Etawah Grade Research Articles

Follicle-stimulating hormone receptor gene exploration as possible markers for prolific trait of local goat in Indonesia

The objective of this study was to discover and identify the effect of SNP of follicle-stimulating hormone receptor (FSHR) gen on prolific traits in Kejobong (KJ) and Etawah grade (EG) doe. A total of 15 blood samples were taken from 11 KJ and 4 EG with various parity and type of birth. The FSHR gene was amplified from the DNA template by Polymerase Chain Reaction (PCR); the PCR products were then sequenced to determine Single Nucleotide Polymorphisms (SNP). Results showed that 3 SNPs were identified, and those SNPs altered amino acid sequence formed 6 haplotypes and divided the doe based on the type of birth. In conclusion, SNPs identified in this study are associated with a prolific trait that can be used as a genetic marker and haplotype 3, 4, and 5 showed the highest prolific on KJ and EG doe.

Characterization of Bioactive Sialyl Oligosaccharides Separated from Colostrum of Indonesia Dairy Goat.

The bioactive functions of oligosaccharides from human milk have been reported by many studies. Many of oligosaccharides isolated from colostrum and/or milk of dairy animals have been reported to have similar chemical structures with those in human colostrum and/or milk. It has been proved by several studies that the oligosaccharides with similar chemical structure shared common bioactivities. Among domesticated dairy animals, bovine/cattle, caprine/goat, and ovine/sheep are the most commonly used species to isolate oligosaccharides from their colostrum and/or milk. Several studies on the oligosaccharides from goat colostrum and milk have revealed similar properties to that of human milk and possess the highest content of sialyl oligosaccharides (SOS) as compared to other ruminants. Indonesia ranks first in Association of Southeast Asian Nations (ASEAN) for goat milk production. Therefore, goat milk is the second most consumed milk in the country. The most reared dairy goat breed in Indonesia is Etawah Grade. However, oligosaccharides from Indonesia dairy animals including goat, have not been characterized. This is the first study to characterize oligosaccharides from Indonesia dairy animals. The present study was aimed to isolate and characterize oligosaccharides, specifically SOS from the colostrum of Etawah Grade goats by using proton/1H-nuclear magnetic resonance. The SOS successfully characterized in this study were: Neu5Ac(α2-3)Gal(β1-4)Glc (3’-N-acetylneuraminyllactose), Neu5Ac(α2-6)Gal(β1-4)Glc (6’-N-acetylneuraminyllactose), Neu5Gc(α2-3)Gal(β1-4)Glc (3’-N-glycolylneuraminyllactose), Neu5Gc(α2-6)Gal(β1-4)Glc (6’-N-glycolylneuraminyllactose), Neu5Ac(α2-6)Gal(β1-4) GlcNAc (6’-N-acetylneuraminyllactosamine) and Neu5Gc(α2-6)Gal(β1-4)GlcNAc (6’-N-glycolylneuraminyllactosamine). This finding shows that Etawah Grade, as a local dairy goat breed in Indonesia, is having significant potential to be natural source of oligosaccharides that can be utilized in the future food and pharmaceutical industries.

Diversity of milk traits in 25 goat breeds

Goats are livestock that is mostly raised by small farmers in Indonesia because they are easier to raise. Apart from having the potential to become meat, several breeds of which are kept as milk-purpose. Milk traits of each breed differ from one another. Therefore, this study tried to observe genetic differences of 25 goat breeds with statistical approach. Information about milk traits from 25 goat breeds is obtained from published journal. Multidimensional preference analysis and average linkage cluster analysis were performed using SAS 9.4 to determine the differences in goat breeds from three traits, namely milk yield, fat content, and protein content. Multidimensional preference analysis was able to see the advantages of breeds from the three observed traits. Goat breeds with superior milk yields are Saanen, Camosciata delle Alpi, and Charmoisée. Sarda Primitiva, Sarda, Etawah Grade have high fat content in milk. In addition, Arsi-Bale and Somali have high protein content. Average linkage cluster analysis is able to observe the genetic relationship of goat breeds based on three traits. According to average linkage cluster analysis, we found four clusters for goat breeds in this study. With existing statistical approaches, we can evaluate genetic diversity in milk traits.

