Intensity Of eGFP Fluorescence Research Articles

Using peptide barcodes for simultaneous profiling of protein expression from mRNA.

mRNA technology has begun to play a significant role in the areas of therapeutic intervention and vaccine development. However, optimizing the mRNA sequence that influences protein expression levels is a resource-intensive and time-consuming process. This study introduces a new method to accelerate the selection of sequences of mRNA for optimal protein expression. We designed the mRNA sequences in such a way that a unique peptide barcode, corresponding to each mRNA sequence, is attached to the expressed protein. These barcodes, cleaved off by a protease and simultaneously quantified by mass spectrometry, reflect the protein expression, enabling a parallel analysis. We validated this method using two mRNAs, each with different untranslated regions (UTRs) but encoding enhanced green fluorescence protein (eGFP), and investigated whether the peptide barcodes could analyze the differential eGFP expression levels. The fluorescence intensity of eGFP, a marker of its expression level, has shown noticeable changes between the two UTR sequences in mRNA-transfected cells when measured using flow cytometry. This suggests alterations in the expression level of eGFP due to the influence of different UTR sequences. Furthermore, the quantified amount of peptide barcodes that were released from eGFP showed consistent patterns with these changes. The experimental findings suggest that peptide barcodes serve as a valuable tool for assessing protein expression levels. The process of mRNA sequence selection, aimed at maximizing protein expression, can be enhanced by the parallel analysis of peptide barcodes using mass spectrometry.

Acute response of astrocytes under rose bengal photoinduction‐mediated vascular injury

AbstractBackgroundCerebrovascular pathology, often found in autopsy confirmed Alzheimer’s disease (AD), is widely believed to exacerbate AD pathophysiology and complicate anti‐AD treatment strategies. Perivascular cells such as astrocytes maintain the microenvironment for proper brain cell function and vascular integrity. Early occurrence of cerebral small vessel disease and astrocyte reactivity could lower the threshold of neuronal disorders and AD. Studies of astrocyte and microvascular pathology and function in the brain have been limited and reaction of astrocytes to vascular damage has yet to be fully understood.MethodAAV‐Gfa‐EGFP or AAV‐Gfa‐GCaMP6 was injected into the barrel cortex of wild type mice followed by glass window installation. After 3 weeks recovery, rhodamine dextran was IV‐injected and intravital brain imaging through two‐photon microscopy was performed at pre‐ and post‐photoinduction. Photoactivation of IV‐injected Rose Bengal dye (RB) technique was used to create vascular pathology. ImageJ was used for data analysis and GraphPad prism was used for statistical analysis.ResultAfter photoinduction, green fluorescence intensity was increased in blood stream of both EGFP and GCaMP expressing brains. This result indicates a leakage of brain parenchyma component to blood stream. Astrocytic EGFP fluorescence intensity and astrocyte processes complexity were reduced after photoinduction in a time‐dependent manner. Interestingly, astrocyte calcium signaling was strikingly increased after photoinduction and returned back to the baseline at ∼1,000s post‐induction. The highest peak of astrocyte calcium signaling was located near a site of vascular damage, indicated by an increased in rhodamine fluorescence intensity in the brain parenchyma area. Astrocytic GCaMP intensity at the astrocyte endfeet surrounding small vasculature was increased, on the other hand, GCaMP intensity at the astrocyte processes are decreased in a time‐dependent manner. Consistently, we observed a reduction of vascular diameter after photoinduction in both EGFP and GCaMP expressing brains.ConclusionAcute vascular injury induced by rose bengal photoinduction altered astrocyte integrity and cellular signaling. This injury model resembles vascular constriction and hemorrhages found in human brain that could accelerate neurodegeneration and AD progression.

