Electrochemical Impedance Spectroscopy Measurements Research Articles

Carbon coated iron pyrite (C–FeS2) photo-electrode for photo-electrochemical water splitting

In this paper, we present fabrication of ‘FeS2’ and carbon coated FeS2 (C–FeS2) photo-electrodes and demonstrated that coating of carbon on FeS2 significantly enhanced photo-electrochemical properties. The hydrothermal method has been adopted for the synthesis of FeS2 and carbon coating on FeS2 was achieved by CVD technique. The materials are subsequently characterized using X-ray diffraction, Raman spectroscopy and Field enhanced scanning electron microscope (FESEM) techniques for phase identification and morphological studies, respectively. The photo-electrochemical measurements revealed significant enhancement in the current density from ∼2 to 3.7 mA/cm2 (∼1.8 times higher) for C–FeS2 in comparison to the FeS2 photo-electrode under visible light. The enhancement in FeS2 after carbon coating has been attributed to reduction in recombination of photo generated charge carriers, enhancement in the band bending and lowering the charge transfer resistance at the semiconductor/electrolyte interface. To date, very few studies have been reported on FeS2 based composites for water splitting applications and use of carbon coating can be a novel approach for developing efficient solar to hydrogen conversion devices. The mechanism for the photocurrent enhancement was supported by Mott-Schottky and electrochemical impedance spectroscopy measurements.

Impact of Electrochemical Impedance Spectroscopy Dataset Curation on Solid Oxide Cell Degradation Assessment

Abstract Electrochemical impedance spectroscopy (EIS) has become a standard measurement technique for detecting degradation in single cells and stacks of solid oxide cells (SOCs). Depending on the experimental setup and test equipment, instabilities and unexpected results can be observed in EIS measurements. For example, in the low-frequency range, instabilities can be induced by feed gas flow fluctuations. Another phenomenon are parasitic, inductive impedances that degrade the high-frequency range. To compensate for such influences in large EIS data sets, we propose a specially developed EIS data curation pipeline. Based on the results of its application, we demonstrate the impact on the quantitative and qualitative attribution of electrochemical processes from EIS using equivalent circuit modeling and distribution of relaxation times. Furthermore, the substantial differences in the temporal evolution of the latter during long-term experiments are highlighted for EIS measurements obtained at the SOC stack and single cell level. In addition, the significant misestimation of aging rates, especially with respect to the fuel electrode and the high-frequency series resistance, is shown when comparing EIS measurements, few of which exhibit a parasitic inductive impedance.

Dual Stimulus Responsive GO-Modified Tb-MOF toward a Smart Coating for Corrosion Detection.

Smart-sensing coatings that exhibit multistimulus response, rapid indication, and reusability are in urgent need to effectively enhance the practicability of coatings while accurately detecting metal corrosion. In this work, a reusable corrosion self-reporting coating with multiple pH and Fe3+ stimulus responses was first constructed by the integration of a composite fluorescent probe into the resin matrix. This composite sensor was constructed by combining a lanthanide metal-organic framework (Ln-MOF) based on terbium and trimeric acid (H3BTC) with graphene oxide (GO) nanosheets (GO@Tb-BTC). The incorporation of GO formed a sea-urchin-like structure, thereby increasing the specific surface area and active sites of the probe. The coatings were characterized by using electrochemical impedance spectroscopy (EIS), visual observation, and fluorescence spectrophotometry. The surface morphology, wettability, and adhesion of the coating samples were analyzed using SEM, XPS, hydrostatic contact angle test, and an adhesion test. EIS measurements in 3.5 wt % NaCl solution for 72 h demonstrated the superior corrosion protection performance of the 0.3 wt %/GO@Tb-BTC/WEP coating compared to blank coating, with the charge-transfer resistance reaching 4.33 × 107 Ω·cm2, which was 9.5 times higher than that of the pure coating. The bright green fluorescence of GO@Tb-BTC/WEP coating exhibited a turn-off response when there was an excess of OH-/H+, but it demonstrated a reversible turn-on fluorescence when the ambient pH returned to neutral. Furthermore, such Fe3+-triggered fluorescence quenching responded to concentrations as low as 1 × 10-6 M. The fluorescence quenching rate of both intact and damaged coatings surpassed that of visual and EIS detection methods. Significantly, the fluorescence in scratches was effectively quenched within 25 min using 0.3 wt %/GO@Tb-BTC/WPU coating for visual observation. GO@Tb-BTC demonstrated exceptional corrosion self-reporting capabilities in both epoxy and polyurethane systems, making it a versatile option beyond single-coating applications.