Comparative study of semen quality traits between Etawah grade and Senduro bucks

This study compared the semen quality traits between Etawah grade (EGB) and Senduro bucks (SB) raised in Singosari National Artificial Insemination Center, Indonesia. A total of 96 ejaculated semen were collected from three EGB and three SB with an average age of three years. The ejaculates were evaluated for semen volume (SV), spermatozoa concentration (SC), total spermatozoa (TS), spermatozoa motility (SM), post-thawing spermatozoa motility (PTSM), the recovery rate of spermatozoa motility (RRSM), and frozen semen production (FSP). Data of SV, SM, PTSM, and RRSM were compared using the Mann-Whitney U test. While the data of SC, TS, and FSP were analyzed using an independent t-test. The results showed that SV, SM, PTSM, and RRSM were not significantly differed (P>0.05) between breeds. Whereas, SC, TS, and FSP of EGB were significantly higher (P<0.05) than SB. Therefore, it can be concluded that Etawah grade bucks can produce higher total spermatozoa and as a result higher frozen semen production for artificial insemination as compared to Senduro bucks.

Estimasi Nilai Heritabilitas Lingkar Dada dan Panjang Badan pada Kambing Peranakan Etawah di BPTU dan HPT Pelaihari Kalimantan Selatan

Evaluation in standardization really needs to be carried out, including whether the livestock is in accordance with the SNI vital statistics standard (Indonesian national standard). The purpose of the study was to estimate heritability and breeding values of body weight and vital statistics in Etawah Grade (PE) goats in BPTU and HPT Pelaihari Kalimantan Selatan. The material used were the performance records of 220 PE goats, offsprings of 35 males and 71 females. The variables measured were body length and chest girth at birth, weaning, and 1 year of age. Variance componenet were analyzed using variance analysisrade. Heritability was estimated using the paternal half-sib correlation method by applying SPSS software. Breeding value was estimated using the progeny test model. The highest breeding value on body length at birth, at weaning age and at 1 year of age were sire 3315 KK, sire 4093 OK, and sire 4007 OK, respectively. The highest breeding Value on chest girth at birth, weaning age and 1 year of age were sire 3983 HH, 3315 HH, and 3971 HH. The conclusion of this study were the heritability for body weight were categorized high and for statistic vital were varied from medium to high value.

Polymorphism of GH Exon 2 (c.100A>G) and GH Exon 4 (c.68A>C) in Sapera Goat

Growth hormone gene plays a key role in regulating body growth and in developing mammary gland. Saanen and Etawah Grade (Peranakan Etawah) are widely cultivated in Indonesia to produce milk. Sapera goat is the crossing between Saanen goat and Etawah Grade goat. Sapera goats are used in Indonesia because they are more adaptive to the tropical climate compared to Saanen and more milk yield compared to Etawah Grade. This study aimed to identify on two single nucleotide polymorphisms of the growth hormone gene, namely GH exon 2 (SNP: c.100A>G) and GH exon 4 (SNP: c.68A>C). These two SNPs were identified by the PCR-RFLP method. The GH exon 2 showed three genotypes (AA, AG, and GG). All breeds of dairy goat exhibited the highest AG genotype frequency (0.600-0.100). On the other hand, GH exon 4 was monomorphic. GH exon 2 could be employed as a useful marker to assist selection related to the growth and milk traits in dairy goat breeds. Further analysis is needed to investigate GH exon 4 (SNP: c.68A>C) in a larger sample size.

Milk production and lactation length of F2 Anglo Nubian × Etawah grade does

Goat milk has many benefits that resulted in increasing its consumption. A study was carried to evaluate total milk production and lactation length of F2 Anglo Nubian (AN) × Etawah Grade (PE) crossbred does in different lactation numbers. There were thirty-eight does of F2 AN × PE used in this study. All does were raised in IRIAP laboratory pens and the same feeding system and management. Daily single hand milking data were collected for total milk production per lactation of the first-third lactation between the year 2018–2019. The data were analyzed using a linear model from the SAS program including lactation numbers as a source of variation. Results had shown that lactation numbers significantly affected total milk production and lactation length (P<0.05). The first lactation of AN × PE does perform the lowest milk production and lactation length while the thirds showed the highest. The milk production and lactation length increased as lactation numbers increasing. It can be concluded that total milk production and lactation length were affected by lactation numbers. This study might be used as a consideration in improving milk production of crossbred goats using AN goats.

