Epstein-Barr Virus Coinfection Research Articles

Evaluating the role of interleukin-2 and interleukin-12 in pediatric patients with concurrent Mycoplasma pneumoniae and Epstein-Barr virus infections.

Mycoplasma pneumoniae (MP) frequently causes respiratory infections in children, whereas Epstein-Barr virus (EBV) typically presents subclinical manifestations in immunocompetent pediatric populations. The incidence of MP and EBV co-infections is often overlooked clinically, with the contributory role of EBV in pulmonary infections alongside MP remaining unclear. To evaluate the serum concentrations of interleukin-2 (IL-2) and interleukin-12 (IL-12) in pediatric patients with MP pneumonia co-infected with EBV and assess their prognostic implications. We retrospectively analyzed clinical data from patients diagnosed with MP and EBV co-infection, isolated MP infection, and a control group of healthy children, spanning from January 1, 2018 to December 31, 2021. Serum IL-2 and IL-12 levels were quantified using enzyme-linked immunosorbent assay. Logistic regression was employed to identify factors influencing poor prognosis, while receiver operating characteristic (ROC) curves evaluated the prognostic utility of serum IL-2 and IL-12 levels in co-infected patients. The co-infection group exhibited elevated serum IL-2 and C-reactive protein (CRP) levels compared to both the MP-only and control groups, with a reverse trend observed for IL-12 (P < 0.05). In the poor prognosis cohort, elevated CRP and IL-2 levels, alongside prolonged fever duration, contrasted with reduced IL-12 levels (P < 0.05). Logistic regression identified elevated IL-2 as an independent risk factor and high IL-12 as a protective factor for adverse outcomes (P < 0.05). ROC analysis indicated that the area under the curves for IL-2, IL-12, and their combination in predicting poor prognosis were 0.815, 0.895, and 0.915, respectively. Elevated serum IL-2 and diminished IL-12 levels in pediatric patients with MP and EBV co-infection correlate with poorer prognosis, with combined IL-2 and IL-12 levels offering enhanced predictive accuracy.

DRB1 locus alleles of HLA class II are associated with modulation of the immune response in different serological profiles of HIV-1/Epstein-Barr virus coinfection in the Brazilian Amazon region.

Epstein-Barr virus (EBV) infection involves distinct clinical and serological profiles. We evaluated the frequency of alleles of locus DRB1 of HLA class II in different serological profiles of EBV infection among HIV-1 infected patients. We recruited 19 patients with primary infection, 90 with serological transition and 467 with past infection by EBV, HIV-1 co-infection was 100% in primary infection and approximately 70% in other serological profiles. EBV viral load was quantified by real-time PCR, T lymphocyte quantification and cytokine level analysis were performed by flow cytometry, and HLA locus genotyping was performed by PCR-SSO. The DRB1*09 allele was associated with primary infection (p: 0.0477), and carriers of the allele showed changes in EBV viral load (p: 0.0485), CD8(+) T lymphocyte counts (p: 0.0206), double-positive T lymphocyte counts (p: 0.0093), IL-4 levels (p: 0.0464) and TNF levels (p: 0.0161). This allele was also frequent in HIV-coinfected individuals (p: 0.0023) and was related to the log10 HIV viral load (p: 0.0176) and CD8(+) T lymphocyte count (p: 0.0285). In primary infection, the log10 HIV viral load was high (p: 0.0060) and directly proportional to the EBV viral load (p: 0.0412). The DRB1*03 allele correlated with serological transition (p: 0.0477), EBV viral load (p: 0.0015), CD4(+) T lymphocyte count (p: 0.0112), CD8(+) T lymphocyte count (p: 0.0260), double-negative T lymphocyte count (p: 0.0540), IL-4 levels (p: 0.0478) and IL-6 levels (p: 0.0175). In the serological transition group, the log10 HIV viral load was high (p: 0.0060), but it was not associated with the EBV viral load (p: 0.1214). Past infection was related to the DRB1*16 allele (p: 0.0477), with carriers displaying IgG levels (p: 0.0020), CD4(+) T lymphocyte counts (p: 0.0116) and suggestive CD8(+) T count alterations (p: 0.0602). The DRB01*16 allele was also common in HIV-1 patients with past EBV infection (p: 0.0192); however, the allele was not associated with clinical markers of HIV-1 infection. Our results suggest that HLA class II alleles may be associated with the modulation of the serological profiles of the immune response to Epstein-Barr virus infection in patients coinfected with HIV-1.