Unraveling the Influence of Shell Thickness in Organic Functionalized Cu2O Nanoparticles on C2+ Products Distribution in Electrocatalytic CO2 Reduction

AbstractCu‐based electrocatalysts exhibit enormous potential for electrochemical CO2 conversion to added‐value products. However, high selectivity, specially toward C2+ products, remains a critical challenge for its implementation in commercial applications. Herein, the study reports the preparation of a series of electrocatalysts based on octadecyl amine (ODA) coated Cu2O nanoparticles (NPs). HRTEM images show ODA coatings with thickness from 1.2 to 4 nm. DFT calculations predict that at low surface coverage, ODA tends to lay on the Cu2O surface, leaving hydrophilic regions. Oppositely, at high surface coverage, the ODA molecules are densely packed, being detrimental for both mass and charge transfer. These changes in ODA molecular arrangement explain differences in product selectivity. In situ Raman spectroscopy has revealed that the optimum ODA thickness contributes to the stabilization of key intermediates in the formation of C2+ products, especially ethanol. Electrochemical impedance spectroscopy and pulse voltammetry measurements confirm that the thicker ODA shells increase charge transfer resistance, while the lowest ODA content promotes faster intermediate desorption rates. At the optimum thickness, the intermediates desorption rates are the slowest, in agreement with the maximum concentration of intermediates observed by in situ Raman spectroscopy, thereby resulting in a Faradaic efficiency to ethanol and ethylene over 73%.

Adsorption of Glycine on TiO2 in Water from On-the-fly Free-Energy Calculations and In Situ Electrochemical Impedance Spectroscopy.

We report here an experimental-computational study of hydrated TiO2 anatase nanoparticles interacting with glycine, where we obtain quantitative agreement of the measured adsorption free energies. Ab initio simulations are performed within the tight binding and density functional theory in combination with enhanced free-energy sampling techniques, which exploit the thermodynamic integration of the unbiased mean forces collected on-the-fly along the molecular dynamics trajectories. The experiments adopt a new and efficient setup for electrochemical impedance spectroscopy measurements based on portable screen-printed gold electrodes, which allows fast and in situ signal assessment. The measured adsorption free energy is -30 kJ/mol (both from experiment and calculation), with preferential interaction of the charged NH3+ group which strongly adsorbs on the TiO2 bridging oxygens. This highlights the importance of the terminal amino groups in the adsorption mechanism of amino acids on hydrated metal oxides. The excellent agreement between computation and experiment for this amino acid opens the doors to the exploration of the interaction free energies for other moderately complex bionano systems.

Effect of DBSA‐doped PANI on the corrosion protection performance of GO/epoxy coatings

AbstractIn this study, the anticorrosion effect of polyaniline doped with dodecyl benzene sulfonic acid (PANI‐DBSA) in graphene oxide (GO)/epoxy coating is investigated. PANI‐DBSA is effectively synthesized on the surface of GO via chemical polymerization, and its properties are investigated via a series of characterization methods. The PANI‐DBSA/GO hybrid exhibits improved compatibility with organic resin. The anticorrosion performance of PANI‐DBSA/GO coatings is assessed through water absorption tests, electrochemical impedance spectroscopy measurements, and adhesion strength tests. The results indicate that PANI reduces the water absorption of GO, and the favorable compatibility of PANI‐DBSA/GO with epoxy resin minimizes coating defects and enhances the interfacial blocking for diffusion electrolytes. In this work, the PANI has no active function such as passivating the metal surface, it just serves to shield the hydrophilic GO surface and to improve compatibility between GO and the epoxy, attributing its low pigment content.