Generation and application of a novel transgenic zebrafish line Tg(GAcyp1a:eGFP/Luc) as an in vivo assay to sensitive and specific monitoring of DLCs in the environment

CYP1A is the most commonly used biomarker and transgenic fish which carrying a cyp1a promoter to drive a reporter gene can be used as reliable way to monitor dioxin/dioxin-like compounds (DLCs) in the environment. Here, we cloned the cyp1a promoter of Gambusia affinis and this promoter showed stronger transcriptional activity than that of zebrafish. Then, a Tg(GAcyp1a:eGFP/Luc) transgenic zebrafish line was first constructed with the G. affinis cyp1a promoter driving eGFP expression using meganuclease I-SceI mediated transgenesis technology. The Tg(GAcyp1a:eGFP/Luc) larvae at 72 h post-fertilization (hpf) were tested by exposing to TCDD for 72 h, and induced GFP was mainly expressed in the liver with low background. The Tg(GAcyp1a:eGFP/Luc) zebrafish showed high sensitivity (limit of detection of 0.322 ng/L TCDD and 0.7 TEQ-ng/L PCDD/Fs) and specificity (insensitive to responses to PAHs and PCBs). In addition, the transgenic line showed a low detection concentration of the DLCs contaminated environmental samples (as low as 1.8 TEQ-ng/L), and the eGFP fluorescence intensity and the chemical-TEQ values were closely correlated. In conclusion, a sensitively and specifically transgenic zebrafish line was established to convenient and effective to detect DLCs in the environment.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Development and evaluation of a novel method for rapid screening of Pichia pastoris strains capable of efficiently expressing recombinant proteins

Pichia pastoris is one of the most widely used recombinant protein expression systems. In this study, a novel method for rapid screening of P. pastoris strains capable of efficiently expressing recombinant proteins was developed. Firstly, the ability to express recombinant proteins of the modified strain GS115-E in which a functional Sec63-EGFP (Enhanced green fluorescent protein) fusion protein replaced the endogenous endoplasmic reticulum transmembrane protein Sec63 was tested. Next, the plasmids carrying different copy numbers of phytase (phy) gene or xylanase (xyn) gene were transformed into GS115-E to obtain recombinant strains with different expression levels of phytase or xylanase, and the expression levels of EGFP and recombinant proteins in different strains were tested. Finally, a flow cytometer sorter was used to separate a mixture of cells with different phytase expression levels into sub-populations according to green fluorescence intensity. A good linear correlation was found between the fluorescence intensities of EGFP and the expression levels of the recombinant proteins in the recombinant strains (0.8<|R|<1). By using the flow cytometer, high-yielding P. pastoris cells were efficiently screened from a mixture of cells. The expression level of phytase of the selected high-fluorescence strains was 4.09 times higher than that of the low-fluorescence strains after 120 h of methanol induction. By detecting the EGFP fluorescence intensity instead of detecting the expression level and activity of the recombinant proteins in the recombinant strains, the method developed by the present study possesses the greatly improved performance of convenience and versatility in screening high-yielding P. pastoris strains. Combining the method with high-throughput screening instruments and technologies, such as flow cytometer and droplet microfluidics, the speed and throughput of this method will be further increased. This method will provide a simple and rapid approach for screening and obtaining P. pastoris with high abilities to express recombinant proteins.

Visualization and isolation of zone-specific murine hepatocytes that maintain distinct cytochrome P450 oxidase expression in primary culture

Parenchymal hepatocytes are responsible for most of the metabolic functions of the liver, but exhibit distinct functional properties depending on their localization within the hepatic lobule. Cytochrome P450 oxidases represent a family of drug-metabolizing enzymes, which are expressed predominantly in hepatocytes localized in the centrilobular area (zone 3). The present study describes a unique transgenic mouse strain that distinguishes zone 3 hepatocytes from periportal zone 1 hepatocytes by the intensity of EGFP fluorescence. Both zone 1 and zone 3 hepatocytes isolated from these mice showed the same zone-specific gene expression patterns as in liver tissue in vivo. Experiments using primary cultures of hepatocytes indicated that a combination of low oxygen concentration and activation of Wnt/β-catenin signaling maintained the expression of zone 3-specific P450 drug-metabolizing enzymes, which was characterized by their susceptibility to acetaminophen-induced mitochondrial dysfunction. These zone-specific hepatocytes provide a useful system in the research area of liver pathophysiology and drug development.