Impact of Antiretroviral Therapy on the Progression of EBV-Associated Lymphomas

Objective — to determine the impact of antiretroviral therapy (ART) on the progression of lymphomas induced by Epstein—Barr virus (EBV) in patients infected with human immunodeficiency virus (HIV). Materials and methods. We analysed clinical-epidemiological, laboratory and serological indicators of 57 HIV-infected patients with clinically and laboratory-confirmed EBV co-infection. Patients were divided into two groups: the primary group consisted of 9 patients with lymphomas (66.7 % of whom received ART without concurrent chemotherapy with cytostatic antitumor agents, while the rest did not receive ART), and the control group included 48 patients without neoplasms. Results and discussion. To assess the effectiveness of ART in treating EBV-induced lymphomas, we analysed the general clinical, immunological and virological indicators of patients at the start of observation and after 6 months of therapy. In patients with EBV-associated lymphomas receiving ART, there was an increase in CD4+ lymphocytes, a decrease in HIV viral load, an increase in hemoglobin levels (p &lt; 0.05), and a significant reduction in EBV viral load (p &lt; 0.01). In patients with EBV-associated lymphomas who did not receive ART, there was a further decrease in CD4+ lymphocytes and an increase in EBV viral load. Two clinical cases are presented: in one, a patient received palliative chemotherapy according to the CHOP regimen but did not receive ART due to an absolute refusal because of poor drug tolerance; in the other case, the patient received ART without cytostatic antitumor drugs due to an absolute refusal. Conclusions. The study results established that the use of ART in patients with EBV-associated lymphomas not only improved the primary indicators characteristic of HIV but also significantly reduced the EBV viral load (p &lt; 0.01). The dynamics of the main immunological and virological indicators in patients with EBV-associated lymphomas who did not receive ART were negative, as evidenced by the further decrease in CD4+ lymphocytes and an increase in EBV viral load. From the clinical cases presented, it can be concluded that the timely administration of ART to patients with EBV-associated lymphomas is a crucial therapeutic tool that not only facilitates positive immunological and virological changes in HIV infection but also affects the quality and duration of life in patients with EBV-associated lymphomas.

Investigating the role of Epstein-Barr virus and human papillomavirus types 16 and 18 co-infections in cervical disease of Iranian women.

High-risk human papillomaviruses (HR-HPVs) are known to contribute to cervical cancer (CC), but the role of Epstein-Barr virus (EBV) in this process remains unclear, despite EBV's widespread detection in premalignant and malignant cervical tissues. In this cross-sectional study of 258 cervical samples, including both formalin-fixed paraffin-embedded (FFPE) and fresh cervical tissues, the presence and viral load of HR-HPVs (HPV-16 and HPV-18) and EBV were evaluated in Iranian women with cervical intraepithelial neoplasia (CIN), squamous cell carcinoma (SCC), and a cervicitis control group using real-time PCR. The study revealed a significant correlation between disease severity and both increased HPV-16 positivity and HPV-16 and HPV-18 co-infection (p<0.001). Interestingly, the control group had a higher frequency of EBV-positive cases than SCC/CIN groups (p<0.001). HPV-16 DNA load increased with disease severity (P<0.001), while HPV-18 showed no significant difference (P=0.058). The control group had a higher EBV DNA load compared to SCC/CIN groups (P=0.033). HPV-16 increased the risk of CIN II, CIN III, and SCC, while HPV-18 increased the risk of CIN II and CIN III. Notably, EBV was associated with a lower risk of CIN groups and SCC. No significant difference in EBV co-infection with HPV-16/18 was found, failing to support the hypothesis that EBV is a cofactor in CC. However, high EBV viral load in the control group suggests a potential "hit and run hypothesis" role in CC progression. This hypothesis suggests that EBV may contribute briefly to the initiation of CC with an initial impact but then becomes less actively involved in its ongoing progression.

Pulmonary co-infections by Pneumocystis jirovecii and Herpesviridae: a seven-year retrospective study

BackgroundPneumocystis jirovecii (P. jirovecii) is an opportunistic fungus responsible for Pneumocystis pneumonia (PCP) in deeply immunocompromised patients and for pulmonary colonization in individuals with mild immunosuppression or impaired respiratory function. PCP and Cytomegalovirus (CMV) co-infections have been widely described whereas those involving other Herpesviruses (HVs) such as Epstein-Barr virus (EBV), Herpes simplex virus type 1 and type 2 (HSV-1 and -2), and Varicella zoster virus (VZV) remain scarce. To date, no data are available concerning HVs co-infections in P. jirovecii colonization.MethodsOur main objective was to evaluate the frequency of HVs in bronchoalveolar lavage fluid (BALF) samples from patients with PCP or with pulmonary colonization. The secondary objective was to assess the relationship between HVs and the mortality rate in PCP patients. A retrospective single-center study over a seven-year period was conducted. All patients with P. jirovecii detected using PCR in a BALF sample and for whom a PCR assay for HVs detection was performed were included in the study.ResultsOne hundred and twenty-five patients were included, corresponding to 77 patients with PCP and 48 colonized patients. At least one HV was detected in 54/77 (70.1%) PCP patients and in 28/48 (58.3%) colonized patients. EBV was the most frequent in both groups. Furthermore, the 30-day survival rate in PCP patients was significantly lower with [EBV + CMV] co-infection than that with EBV co-infection, [EBV + HSV-1] co-infection and without HV co-infection.ConclusionOur results show that the frequency of HV, alone or in combination is similar in PCP and colonization. They also suggest that [EBV + CMV] detection in BALF samples from PCP patients is associated with an increased mortality rate, underlying the significance to detect HVs in the course of PCP.