Synthesis and study of the inhibitory properties of a new Schiff base for C45 carbon steel in 1 M HCl

A newly Schiff base 1, 13-bis-[(4-dimethylamino) benzaldehyde 4, 7, 10-trioxatridecane-diimine] (DABT) was synthesized and characterized on the basis of the results of FT-IR, mass spectroscopy (MS), 1HNMR and 13CNMR. The desired performance of the organic compound DABT which is easy, inexpensive to prepare and eco-friendly, as a corrosion inhibitor for C45 carbon steel in 1 M HCl medium was evaluated using weight loss, potentiodynamic polarization, electrochemical impedance spectroscopy (EIS) measurements. The results suggest that the corrosion inhibition effectiveness increases with increasing inhibitor concentration and decreases with increasing temperature. The polarization experiments demonstrate that DABT exhibits the characteristics of a mixed-type inhibitor and follows the Langmuir isotherm in its adsorption behavior. Contact angle measurement revealed that the inhibitor on the surface of the carbon steel is hydrophobic. The synergistic effect of DABT has been investigated; inhibitory efficiency rises with increasing concentration of KI by competitive adsorption to form a layer of protection on the metal surface. Energy dispersive X-ray spectroscopy (EDS) combined with scanning electron microscope (SEM) was utilized to interpret the morphological study of the carbon steel surface. A good correlation was found between theoretical [Density functional theory (DFT), molecular dynamics simulation (MDS)] and experimental findings.

Optimizing Structural Patterns for 3D Electrodes in Lithium-Ion Batteries for Enhanced Fast-Charging Capability and Reduced Lithium Plating

The most common pattern types for anode structuring, in particular the line, grid, and hexagonal-arranged hole pattern were evaluated in a comparable setup in full-cells and symmetrical cells. The cells with structured electrodes were compared to reference cells with unstructured anodes of similar areal capacity (4.3 mAh cm−2) and the onset of lithium plating during fast-charging was determined in situ by differential voltage analysis of the voltage relaxation and ex situ by post-mortem analysis. Furthermore, electrochemical impedance spectroscopy measurements on symmetrical cells were used to determine the ionic resistance of structured and unstructured electrodes of similar areal capacity. All cells with structured electrodes showed lower ionic resistances and an onset of lithium plating shifted to higher C-rates compared to cells with unstructured electrodes. The structure patterns with capillary structures, i.e., lines and grids, showed significant reduced lithium plating during fast-charging and a higher rate capability compared to reference cells with unstructured electrodes and cells with hole structured electrodes. The continuous rewetting of the electrode with liquid electrolyte by capillary forces and the reduced ionic resistance of the 3D electrode are identified as key factors in improving overall battery performance. The data of the studied cells were used to calculate the resulting energy and power densities of prospective commercial pouch cells and potential pitfalls in the comparison to cells with unstructured electrodes were identified.

In2S3 nanoparticles modify the porous Fe2V4O13 nanostructure photoanode to enhance charge separation efficiency and photoelectrochemical water splitting performance

In this study, we demonstrate for the first time a promising photoanode of Fe2V4O13/In2S3 (FVO/IS) nanoparticles (NPs) for photoelectrochemical (PEC) water splitting. Most importantly, this work presents the first application of X-ray photoelectron spectroscopy in tracking electron flow direction within FVO/IS to reveal the formation of heterojunction having the electron flow from IS to FVO. Mott-Schottky measurement confirms that the modification of IS NPs establishes the type II heterojunction between FVO and IS, favorable for the transport and separation of carriers. Spectral measurements of electrochemical impedance spectroscopy, photoluminescence and Bode diagram confirm the effective separation of carriers and the prolongation of the charge lifetime in the FVO/IS heterojunction photoanode. Moreover, the electrochemical measurements evidently demonstrate the substantial enhancement in the charge separation efficiency (ηseparation) and charge transfer efficiency (ηtransfer) of the photoanode, leading to significantly enhanced PEC water splitting capability. As a result, in contrast with the pure FVO NPs photoanode, the photocurrent density of the constructed FVO/IS NPs photoanode is increased by 27 times without bias. This study paves a new approach for boosting the PEC water splitting activity of FVO photoanodes by constructing heterostructures through modification with other semiconductors.