Generation of a GFP Reporter Akabane Virus with Enhanced Fluorescence Intensity by Modification of Artificial Ambisense S Genome.

We previously generated a recombinant reporter Akabane virus expressing enhanced green fluorescence protein (eGFP-AKAV), with an artificial S genome encoding eGFP in the ambisense RNA. Although the eGFP-AKAV was able to detect infected cells in in vivo histopathological study, its fluorescent signal was too weak to apply to in vivo imaging study. Here, we successfully generated a modified reporter, eGFP/38-AKAV, with 38-nucleotide deletion of the internal region of the 5′ untranslated region of S RNA. The eGFP/38-AKAV expressed higher intensity of eGFP fluorescence both in vitro and in vivo than the original eGFP-AKAV did. In addition, eGFP/38-AKAV was pathogenic in mice at a comparable level to that in wild-type AKAV. In the mice infected with eGFP/38-AKAV, the fluorescent signals, i.e., the virus-infected cells, were detected in the central nervous system using the whole-organ imaging. Our findings indicate that eGFP/38-AKAV could be used as a powerful tool to help elucidate the dynamics of AKAV in vivo.

A Novel Botulinum Toxin TAT-EGFP-HCS Fusion Protein Capable of Specific Delivery Through the Blood-brain Barrier to the Central Nervous System.

Botulinum toxin has many applications in the treatment of central diseases, as biological macromolecules, it is difficult to pass through the blood-brain barrier which greatly limits their application. In this paper, we verified whether the botulinum toxin heavy chain HCS has a specific neural guidance function. We have constructed a fusion protein with botulinum toxin heavy chain and a membrane penetrating peptide TAT (TAT-EGFP-HCS). Recombinant plasmid of botulinum toxin light chain (LC) and TAT were also constructed. The biological activity of HCS, LC, TAT-EGFP-HCS and TAT-EGFP-LC were measured by its ability to cleave protein SNAP-25. The intracellular expression efficiency was evaluated by detecting the fluorescence intensity of EGFP in the cells by fluorescence microscopy and FACS. In addition, we also determined the effect of the above plasmid expression on the apoptosis of PC12 cells. Finally, the tissue specificity of TAT-EGFP-HCS in vivo experiments was also examined. In the present study, we have constructed a fusion protein with botulinum toxin heavy chain and a membrane penetrating peptide TAT which can lead the entire molecule through the blood-brain barrier and reach the central nervous system. Moreover, we also examined the biological activities of this recombinant biological macromolecule and its physiological effects on nerve cells in vitro and in vivo. TAT-EGFP-HSC expressed in vitro has neural guidance function and can carry large proteins across the cell membrane without influencing the biological activity.

Magnetically targetable microcapsules display subtle changes in permeability and drug release in response to a biologically compatible low frequency alternating magnetic field

High frequency alternating magnetic fields (AMF) have been widely used as a non-invasive method to induce local hyperthermia for antitumor treatment and to efficiently trigger drug release from various carriers. However, few studies have exploited the potential of targeted drug delivery to healthy cells or tissue and the use of low frequency AMF (LF-AMF) for intracellular triggered release. To achieve this goal, doxycycline was delivered with the layer-by-layer (LbL) assembled magnetic microcapsules, and AMF with low frequency (50 Hz) was applied. The low frequency AMF had little effect on morphology of microcapsules, which upon exposure for 360 min caused no significant damage and had the advantage of minimizing heating effects. Nonetheless, microcapsule permeability increased as a function of exposure time when assessed using FITC-dextran (70 kDa) with the number of permeable microcapsules increased from 13.5% (20 min) to 52.8% (360 min). Increased permeability also enhanced in vitro doxycycline release in genetically engineered myoblast cells where EGFP expression is regulated by the tetracycline system, while targeted EGFP expression was observed by magnetically navigating the microcapsules to a site of interest. Upon LF-AMF exposure of 30 min, no cytotoxicity was observed, but intracellular doxycycline release was promoted and enhanced EGFP expression as demonstrated by EGFP fluorescence intensity measurement. This study reveals the possibility of targeted drug delivery and using LF-AMF as a non-cytotoxic intracellular trigger of drug release from microcapsules without alteration in cell viability.