Combined treatment with allogeneic Epstein–Barr- and human polyomavirus 1 specific T-cells in progressive multifocal leukoencephalopathy and EBV infection: a case report

Opportunistic viral infections in individuals with severe immunodeficiency can lead to fatal conditions such as progressive multifocal leukoencephalopathy (PML), for which treatment options are limited. These infections pose significant risks, especially when co-infections with other viruses occur. We describe a combined therapy approach using directly isolated allogeneic Human Polyomavirus 1 (also known as BKV) and Epstein–Barr virus (EBV) specific cytotoxic T-cells for the treatment of PML in conjunction with identified EBV in the cerebrospinal fluid (CSF) of a male patient infected with human immunodeficiency virus (HIV). A 53-year-old HIV-positive male, recently diagnosed with PML, presented with rapidly worsening symptoms, including ataxia, tetraparesis, dysarthria, and dysphagia, leading to respiratory failure. The patient developed PML even after commencing highly active antiretroviral therapy (HAART) 3 months prior. Brain magnetic resonance imaging (MRI) revealed multifocal demyelination lesions involving the posterior fossa and right thalamus suggestive of PML. In addition to the detection of human polyomavirus 2 (also known as JCV), analysis of CSF showed positive results for EBV deoxyribonucleic acid (DNA). His neurological condition markedly deteriorated over the following 2 months. Based on MRI, there was no evidence of Immune Reconstitution Inflammatory Syndrome contributing to this decline. The patient did not have endogenous virus-specific T-cells. We initiated an allogeneic, partially human leukocyte antigen-matched transfer of EBV and utilizing the cross-reactivity between BKV and JCV–BKV specific T-cells. This intervention led to notable neurological improvement and partial resolution of the MRI lesions within 6 weeks. Our case of a patient with acquired immune deficiency syndrome demonstrates that PML and concurrent EBV co-infection can still occur despite undergoing HAART treatment. This innovative experimental therapy, involving a combination of virus-specific T-cells, was demonstrated to be an effective treatment option in this patient.

The influence of SARS-COV-2 viral infection on the serological level of igm antibodies in patients with infectious mononucleosis

Infectious mononucleosis (IM) is a disease caused by the Epstein-Barr virus (EBV), a member of the herpes virus family, which usually occurs in older children, adolescents, and young adults between the ages of 15 and 25. In young adults, infectious mononucleosis often causes fever, cough, pharyngitis and malaise, and lymphadenopathy. The similar symptoms of COVID-19 and EBV-induced IM suggest a possible association. The aim of this study is to investigate the possibility of coinfection with Epstein-Barr virus in COVID-19 patients. 80 serum samples from IM patients from January 2020 to December 2022 are included and analyzed by enzyme‐linked immunosorbent assay (ELISA) for diagnosis and determination of EBV-VCA IgM stage. Patients were classified into an EBV/SARS- CoV-2 coinfection group based on serologic results. A high frequency of reinfection and coinfection with EBV was found in patients with COVID-19 (23.42 % - 34.58 %). C-reactive protein (CRP) and aspartate aminotransferase (AST) results were higher in EBV SARS-CoV-2 coinfection during disease. EBV coinfection may be associated with disease severity at COVID -19.

Clinical features of Talaromyces marneffei infection in HIV-positive and HIV-negative individuals: a retrospective study in southern China.