Use of genetic similarity analysis for identification and study of the origin of Indonesian local goats based on X-Y sex chromosome karyotyping and cytochrome-b genes sequence

The history and origins of Indonesian local goats are still compiled and described based on information on phenotypic characters, and there is still limited research that studies the origin of goats based on cellular and molecular analysis. The purpose of this study was to identify the origin of local goats in Indonesia based on the emergence of the profile of the sex chromosome band and the results of the Cytochrome b (Cyt-b) gene sequence. The research method is a case study with analysis of sex chromosome band profile results of preparation with G-banding and Cyt-B gene sequences. Genetic similarity analysis was performed using mitochondrial DNA (mtDNA). The sample used was whole blood from six Senduro goats, three male Etawah Grade and three Etawah goats. Chromosome preparation was done by G-Staining and analyzed by cytovision then analyzed its similarity with ancestor breeds. The whole blood sample was isolated with the Blood DNA Preparation Kit by Jena Bioscience. The primers used are Forward (Cytb_F) 5’GCAATTGCCATAGTCCACCT’3 and Reverse (Cytb_R) 5’GGATTTGCC GGGGTATAGTT ’3. The PCR results were sequenced by the Sanger method. Gene sequence analysis is performed using MEGA-X software. The results showed that the genetic distance between intraspesies and interspesies of Senduro goats and PE goats was 0% or ⩽ 2%. Conclusions based on genetic similarity from this study are Senduro goats and Etawah Peranakan goats, and Etawah has a close kinship, instead there is a distant kinship with the comparison of Capra Hircus, but it has a close kinship between individuals.

Breed and age effects on concentration of adiponectin and reproductive performance in Anglo Nubian, Etawah grade and its crossbred bucks

Abstract. Hafizuddin, Karja NWK, Praharani L, Setiadi MA. 2021. Breed and age effects on concentration of adiponectin and reproductive performance in Anglo Nubian, Etawah grade and its crossbred bucks. Biodiversitas 22: 1112-1119. The purpose of this study was to evaluate the effect of differences in breed and age on reproductive performance and adiponectin and testosterone production in Anglo Nubian, Etawah grade, and crossbred (Anpera) bucks. A total of 12 bucks with four individuals of each breed were used. This study collected five data points from each buck regarding adiponectin, testosterone, and reproductive performance (libido and semen characteristics). Data were analyzed with factorial analysis of variance and Duncan's test. The result shows that adiponectin concentration between breeds was significantly different (P &lt;0.01). There were also significant differences (P&lt;0.05) in adiponectin concentrations based on buck age. There were also significant interactions with adiponectin concentrations (P &lt;0.01). Furthermore, testosterone concentrations showed significant differences based on breed (P &lt;0.05) and age (P &lt;0.05). There were also significant age-breed interactions affecting testosterone concentrations (P &lt;0.01). Libido and semen characteristics had no significant differences based on breed and age group, and no significant age-breed interactions (P&gt; 0.05). The heterosis effect on adiponectin concentration (48.05%), testosterone concentration (27.68%), libido (-0.61%), semen volume (-1.93%), sperm motility (0.49%), sperm normal morphology (0.18%), and sperm concentration (0.00%) was measured. In conclusion, there is a significant effect of breed, age, and age-breed interactions on the concentration of adiponectin and testosterone in bucks, and both of these variables have a high heterosis effect on crossbred bucks.

Kualitas Mikrobiologis Susu Kambing dengan Metode Pasteurisasi High Temperature Short Time (HTST) pada Penyimpanan Berbeda

The aim of this study was to determine the effectiveness of the pasteurization method on the microbiologicalquality of goat’s milk stored at different times in the refrigerator. The research was conducted in MarchMay 2020 at the Animal Production Laboratory of the University of Lampung and the Laboratory ofthe Lampung Veterinary Center. The goat milk sample were colleted from Etawah Grade goats fromsmallholder farms in Metro City. Milk samples were taken from 20 goats from Etawah Grade in the 2ndand 3rd lactation periods. The goat milk sample used was 9 liters. Goat milk samples were pasteurizedusing the high temperature short time (HTST) method at a temperature of 72ºC for 15 seconds thencooled and put in a plastic bottle and stored in the refrigerator. This study used a completely randomizeddesign (CRD) with long storage treatment (0 days, 12 days, 24 days, 36 days, 48 days, and 60 days) in therefrigerator. The results showed that pasteurized goat milk with different storage times had no effect onthe microbiological quality, namely TPC, S. aureus, coliform bacteria, E. coli, reductase numbers andpH values. The conclusion of this study is that pasteurized goat’s milk using the HTST method is stillsuitable for consumption until the 60th storage day

