PCR and no differences were found between the two extraction methods assayed. Sample R-407 was positive for exocortis with biological diagnosis and s-PAGE, but it was negative with RT-PCR. This was probably due to inefficient cDNA synthesis or to the presence of inhibitors that could interfere with the reaction. On the basis of the results obtained, it can be concluded that the three techniques assayed are complementary and useful tools for diagnosis and identification of HSVd and CEVd in citrus.

Two nucleotide positions in the Citrus exocortis viroid RNA associated with symptom expression in Etrog citron but not in experimental herbaceous hosts

Citrus exocortis viroid (CEVd) is the causal agent of exocortis disease of citrus. CEVd has a wide host range that includes woody and herbaceous species. A new CEVd strain (CEVd(COL)), phylogenetically clustering with CEVd variants of Class A inducing severe symptoms in tomato, was identified in Colombia and shown to induce only extremely mild symptoms in Etrog citron indicator plants. Using site-directed mutagenesis, two nucleotide substitutions (314A → G and 315U → A) in the lower strand of the P domain of the predicted CEVd(COL) secondary structure resulted in a severe artificial CEVd(MCOL) variant. Conversely, two nucleotide exchanges (314G → A and 315A → U) in the same region of the severe variant CEVd(E-117) resulted in a symptomless artificial CEVd(ME-117) variant. Infectivity assays conducted with the natural and mutated variants showed that all induced severe symptoms in Gynura aurantiaca, tomato and chrysanthemum. This is the first report of the identification of pathogenic determinants of CEVd in citrus, and shows that these pathogenicity determinants are host dependent.