Talaromyces marneffei (TSM) is a temperature-dependent dimorphic fungus endemic to Southeast Asia and southern China. As the number of people at risk of TSM infection continues to increase, the clinical manifestations are becoming increasingly complex, posing challenges for clinical management. In this study, we analyzed the medical records of 99 patients (71 HIV-positive and 28 HIV-negative) diagnosed with TSM infection from January 1, 2017 to December 31, 2022 in southern China and compared the clinical manifestations in HIV-positive and HIV-negative patients. Most patients (83/99, 84%) were male. The incidence of skin and soft tissue involvement (48% vs. 21%, P = 0.016); disseminated infection with blood circulation, hematopoietic, lymphatic, alimentary, or central nervous system involvement (69% vs. 36%, P = 0.002); and gastrointestinal bleeding (33% vs. 9%, P = 0.023) was higher in the HIV-positive group than the HIV-negative group. The HIV-positive group also had significantly higher alanine aminotransferase levels (31 [26-42] vs. 14 [11-16]) U/L, P < 0.001) and alanine aminotransferase/aspartate transaminase ratio (1.9 [1.5-2.2] vs. 1.3 [1.1-1.6], P = 0.006) than the HIV-negative group. The time to diagnosis (5.5 ± 1.1 vs. 5.1 ± 1.4 days, P = 0.103), antifungal regimen (P = 0.278), case fatality rate (20% vs. 21%, P = 0.849), and relapse/reinfection rate (11% vs. 19%, P = 0.576) did not differ significantly between the HIV-positive and HIV-negative groups. Poor antiretroviral therapy adherence (OR=26.19, 95%CI 3.26-210.70, P = 0.002), advanced age (OR=1.13, 95%CI 1.03-1.23, P = 0.010), and Epstein-Barr virus co-infection (OR=37.13, 95%CI 3.03-455.64, P = 0.005) were independent risk factors for all-cause mortality from TSM infection in HIV-positive patients. Overall, the predominant infection sites, clinical manifestations, and complications of TSM infection differed by HIV status. However, with prompt diagnosis and appropriate treatment, HIV-positive patients with TSM infection can have similar outcomes to HIV-negative patients.

Fulminant Myocarditis Associated With Parvovirus B19 and Epstein-Barr Virus Coinfection

Abstract Parvovirus B19 (PVB19) and Epstein-Barr virus (EBV) commonly cause infection worldwide, with most persons infected during childhood. Their disease courses are usually mild and brief; however, PVB19 and EBV have been implicated as etiologies of viral myocarditis. We report a case of PVB19 and EBV coinfection associated with fulminant lymphocytic myocarditis. We address the implications of the case, including the differential diagnosis, immunomodulatory treatment considerations, and evidence for the pathologic roles of PVB19, EBV, and coinfection in myocarditis. Although the pathogenic roles of PVB19 or EBV alone in myocarditis are not well established, coinfection of PVB19 and EBV may unlock their pathogenic roles causing fulminant myocarditis. Treatment with steroids and intravenous immunoglobulin G in a patient with rapid clinical deterioration despite the presence of active infection on endomyocardial biopsy by polymerase chain reaction can result in a safe and quick recovery of fulminant viral myocarditis. Early and aggressive intervention, including both mechanical circulatory support and immunomodulatory therapy, may be key to improved outcomes in cases of fulminant myocarditis.

Cytomegalovirus and Epstein–Barr virus co-infected young and middle-aged adults can have an aging-related T-cell phenotype

Cytomegalovirus (CMV) is known to alter circulating effector memory or re-expressing CD45RA+ (TemRA) T-cell numbers, but whether Epstein–Barr virus (EBV) does the same or this is amplified during a CMV and EBV co-infection is unclear. Immune cell numbers in blood of children and young, middle-aged, and senior adults (n = 336) were determined with flow cytometry, and additional multivariate linear regression, intra-group correlation, and cluster analyses were performed. Compared to non-infected controls, CMV-seropositive individuals from all age groups had more immune cell variance, and CMV+ EBV− senior adults had more late-differentiated CD4+ and CD8+ TemRA and CD4+ effector memory T-cells. EBV-seropositive children and young adults had a more equal immune cell composition than non-infected controls, and CMV− EBV+ senior adults had more intermediate/late-differentiated CD4+ TemRA and effector memory T-cells than non-infected controls. CMV and EBV co-infected young and middle-aged adults with an elevated BMI and anti-CMV antibody levels had a similar immune cell composition as senior adults, and CMV+ EBV+ middle-aged adults had more late-differentiated CD8+ TemRA, effector memory, and HLA-DR+ CD38− T-cells than CMV+ EBV− controls. This study identified changes in T-cell numbers in CMV- or EBV-seropositive individuals and that some CMV and EBV co-infected young and middle-aged adults had an aging-related T-cell phenotype.

Helicobacter pylori and Epstein-Barr Virus Co-Infection in Gastric Disease: What Is the Correlation with p53 Mutation, Genes Methylation and Microsatellite Instability in a Cohort of Sicilian Population?