Simulating allele frequency changes in Indonesian goat crossbreeding scenarios

This study was aimed to predict heterozygosity related to body weight (BW) trait from simulation of allele frequency changes in five crossbreeding scenario of Indonesian goat breed, namely Indonesian goat called Jawarandu (Etawah grade ♂ >< Kacang ♀), Boer (Boer ♂ >< Boer ♀), Boerja F1 (Boer ♂ >< Jawarandu ♀), Boerja F2 (Boer ♂ >< Boerja F1♀) and Boerja F3 (Boer ♂ >< Boerja F2 ♀). Allele frequency simulation was conducted, the heterozygosity were estimated and the associations to observed BW were measured from corresponding goat samples. BW (kg) data was retrieved from 1.5-year-old goats from the studied samples. In this study, allele that control BW trait was coded as “B” for high and “b” for low BW. The initial allele frequencies in Jawarandu were set as (B=0.45; b=0.55) and in Boer were (B=0.7; b=0.3). The simulation resulted in allele frequency in Boerja F1 were (B=0.57; b=0.43), F2 (B=0.64; b=0.36) and F3 (B=0.67; b=0.33). The estimated heterozygosity values were 0.54 0.42; 0.52; 0.47 and 0.44 in Jawarandu, Boer, F1, F2 and F3 respectively. Whereas the respective average of observed BW was 30.50±4.50; 49.50±5.90; 41.80±4.10; 41.60±3.60; and 39.80±3.20 kg. We confirmed that crossbreeding changes the heterozygosity in our simulation study.

Adiponectin and Testosterone Levels and Their Correlations with Fertility in Anglo-Nubian x Etawah Grade Crossbred Bucks

The purpose of the current study was to determine the concentrations of adiponectin and testosterone in various ages of bucks as well as the correlations of adiponectin and testosterone with semen quality as an indicator of fertility. Nineteen Anglo Nubian (AN) x Etawah Grade (PE) (Anpera) crossbred bucks belonged to the Research Institute for Animal Production were classified into four different age groups: 24 months, 30 months, 36 months, and more than 48 months. The concentrations of adiponectin and testosterone in the samples of blood plasma were analyzed using enzyme-linked immunosorbent assay (ELISA). The semen characteristics were evaluated both macroscopically and microscopically. The results of the study showed that plasma concentrations of adiponectin in Anpera bucks at the ages of 24, 30, 36, and more than 48 months were 14.10±1.73 mg/L, 18.36±8.25 mg/L, 20.38±8.67 mg/L, and 15.41±7.31 mg/L, respectively. There was no significant difference in adiponectin concentrations among the age groups (p>0.05). However, there were correlations of adiponectin concentrations with semen volume, sperm morphology, and sperm concentration. Plasma concentrations of testosterone at the ages of 24, 30, 36, and more than 48 months were 9.76±2.46 ng/mL, 9.81±1.56 ng/mL, 10.05±0.94 ng/mL, and 9.93±2.71 ng/mL, respectively. Plasma concentrations of testosterone in Anpera bucks also did not demonstrate a significant difference among the age groups (p>0.05). However, plasma testosterone concentrations had significant correlations with semen volume, sperm motility, and sperm concentration. In conclusion, the plasma concentrations of adiponectin and testosterone hormones had correlations with the semen quality parameters, which are related to fertility.