Investigation of iron dissolution mechanism in acidic solutions with and without dissolved CO2 – Part I: EIS measurements

ABSTRACT Aqueous CO2 corrosion of mild steel is one of the major problems in the oil and gas industry. While current understanding primarily focuses on cathodic reaction mechanisms, less attention has been given to the impact of aqueous CO2 on the anodic iron dissolution reaction. In contrast, the mechanism of iron dissolution in strong acidic environments has been thoroughly investigated. Among the reaction mechanisms found in the open literature, a multi-path mechanism was identified that could explain the iron dissolution in strong acidic sulfate solution; both in terms of steady state polarization sweeps and impedance data at various pH values and current densities. However, the role of aqueous CO2 in solutions containing chlorides on the mechanism of iron dissolution had remained an open question. The present study used electrochemical impedance spectroscopy (EIS) as the main technique, to study the mechanism of iron dissolution in strong acid chloride solution with and without the presence of CO2. Results showed that the presence of chloride ions (0.5 M) decreases the rate of iron dissolution by competing with hydroxide ions to adsorb on the metal surface, forming chloride-containing intermediate species that participate in the iron dissolution reaction. The resulting decrease in the availability of hydroxide intermediates, which are more effective at enhancing the reaction rate compared to chloride-containing intermediates, leads to an overall decrease in the rate of iron dissolution. While the presence of CO2 increases anodic current density, EIS investigation revealed that neither aqueous CO2 nor other carbonic species directly react on the bare metal surface to form adsorbed intermediates involved in the anodic reaction. EIS investigation suggested that aqueous CO2 may induce changes in the chemical composition of adsorbed species, rate constants, and surface coverage, thereby altering the kinetics of the underlying reactions.

Corrosion behavior analysis of steel in simulated carbonated concrete pore solution based on 3D optical microscopy method

The main purpose of this study was to analyze the corrosion behavior of steel in simulated carbonated concrete pore solution (SCCPS) with the help of 3D optical microscopy method. This method was adopted to provide qualitative observation of surface with 3D information and quantitative results of defects for steel which was affected by various NaCl contents and inhibitors (inorganic inhibitor (NaNO2) and organic inhibitor (DEA(C4H11NO2)). As the NaCl contents changed during all corrosion periods, the mean pitting depths (Ra) and NaCl contents showed stronger linear relationships, and the slop values presented as the Ra added value of per wt% for different inhibitor systems were all detected to be closed to 3 μm/wt% in all linear regression models. This method provided a new angle to investigate and estimate the defect variation on steel surface, which denoted to better understand the corrosion behavior in SCCPS. Additionally, electrochemical impedance spectroscopy (EIS) and weight loss measurements were also used to verify the results of 3D optical microscopy analysis.

Degradation behavior and osteogenic activity of octacalcium phosphate modified MgO coatings on magnesium

To further enhance the corrosion resistance and osteogenic activity of the porous micro-arc oxidation (MAO) derived MgO ceramic coating on biomedical magnesium (Mg), octacalcium phosphate (OCP) layers with different microstucture were prepared on MAO coating by chemical deposition (CD) method to fabricate MAO/CD composite coatings. The in vitro degradation behaviors of MAO/CD-coated samples were evaluated by immersion in simulated body fluid (SBF) and electrochemical impedance spectroscopy (EIS) measurement. Their effects on in vitro MC3T3-E1 cell differentiation were investigated by examining alkaline phosphatase (ALP) activity and expression of main osteogenic-related genes. The in vitro immersion tests show that MAO/CD coatings rarely experience destruction and only micro-cracks occur after 96 h. EIS tests indicate that MAO/CD coatings slow down the degradation rate of Mg observably. In addition, MAO/CD coatings improve osteogenic differentiation of MC3T3-E1 cells compared to MAO coating, which is ascribed the lightened alkalization of the surrounding medium as well as up-regulated intracellular Ca2+. MAO/CD coating deposited in 2 h endows Mg the slowest degradation rate and excellent osteogenic differentiation induction activity.

In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10−9 – 200 × 10−9 M), detection limit (1.0 × 10−9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

Li-Ion Battery Material Impedance Analysis II: Graphite and Solid Electrolyte Interphase Kinetics

Li-ion battery graphite electrodes form a solid-electrolyte-interphase (SEI) which is vital in protecting the stability and efficiency of the cell. The SEI properties have been studied extensively in the context of formation and additives, however studying its kinetic features after formation have been neglected. In this study we show the dynamic resistive behavior of the SEI after formation. Via electrochemical impedance spectroscopy measurements on Cu-foil after SEI formation we show how the SEI shows a potential-dependent resistance which can be explained by a change in charge carriers (Li+) in the SEI. Additional measurements on graphite exhibit a similar behavior and allow us to separate the charge transfer kinetics from the SEI resistance, showing that the SEI resistance is the dominating resistance in the graphite kinetics. Measurements on pre-formed electrodes also show how the SEI resistance changes when in contact with electrolyte of different LiPF6 salt concentrations, with the resistance decreasing for increasing salt concentrations. Ultimately, we show that the SEI resistance affects Li-plating by acting as an offset to the plating reaction but does not affect the nucleation overpotential itself.