Genetic predisposition, environmental factors, and infectious agents interact in the development of gastric diseases. Helicobacter pylori (Hp) and Epstein-Barr virus (EBV) infection has recently been shown to be correlated with these diseases. A cross-sectional study was performed on 100 hospitalized Italian patients with and without gastric diseases. The patients were stratified into four groups. Significant methylation status differences among CDH1, DAPK, COX2, hMLH1 and CDKN2A were observed for coinfected (Hp-EBV group) patients; particularly, a significant presence of COX2 (p = 0.0179) was observed. For microsatellite instability, minor stability was described in the Hp-HBV group (69.23%, p = 0.0456). Finally, for p53 mutation in the EBV group, exon 6 was, significantly, most frequent in comparison to others (p = 0.0124), and in the Hp-EBV group exon 8 was, significantly, most frequent in comparison to others (p < 0.0001). A significant positive relationship was found between patients with infection (Hp, EBV or both) and p53 mutation (rho = 0.383, p = 0.0001), methylation status (rho = 0.432, p < 0.0001) and microsatellite instability (rho = 0.285, p = 0.004). Finally, we observed among infection and methylation status, microsatellite instability, and p53 mutation a significant positive relationship only between infection and methylation status (OR = 3.78, p = 0.0075) and infection and p53 mutation (OR = 6.21, p = 0.0082). According to our analysis, gastric disease in the Sicilian population has different pathways depending on the presence of various factors, including infectious agents such as Hp and EBV and genetic factors of the subject.

Epstein-Barr Virus and Multiple Sclerosis: A Convoluted Interaction and the Opportunity to Unravel Predictive Biomarkers.

Since the early 1980s, Epstein-Barr virus (EBV) infection has been described as one of the main risk factors for developing multiple sclerosis (MS), and recently, new epidemiological evidence has reinforced this premise. EBV seroconversion precedes almost 99% of the new cases of MS and likely predates the first clinical symptoms. The molecular mechanisms of this association are complex and may involve different immunological routes, perhaps all running in parallel (i.e., molecular mimicry, the bystander damage theory, abnormal cytokine networks, and coinfection of EBV with retroviruses, among others). However, despite the large amount of evidence available on these topics, the ultimate role of EBV in the pathogenesis of MS is not fully understood. For instance, it is unclear why after EBV infection some individuals develop MS while others evolve to lymphoproliferative disorders or systemic autoimmune diseases. In this regard, recent studies suggest that the virus may exert epigenetic control over MS susceptibility genes by means of specific virulence factors. Such genetic manipulation has been described in virally-infected memory B cells from patients with MS and are thought to be the main source of autoreactive immune responses. Yet, the role of EBV infection in the natural history of MS and in the initiation of neurodegeneration is even less clear. In this narrative review, we will discuss the available evidence on these topics and the possibility of harnessing such immunological alterations to uncover predictive biomarkers for the onset of MS and perhaps facilitate prognostication of the clinical course.

Human papillomavirus and Epstein-Barr virus co-infection in oral and oropharyngeal squamous cell carcinomas: A systematic review and meta-analysis.

Squamous cell carcinoma of the oral cavity (OSCC) is the most common head-and-neck malignancy. Importantly, we are experiencing an alarming rise in the incidence of oropharyngeal squamous cell carcinoma (OPSCC) globally. Oncogenic viruses, human papillomavirus (HPV) and Epstein-Barr virus (EBV), are known to be co-associated with OSCC and OPSCC cases. However, the reported incidence of HPV and EBV co-infection in OSCCs and OPSCCs globally is unknown. To address this, we performed a formal meta-analysis and systematic review on published studies that report the detection of both EBV and HPV in OSCCs and OPSCCs. Our analysis revealed 18 relevant studies out of a total of 1820 cases (1181 from the oral cavity and 639 from the oropharynx). Overall, HPV and EBV co-infection was found in 11.9% of OSCC and OPSCC cases combined (95% CI: 8%-14.1%). Based on anatomical subsite, dual positivity estimates were 10.5% (95% CI: 6.7%-15.1%) for OSCC and 14.2% (95% CI: 9.1%-21.3%) for OPSCC. The highest dual positivity rates described were in European countries: for OSCC 34.7% (95% CI: 25.9%-44.6%) in Sweden and for OPSCC, 23.4% (95% CI: 16.9%-31.5%) in Poland. Given these substantive prevalence rates, the value of detecting dual infection in the diagnosis and prognosis of these cancers deserves careful longitudinal studies, as do implications for cancer prevention and therapy. We further proposed molecular mechanisms that could explain how HPV and EBV could co-contribute to the aetiology of OSCCs and OPSCCs.