Morphometrics of Etawah Grade goat females as dairy breeding stocks under intensive management system in Central Java

Body measurements and their intercorrelations can be used as initial indicators of measurements, and to estimate chest girth from other body measurements in EG goat females kept under intensive management at one government dairy station in Purwokerto District, Central Java. Samples were Etawah Grade (EG) goat performance-based selection for good EG dairy breeding stocks. The aims of this research were to study characteristics of morphometric, to investigate intercorrelation among body females specified as breeding stocks of dairy goat type kept under intensive management of the Government Dairy Breeding Station at BBPTU Baturraden, Purwokerto District, Central Java. A total of 50 EG females between the ages of 1-6 years old were measured for some body measurements. Averages of body measurements of the observed EG goat females increased by the ages. The averages of body sizes at the ages of 2 years old for SH, HH, BL, CG, and HG were successively 75.0±11.1 cm, 79.8±1.8 cm, 65.3±1.8 cm, 77.0±3.9 cm, and 82.8±0.4 cm. At the mature ages (5 years old), compared to the young ones (2 years old), EG females had higher values of SH, HH, BL, CG, and HG by 6.3%, 1.8%, 17.9%, 18.0%, and 16.3%.CG had the highest correlation to HG (rs = 0.837-0.858) and CG was accurately predicted by HG or by the combination of HG to other body sizes. High intercorrelations were found among certain body measurement(s) of the EG dairy goat females.

The behavior of Etawah Grade goats in early and late pregnancy period in a tropical area

The behavior of Etawah Grade goats in early and late pregnancy period in a tropical area

Heterosis on morphometric traits of crossbreds from Anglo Nubian and Etawah Grade goats

Crossbreeding was applied to increase production performance of local goats. This study was conducted to evaluate the heterosis effect of morphometric traits in crossbred does produced from a mating between Anglo Nubian (AN) and Etawah Grade (PE) goats. A total of 34 does of AN, 66 F-1 ANxPE and 40 PE were used to analyze heterosis effect of morphometric traits. Data were analyzed using general linear model with age and genotype as fixed effects. Morphometric traits were affected significantly by genotype (P<0.05), but head with, body length and chest width were not. Heterosis of body weight, head length, head width, ear length, ear width, body length, heart girth, chest width, wither height, hip height, hip width, foreleg length, rear leg length, tail length, tail width were -2.75, -2.60, -2.09, -13.79, -3.90, 0.21, -3.82, 0.14, -3.1, -5.42, 6.06, -6.16, -5.88, -9.44 and 2.88%, respectively. Crossbreeding of Anglo Nubian and Etawah Grade resulted in low heterosis effects of morphometric traits. This study indicated crossbreeding of Anglo Nubian and Etawah grade need to be considered.

Analisis Keterkaitan GEN BMP15, BMPR1B, dan KISS1 dengan Sifat Fekunditas pada Kambing Peranakan Etawah Betina

Etawah grade goat is a result of grading up line between Kacang and Etawah goats, which well adapted to Indonesia’s humid tropical climate. This goat is a dual-purpose goat breed for milk and meat production. The objectives of this study were to evaluate the polymorphism of fecundity genes through the investigation of four candidate genes for prolificacy, i.e., BMP15 (exon 1), BMPR1B (exon 1), KISS1 (exon 1), and KISS1 (intron 1) and their associations with the litter size of Etawah-Grade does. The diversity of BMP15 (exon 1), BMPR1B (exon 1), KISS1 (exon 1), and KISS 1 (introns 1) genes were analyzed by the PCR-RFLP technique. A total of 106 of DNA samples were collected from Etawah-Grade does at BPTU-HPT Pelaihari in Pelaihari, South Kalimantan (51 heads) and Cordero Farm in Bogor, West Java (55 heads). Genetic polymorphisms between the two Etawah-Grade groups were calculated as well as their allele and genotype frequencies and the Polymorphic Informative Content (PIC). The Kruskal-Wallis one-factor ranked analysis of variance was used to determine whether there was any effect of genotype of the fecundity genes on litter size. The polymorphic information content (PIC) estimated at BPTU-HPT Pelaihari was 0.313, whereas at Cordero farm was 0.174, and overall PIC was 0.244. There was no association between genotypes of BMP15 (exon 1), BMPR1B (exon 1), KISS1 (exon 1), and KISS1 (intron 1) genes and litter size. Results indicated that BMP15 (exon 1) and KISS1 (exon 1) genes were monomorphic. However, the other two loci showed polymorphisms . The BMPR1B (exon 1) locus had two genotypes with the frequency for CC (96.23%) and for GG (3.77%), and KISS1 (intron 1) locus had three genotypes with the frequency for TT (80.19%), AT (17.92%), and AA (1.89%).

Artificial Insemination on the Etawah Grade Goats Using Frozen Semen of Gembrong Goat

.