Homogeneous distribution of highly dispersed Pt species over O and P co-doped g-C3N4 and its superior photocatalytic H2 evolution activity

In this study, we synthesized O and P co-doped graphitic C3N4 (OPCN) materials by a one-step calcination method and prepared Pt/OPCN photocatalysts for the photocatalytic H2 evolution reaction. Among the Pt/OPCN catalysts with various O and P contents, Pt/OPCN2 exhibited the highest H2 evolution rate of 2198 μmol·g−1 (AQE = 7.33%), which was 1.65 times higher than that of Pt/CN (1330 μmol·g−1). Moreover, Pt/OPCN2 demonstrated excellent photocatalytic properties, such as suitable band gap (2.50eV) for visible light and efficient charge separation of photoexcited electron–hole pairs, which was confirmed by ultraviolet-visible spectroscopy, electrochemical impedance spectroscopy, photoluminescence spectroscopy, and time-resolved photoluminescence measurements. Fundamentally, the Pt species effectively interacted with neighboring P=O and C=O functional groups that optimally located defective OPCN2, resulting in a homogeneous formation of highly dispersed PtO evenly distributed over Pt/OPCN2, as confirmed by X-ray photoelectron spectroscopy, high-angle annular dark-field scanning transmission electron microscopy, and density functional theory calculations. However, excessive O and P contents of OPCN3 damaged the morphological structure of g-C3N4, inducing a poor interaction between the Pt species and OPCN3 and forming isolated Pt nanoparticles, resulting in the low photocatalytic activity of Pt/OPCN3.

Electrochemical characteristics of nano-structure TiCN coatings on the tool steel deposited by PACVD in various solutions

This study investigates The electrochemical behavior of various nano-structure TiCN coatings prepared using a plasma-assisted chemical vapor deposition technique in acidic and alkaline solutions. The N2/Ar ratio was varied to explore its effect on the microstructure and electrochemical properties of coatings on the steel cold-work tool. Electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization (PP) measurements were carried out in various corrosive solutions. Field emission scanning electron microscopy and X-ray diffraction were also utilized to evaluate the microstructure and phase detection. The EIS results showed that the resistance of TiCN coatings increased by about 94.3 % based on the equiaxed structure and small size of the coating cluster in 3.5 % wt NaCl solution after 24 h. The lowest corrosion rate with a value of 5.9 µA cm−2 in Ringer's solution at 37 °C after 24 h was attributed to the TiCN coating with the N2/Ar ratio of 0.4 according to exhibiting the highest Ti content and changes in present phases. The N2/Ar ratio of 0.7 effectively increased the impedance resistance to 97.5 % based on PP test results in 3 M H2SO4 solution. This behavior was related to the lowest value of the C/N ratio and the highest coating thickness.

A green approach to synthesis of Ag-doped CeO2 nanorods embedded reduced graphene oxide nanocomposite for excellent photocatalytic and antimicrobial activity

In this paper, the Ag-doped cerium oxide nanorods embedded reduced graphene oxide (Ag@CeO2/rGO) nanocomposite was synthesized via Punica Granatum leaf extract for for photocatalytic degradation of methylene blue (MB) and 4-nitrophenol (4-NP). The microstructural results confirmed the successful decoration of Ag-doped CeO2 nanorods on rGO matrix. The photocatalytic properties, including photocatalytic degradation, charge transfer kinetics and photocurrent generation, are systematically investigated using electrochemical impedance spectroscopy (EIS), photocurrent transient response (PCTR) and open circuit voltage decay (OCVD). The results of photocatalytic dye degradation measurements indicated that Ag@CeO2/rGO nanocomposite is more effective than pristine CeO2 to degrade the MB dye, and the degradation rate reached 100 % in 60 min. The decomposition of MB with Ag@CeO2/rGO nanostructure followed first-order reaction kinetics with a reaction rate constant (Ka) of 0.0198 min−1. The EIS and OCVD measurements revealed that the Ag doping and incorporation of rGO could suppress the recombination probability in CeO2 by the separation of photo-generated electron–hole pairs, which leads to the enhanced photocurrent generation and photocatalytic activity. The photocurrent density of Ag@CeO2/rGO, CeO2/rGO and pristine CeO2 are 215, 167.4 and 98.8 mAcm−2, respectively.