Abstract 6750: Primary effusion lymphoma descriptors and clinicopathologic determinants of survival: Analysis of a pooled database

Abstract Background Primary effusion lymphoma (PEL) is a rare and aggressive type of B-cell non-Hodgkin lymphoma presenting primarily as lymphomatous effusions in body cavities and less often as solid extracavitary masses. It is typically associated with human herpesvirus 8 (HHV8) infection and occasionally with Epstein-Barr virus (EBV) co-infection. It is commonly seen in immunocompromised states, such as human immunodeficiency virus (HIV) infection, organ transplantation, immunosuppressive therapy, or advanced age. Due to our limited understanding of this disease, we conducted this pooled database analysis to delineate key clinicopathological characteristics, prognostic indicators, and treatment modalities that affect survival in this rare and unique lymphoma subtype. Methods To study the demographic characteristics, molecular and immunohistochemical signatures, therapeutic interventions, survival, and prognostic factors, we compiled a pooled database of 303 cases of PEL. All cases with an unequivocal expression of CD19 and CD20 expression were excluded. Kaplan-Meier survival curves were constructed. Cox proportional hazards model and Log-rank tests were used to assess the influence of demographic and clinicopathologic factors on overall survival (OS). Result A total of 304 patients with confirmed PEL were identified. The median age was 49, with a peak incidence between 42 and 56 years. There was a male preponderance with M:F of 10. The majority (71%) was associated with HIV infection, with a median CD4 count of 108. Sixty-eight percent were cavitary with the pleural, pericardial, and peritoneal cavities involved in 56%, 20%, and 30%. The median duration of symptoms before diagnosis was 1.5 months. Patients presented with constitutional symptoms, hepatosplenomegaly, lymphadenopathy, and bone marrow involvement in 31%, 10%, 20%, and 16%. The median OS of the whole group was 6.5 months. Presentation with constitutional symptoms (p=0.026), extracavitary/solid tumors (p=0.03), and normal platelet counts (p=0.04) were associated with better median OS. Cavitary disease with effusions restricted to the thoracic cavity had also better median OS (p&amp;lt;0.0001). PEL occurrence in the context of immunosuppression due to transplantation had poor median OS (p=0.004). While having Kaposi sarcoma tended to impact OS negatively (p=0.08), Castleman’s disease did not. Compared to no treatment, combination chemotherapy alone, chemotherapy with anti-retroviral therapy, and stem cell transplant were statistically superior with a median OS of 1.5, 8, 30, and 16 months, respectively (p&amp;lt;0.0001). Conclusion This study presents updated clinicopathologic data from a pooled cohort of patients with PEL. It identifies the type of clinical setting contributing to immunodeficiency, disease presentation, the primary location of cavitary disease, and treatment approach as key determinants of OS. Citation Format: Supriya Gupta, Christopher Graham, Philip A. Haddad. Primary effusion lymphoma descriptors and clinicopathologic determinants of survival: Analysis of a pooled database. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 6750.

Abstract 6751: Provisional prognostic score for primary effusion lymphoma

Abstract Background Primary effusion lymphoma (PEL) is a rare and aggressive type of B-cell non-Hodgkin lymphoma presenting primarily as lymphomatous effusions in body cavities and less often as solid extracavitary masses. It is typically associated with human herpesvirus 8 (HHV8) infection and occasionally with Epstein-Barr virus (EBV) co-infection. It is commonly seen in immunocompromised states, such as human immunodeficiency virus (HIV) infection, organ transplantation, immunosuppressive therapy, or advanced age. Survival remains poor, and an optimal regimen has yet to be identified. However, the disease presents a diverse spectrum of survival outcomes. We conducted this study to develop a provisional PEL prognostic score (PPS) for this rare disease. Methods We used our constructed PEL database, which contains retrospective data on 302 cases. Such data included demographics such as sex, age, and race. It also included disease presentation symptoms, duration of symptoms before diagnosis, site(s) of the disease, blood counts, coexisting comorbidities, disease immunohistochemical and molecular phenotype, types of treatment, and survival outcomes. Of the 302 cases, only 238 had complete survival and outcomes data, the sample chosen for this study. Cox proportional-hazards model and Log-rank tests were used to assess the influence of clinicopathologic factors on overall survival (OS). Due to the relatively small training cohort, we included factors that statistically impacted OS and those that numerically trended that way. Results The median OS of the cohort was 6.5 months. The following dichotomous variables were identified as impactful prognostic factors in this cohort: the absence of constitutional symptoms (5 vs. 18 months), cavitary effusion disease (6 vs. 66 months), peritoneal cavity disease (3.5 vs. 11 months), transplant context (4 vs. 7 months), male sex (6 vs. 40 months), and detectable HHV8 viremia (7 vs. 66 months). A prognostic model was devised using these variables to identify different levels of risk. Each variable was assigned a score of 1 when present, except for peritoneal cavity disease and transplant context, which were assigned 2 points as they had the highest hazard ratio of all the other variables. In this exploratory cohort, low risk was assigned a score of 0-1, intermediate risk a score of 2-3, and high risk a score of 4-8. This prognostic score system led to our cohort's most optimal risk discriminatory model, where low, intermediate, and high risk had a median OS of 66, 28, and 4 months, respectively (p&amp;lt;0.0001). Conclusion This PPS is a promising new tool for risk-stratifying patients with PEL. However, it still needs prospective validation. Citation Format: Philip A. Haddad, Supriya Gupta, Christopher Graham. Provisional prognostic score for primary effusion lymphoma. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 6751.