Using Fluorescence Intensity of Enhanced Green Fluorescent Protein to Quantify Pseudomonas aeruginosa.

A variety of direct and indirect methods have been used to quantify planktonic and biofilm bacterial cells. Direct counting methods to determine the total number of cells include plate counts, microscopic cell counts, Coulter cell counting, flow cytometry, and fluorescence microscopy. However, indirect methods are often used to supplement direct cell counting, as they are often more convenient, less time-consuming, and require less material, while providing a number that can be related to the direct cell count. Herein, an indirect method is presented that uses fluorescence emission intensity as a proxy marker for studying bacterial accumulation. A clinical strain of Pseudomonas aeruginosa was genetically modified to express a green fluorescent protein (PA14/EGFP). The fluorescence intensity of EGFP in live cells was used as an indirect measure of live cell density, and was compared with the traditional cell counting methods of optical density (OD600) and plate counting (colony-forming units (CFUs)). While both OD600 and CFUs are well-established methods, the use of fluorescence spectroscopy to quantify bacteria is less common. This study demonstrates that EGFP intensity is a convenient reporter for bacterial quantification. In addition, we demonstrate the potential for fluorescence spectroscopy to be used to measure the quantity of PA14/EGFP biofilms, which have important human health implications due to their antimicrobial resistance. Therefore, fluorescence spectroscopy could serve as an alternative or complementary quick assay to quantify bacteria in planktonic cultures and biofilms.

Predicting synonymous codon usage and optimizing the heterologous gene for expression in E. coli

Of the 20 common amino acids, 18 are encoded by multiple synonymous codons. These synonymous codons are not redundant; in fact, all of codons contribute substantially to protein expression, structure and function. In this study, the codon usage pattern of genes in the E. coli was learned from the sequenced genomes of E. coli. A machine learning based method, Presyncodon was proposed to predict synonymous codon selection in E. coli based on the learned codon usage patterns of the residue in the context of the specific fragment. The predicting results indicate that Presycoden could be used to predict synonymous codon selection of the gene in the E. coli with the high accuracy. Two reporter genes (egfp and mApple) were designed with a combination of low- and high-frequency-usage codons by the method. The fluorescence intensity of eGFP and mApple expressed by the (egfp and mApple) designed by this method was about 2.3- or 1.7- folds greater than that from the genes with only high-frequency-usage codons in E. coli. Therefore, both low- and high-frequency-usage codons make positive contributions to the functional expression of the heterologous proteins. This method could be used to design synthetic genes for heterologous gene expression in biotechnology.

Validation of eGFP fluorescence intensity for testing in vitro cytotoxicity according to ISO 10993-5.

ISO 10993-5 provides one of the accepted standards for testing the biotoxicity of new materials. All of the recommended test procedures rely upon the uptake or metabolism of dye by living cells. Results of direct contact tests can be potentially compromised by interaction or adsorption of the dye or its metabolic products. Therefore, the aim of the current study was to validate the use of the eGFP signal of transfected NIH-3T3 fibroblasts with the results of the MTT test in order to provide a test procedure that is very close to the ISO 10993-5 but has the advantage of not relying on the addition of dye. Our tests show that the MTT assay detects cytotoxicity in the eGFP NIH-3T3 cells at least as well as in the L929 cells. To facilitate the validation, we chose to integrate the fluorescence measurements into the MTT test procedure. To that end, an additional washing step was introduced. Additionally, medium without phenol red was used, resulting in a very high correlation of both measurements. Without these modifications, the fluorescence test was comparable to the MTT test in its ability to detect the cytotoxic potential of substances; however, it did result in slightly elevated IC50 concentrations. As the results of both tests correlated highly, measurement of the eGFP signal appears to present a reliable tool for detecting cytotoxicity of materials in line with the ISO 10993-5 norm with the advantage of avoiding the addition of dyes and the subsequent potential interaction with test materials. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 715-722, 2017.