Sulfur-doped manganese-cobalt hydroxide with promoted surface reconstruction for glycerol electrooxidation assisted hydrogen production

Glycerol electrooxidation reaction (GOR), as an attractive alternative to oxygen evolution reaction, not only produces value-added formic acid but also facilitates H2 production. However, its practical application suffers from the lack of efficient electrocatalysts with high activity at low potentials. Herein, sulfur doped manganese-cobalt hydroxide nanosheets on nickel foam (Mn-Co-S/NF) has been demonstrated as a promising electrocatalytic electrode for GOR, showing high current density at low potentials and high Faradaic efficiency for formate production. The combination of ex situ characterization, operando Raman analysis, and in situ electrochemical impedance spectroscopy measurement unveils that S doping leads to the formation of hierarchically porous structure with abundant oxygen vacancies during the reaction, enabling the surface reconstruction to proceed in an easier manner and to a higher degree. As a result, the reconstructed Mn-Co-S/NF possesses highly enhanced charge/mass transfer capability and enriched high valence Co active species. Impressively, in a practical flow electrolyzer, an industrial-level current density of 900 mA cm−2 can be achieved at a cell voltage of 2.0 V. It also exhibits H2 yield rate of 3.5 mmol cm−2 h−1 at 200 mA cm−2, realizing up to 30.2% energy saving efficiency compared to water electrolysis.

Wideband Measurement Approach for EIS of Lithium-Ion Batteries Using Low-Frequency Concentrated Disturbance

Precise and rapid measurement for electrochemical impedance spectroscopy (EIS) is conducive to the working state monitoring and fault diagnosis of lithium-ion batteries (LIBs). Although using a wideband signal can effectively reduce measurement time, it will deteriorate the measurement precision due to the insufficient Signal-to-Noise Ratio. Considering this issue, this paper proposes a wideband measurement approach using low-frequency concentrated disturbance for the EIS of LIBs. This approach can obtain high measurement accuracy and a wide measurement bandwidth under a small current disturbance. Besides, it effectively reduces the measurement time. First, LIBs are stimulated by a low-frequency concentrated binary sequence signal to enhance measurement precision in a low-frequency region. Then, in the entire frequency region, an accurate EIS can be obtained by a fast Morlet wavelet transform and covariance-based impedance calculation. Finally, the effectiveness of the proposed approach is verified on a buck-boost converter-based EIS measurement platform, and comparative analyses with literature methods are conducted. The experimental results illustrate that the maximum Normalized Root Square Error of the two types of LIBs at different state-of-charge is 0.37% under the response voltage amplitude of less than 10mV. Moreover, this approach is approximately 20 times faster than commercial electrochemical workstations in measurement time.

Achieving ultrafine lamellar structure and exceptional electrochemical properties of Fe35Mn27Ni28Co5Cr5 high-entropy alloy through severe cold rolling process

This research provides an insight into the effect of ultrafine lamellar microstructures on the electrochemical behavior of Fe35Mn27Ni28Co5Cr5 high-entropy alloys (HEAs) in a 0.5 M H2SO4 solution. Following the severe cold rolling (SCR) process at a reduction rate of 90 %, the Fe35Mn27Ni28Co5Cr5 alloy exhibited a predominantly lamellar microstructure aligned along the rolling direction, leading to variations in grain size and subsequent differences in electrochemical behaviors. The potentiodynamic polarization (PDP) plots and electrochemical impedance spectroscopy (EIS) measurements confirmed that the influence of heavy cold rolling on corrosion resistance was mainly attributed to grain refinement and residual stress. The corrosion resistance of HEAs was ameliorated as a result of increased rolling deformation. The 90 % cold-rolled specimen showed excellent comprehensive corrosion resistance, for which the Ecorr and icorr values were found to be −0.278 V and 329 µA/cm2. Consequently, the development of ultrafine lamellar structures provides better conditions for forming passive films with higher protection behavior compared with their other counterparts. It could be due to the improved surface conditions for the development of oxide films resulting from higher homogeneity. The present work will provide new opportunities for tailoring the electrochemical characteristics of HEAs with strong commercial viability.