Phylogenetical Relationships between Kejobong Goat and Other Goats Based on Mt-DNA D-loop Sequence Analysis

The aim of this study was to investigate phylogenetical relationships between Kejobong goat and Kacang goat as well as Etawah Grade goat using genetic diversity, haplotype, and genetic distance analysis based on D-loop sequences. A total of 76 blood samples belonged to three local goats, namely Kacang goat (KC), Etawah Grade goat (EG), and Kejobong goat (KJ). The DNA genome was extracted based on the manufacturer’s standard protocol using gSYNC DNA Mini Kit (Geneaid Biotech Ltd.) for sequence analysis control region (D-loop) in mitochondrial DNA (mtDNA) using specific primer. The results revealed that there were a total of 36 nucleotide substitutions, those were 1 indel (insertion or deletion), 34 haplotypes with Pi = 0.00253±0.00029 and Hd = 0.925±0.018 in three local goats, while intra-breed in this study showed Pi value of EG, KC, and KJ were 0.00452±0.00077, 0.00214±0.00028 and 0.00143±0.00018, respectively and Hd value were 0.985±0.025, 0.926±0.032, and 0.855±0.044, respectively. Genetic distances between KJ and KC, KJ and EG, and between KC and EG were 0.0018; 0.0034, and 0.0036, respectively. The highest NHap was observed in KC (17), followed by EG (15) and KJ (11); and all three local goats were in the same cluster in phylogeny tree. In conclusion, genetically, Kejobong goat is a crossbred of Kacang goat and Etawah Grade goat and has closer genetic relationships to Kacang goat than to Etawah Grade goat.

Milk Production in the First Lactation and Its Correlation with Mammary Gland Size of Etawah Grade Goat in BBPTU-HPT Baturraden, Indonesia

This study was conducted to determine relationship of the mammary glands size with milk production during the first lactation of Etawah Crossbreed/Peranakan Etawah (PE) goats at the Balai Besar Pembibitan Ternak Unggul Hijauan Pakan Ternak (BBPTU-HPT) Baturraden, Indonesia. The study used 41 first lactating PE goats. Variables in this study were taken by observation and measured of mammary glands. Data during the study which were taken included length, width, and circumference of udder, length, circumference, and distance between of teat, length and index of the mammary gland. Mammary gland index was calculated from the ratio between the length and circumference of the udder. Milk production was measured and recorded since the first day of lactation until day 91th. Data size of the mammary gland calculated the average and standard deviation. The data is then statistically analyzed regression. The results showed that milk production had a positive correlation with the circumference and length of the udder. Udder circumference correlation value to the milk production of 30.2%, while the length of the udder to the milk production of 22.3%. It was concluded that the production of goat's milk in the first lactation Etawah grade goat in BBPTU-HPT Baturraden correlated with the length and circumference of the udders but little correlation value.

Effect of Fermented Cocoa Pod Husk Level in Concentrate on Etawah Grade Semen Quality

The purpose of study was to determine the effect of fermented CPH supplementation level in concentrate toward semen quality of Etawah Grade Buck (EGB). This research was conducted from August to October, 2011 at experiment pen and Feeds Science Laboratory, Faculty of Animal Science, Universitas Gadjah, Yogyakarta. Semen was collected from 4 heads of EGB with about 2 years old and weight approximately of 24 kg. Concentrate was main material of CPH fermentation with composition P0 0, P1 20%, P2 40% and P3 60% from total of ration. The composer was used by the Aspergillus niger BPT with density 9.1 × 107 of colony/g as many as 1% of CPH material (on dry matter). Semen collection was done every 1 time/week and to be done five times semen collection. An examination was consisting of volume, color, smell, consistency, and the pH. Meanwhile, for microscopic examination was motion of mass, individual, motility, viability of spermatozoa. pH of P0, P1, P2 and P3 were 6.95, 7.03, 7.50 and 7.79, respectively. Mass movement of P0, P1, P2 and P3 were +++, +++, ++ and ++, while viability of P0, P1, P2 and P3 were 79.57%, 79.47%, 59.97% and 51.13%, respectively. It was concluded that addition of CPH fermentation in concentrates up to 20% for of EGB has not affect to feed consumption but it has affect to decreasing of semen quality in both of microscopic and microscopic.