Epidemiology and clinical characteristics of Epstein-Barr virus infection among children in Shanghai, China, 2017-2022.

To investigate the epidemiology and infectious characteristics of Epstein-Barr virus (EBV) infection among children in Shanghai, China from 2017 to 2022. We conducted a retrospective analysis of 10,260 inpatient patients who were subjected EBV nucleic acid testing from July 2017 to December 2022. Demographic information, clinical diagnosis, laboratory findings, etc. were collected and analyzed. EBV nucleic acid testing were performed by real-time PCR. A total of 2192 (21.4%) inpatient children were EBV-positive, with the average age of 7.3 ± 0.1 y. EBV detection was stable from 2017 to 2020 (26.9~30.1%), but showed essential decreases in 2021 (16.0%) and 2022 (9.0%). EBV was highest (>30%) detected from three quarters (Q) including 2018-Q4, 2019-Q4 and 2020-Q3. There were 24.5% of EBV coinfection with other pathogens, including bacteria (16.8%), other viruses (7.1%) and fungi (0.7%). EBV viral loads increased when coinfecting with bacteria ((142.2 ± 40.1) ×104/mL) or other viruses ((165.7 ± 37.4) ×104/mL). CRP significantly increased in EBV/fungi coinfection, while procalcitonin (PCT) and IL-6 showed remarkable increases in EBV/bacteria coinfection. Most (58.9%) of EBV-associated diseases belonged to immune disorders. The primary EBV-related diseases were systemic lupus erythematosus (SLE, 16.1%), immunodeficiency (12.4%), infectious mononucleosis (IM, 10.7%), pneumonia (10.4%) and Henoch-schonlein purpura (HSP, 10.2%). EBV viral loads were highest ((233.7 ± 27.4) × 104/mL) in patients with IM. EBV was prevalent among children in China, the viral loads increased when coinfecting with bacteria or other viruses. SLE, immunodeficiency and IM were the primary EBV-related diseases.

Molecular Detection of Epstein Barr Virus Co-Infection in HIV Positive Women Attending Selected Hospitals in Sokoto, Nigeria

Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is a type of herpes virus with no clinical manifestation in majority of individuals. However, when it occurs in adulthood, it causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection of EBV co-infection among HIV positive women attending some selected hospitals in Sokoto, Nigeria. Questionnaires were administered on 80 consenting HIV positive women attending three selected hospitals in Sokoto to gather data on socio-demography and risk factors. Blood samples were aseptically collected by venipuncture from the HIV positive patients and EBV screening done using PCR analysis with primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 EBV (EBV-1) and primer +5' GGTAGCCTTAGGACATACTC (Forward), -5' TGGAGGGAGTCCTGTACTAT (Reverse) for Type 2 EBV (EBV-2). Result indicated that majority (63.75%) of the HIV positive women were in the age group of 21-30 years with EBV-1 having the highest occurrences of 60.7%. Co-infection of EBV among HIV positive women attending the selected hospitals in Sokoto, Nigeria was established with EBV-1 having the highest prevalence and in subjects in polygamous relationships.

Retinoblastoma Protein Is Required for Epstein-Barr Virus Replication in Differentiated Epithelia.

Coinfection of human papillomavirus (HPV) and Epstein-Barr virus (EBV) has been detected in oropharyngeal squamous cell carcinoma. Although HPV and EBV replicate in differentiated epithelial cells, we previously reported that HPV epithelial immortalization reduces EBV replication within organotypic raft culture and that the HPV16 oncoprotein E7 was sufficient to inhibit EBV replication. A well-established function of HPV E7 is the degradation of the retinoblastoma (Rb) family of pocket proteins (pRb, p107, and p130). Here, we show that pRb knockdown in differentiated epithelia and EBV-positive Burkitt lymphoma (BL) reduces EBV lytic replication following de novo infection and reactivation, respectively. In differentiated epithelia, EBV immediate early (IE) transactivators were expressed, but loss of pRb blocked expression of the early gene product, EA-D. Although no alterations were observed in markers of epithelial differentiation, DNA damage, and p16, increased markers of S-phase progression and altered p107 and p130 levels were observed in suprabasal keratinocytes after pRb knockdown. In contrast, pRb interference in Akata BX1 Burkitt lymphoma cells showed a distinct phenotype from differentiated epithelia with no significant effect on EBV IE or EA-D expression. Instead, pRb knockdown reduced the levels of the plasmablast differentiation marker PRDM1/Blimp1 and increased the abundance of c-Myc protein in reactivated Akata BL with pRb knockdown. c-Myc RNA levels also increased following the loss of pRb in epithelial rafts. These results suggest that pRb is required to suppress c-Myc for efficient EBV replication in BL cells and identifies a mechanism for how HPV immortalization, through degradation of the retinoblastoma pocket proteins, interferes with EBV replication in coinfected epithelia. IMPORTANCE Terminally differentiated epithelium is known to support EBV genome amplification and virion morphogenesis following infection. The contribution of the cell cycle in differentiated tissues to efficient EBV replication is not understood. Using organotypic epithelial raft cultures and genetic interference, we can identify factors required for EBV replication in quiescent cells. Here, we phenocopied HPV16 E7 inhibition of EBV replication through knockdown of pRb. Loss of pRb was found to reduce EBV early gene expression and viral replication. Interruption of the viral life cycle was accompanied by increased S-phase gene expression in postmitotic keratinocytes, a process also observed in E7-positive epithelia, and deregulation of other pocket proteins. Together, these findings provide evidence of a global requirement for pRb in EBV lytic replication and provide a mechanistic framework for how HPV E7 may facilitate a latent EBV infection through its mediated degradation of pRb in copositive epithelia.

397: DEGREE OF THROMBOCYTOPENIA IN HOSPITALIZED COVID-19 PATIENTS WITH EBV AND CMV COINFECTION

Introduction: Thrombocytopenia (TCP) can be caused by Epstein-Barr Virus (EBV), Cytomegalovirus (CMV), and Coronavirus Disease 2019 (COVID-19). This study aimed to evaluate the degree of TCP in COVID-19 patients with co-infection with EBV and/or CMV. Methods: Retrospective study of adult patients admitted to our hospital with COVID-19 infection from March 2020 to February 2022 was conducted. Patients were divided into two groups. Group 1 (G1) had viral co-infection with EBV and/or CMV and group (G2) did not. These groups were analyzed based on the degree of TCP. Thrombocytopenia was classified into mild (100–150x103/uL), moderate (50–99x103/uL), and severe (< 50x103/uL). Primary outcomes were mortality, need for ventilation (NFV), and length of stay (LOS). Descriptive statistics, crosstabulation, Chi-square, and Mann-Whitney tests were used. Results: Of 994 patients, 445 with a median age of 57 [45-68] years were tested for viral co-infection. 262 (58.9%) were male and 327 (73.5%) survived. There was a statistically significant association between co-infection and TCP, X2(3)= 22.335, p= <.001. Of 218 patients in G1, 98 (45.0%) had normal platelet count (NPC), 44 (20.2%) had mild TCP, 47 (21.6%) had moderate, and 29 (13.3%) had severe. Of 227 patients in G2, 132 (58.1%) had NPC, 59 (26.0%) had mild TCP, 26 (11.5%) had moderate, and 10 (4.4%) had severe. There was a statistically significant association between co-infection and mortality, X2(1)= 36.682, p= <.001. In G1, 86 (39.4%) died and 132 (60.6%) survived. In G2, 32 (14.1%) died and 195 (85.9%) survived. There was a significant difference in LOS between the groups, [U= 16935.50, p= <.001]. G1 had a median LOS of 12 [6-19] days and G2 had a median of 7 [4-11] days. There was no statistically significant association between co-infection and NFV, X2(1)= .033, p= .856. In G1, 34 (15.6%) patients were mechanically ventilated and 184 (84.4%) were not. In G2, 34 (15.0%) were ventilated and 193 (85.0%) were not. Conclusions: COVID-19 and viral co-infection with EBV and/or CMV is associated with the presence of thrombocytopenia, mortality, and longer LOS in hospitalized patients. The presence of co-infection is associated with moderate and severe TCP.

Tumor Molecular and Microenvironment Characteristics in EBV-Associated Malignancies as Potential Therapeutic Targets: Focus on Gastric Cancer.

Although most people are infected with Epstein-Barr Virus (EBV) during their lifetime, only a minority of them develop an EBV-associated malignancy. EBV acts in both direct and indirect ways to transform infected cells into tumor cells. There are multiple ways in which the EBV, host, and tumor environment interact to promote malignant transformation. This paper focuses on some of the mechanisms that EBV uses to transform the tumor microenvironment (TME) of EBV-associated gastric cancer (EBVaGC) for its benefit, including overexpression of Indoleamine 2,3-Dioxygenase 1 (IDO1), synergism between H. pylori and EBV co-infection, and M1 to M2 switch. In this review, we expand on different modalities and combinatorial approaches to therapeutically target this mechanism.