PiggyBac-mediated generation of stable transfectants with surface human leukocyte antigen expression from a small number of cells

Techniques useful for isolating a series of stable transfectants from a small number of cells are important for high-throughput functional analyses of genes of interest (GOIs). This study employed piggyBac transposon vectors carrying an IRES–eGFP cassette to isolate stable transfectants. The 14 transfections performed produced stable transfectants; a small number of cells (5.7×104) was sufficient even when liposomes were used to transfect non-adherent cells. Of note, there was a close relationship between eGFP fluorescence intensity and GOI (human leukocyte antigen) expression level. Therefore, the current system would be useful for the high-throughput acquisition of clones showing high GOI expression.

An Image-Based Biosensor Assay Strategy to Screen for Modulators of the microRNA 21 Biogenesis Pathway

microRNAs (miRNAs) are evolutionary conserved, small endogenous non-coding, RNA molecules. Although their mode of action has been extensively studied, little is known about their biogenesis. As their altered expression has been implicated in many diseases, small molecules that would modulate their expression are sought after. They are generated through the concerted action of several complexes which promote their transcription, maturation, export, trafficking, and loading of mature miRNA into silencing complexes. An increasing number of studies have suggested that each of these steps serves as a regulatory junction in the process, and therefore provides an intervention point. For this purpose, we have developed a simple image-based assay strategy to screen for such modulators. Here, we describe its successful implementation which combines the use of a microRNA 21 (miR-21) synthetic mimic together with an EGFP based reporter cell line, where its expression is under the control of miR-21, to monitor EGFP expression in a format suitable for HTS. The strategy was further validated using a small panel of known gene modulators of the miRNA pathway. A screen was performed in duplicate against a library of 6,912 compounds and identified 48 initial positives exhibiting enhanced EGFP fluorescence intensity. 42 compounds were found to be inherently fluorescent in the green channel leaving the remaining 6 as potential inhibitors and with a positive rate of 0.09%. Taken together, this validated strategy offers the opportunity to discover novel and specific inhibitors of the pathway through the screening of diverse chemical libraries.

MiR-124-regulated RhoG reduces neuronal process complexity via ELMO/Dock180/Rac1 and Cdc42 signalling

The small GTPase RhoG plays a central role in actin remodelling during diverse biological processes such as neurite outgrowth, cell migration, phagocytosis of apoptotic cells, and the invasion of pathogenic bacteria. Although it is known that RhoG stimulates neurite outgrowth in the rat pheochromocytoma PC12 cell line, neither the physiological function nor the regulation of this GTPase in neuronal differentiation is clear. Here, we identify RhoG as an inhibitor of neuronal process complexity, which is regulated by the microRNA miR-124. We find that RhoG inhibits dendritic branching in hippocampal neurons in vitro and in vivo. RhoG also inhibits axonal branching, acting via an ELMO/Dock180/Rac1 signalling pathway. However, RhoG inhibits dendritic branching dependent on the small GTPase Cdc42. Finally, we show that the expression of RhoG in neurons is suppressed by the CNS-specific microRNA miR-124 and connect the regulation of RhoG expression by miR-124 to the stimulation of neuronal process complexity. Thus, RhoG emerges as a cellular conductor of Rac1 and Cdc42 activity, in turn regulated by miR-124 to control axonal and dendritic branching.

Fast Modulation of μ-Opioid Receptor (MOR) Recycling Is Mediated by Receptor Agonists

The μ-opioid receptor (MOR) is a member of the G protein-coupled receptor family and the main target of endogenous opioid neuropeptides and morphine. Upon activation by ligands, MORs are rapidly internalized via clathrin-coated pits in heterologous cells and dissociated striatal neurons. After initial endocytosis, resensitized receptors recycle back to the cell surface by vesicular delivery for subsequent cycles of activation. MOR trafficking has been linked to opioid tolerance after acute exposure to agonist, but it is also involved in the resensitization process. Several studies describe the regulation and mechanism of MOR endocytosis, but little is known about the recycling of resensitized receptors to the cell surface. To study this process, we induced internalization of MOR with [D-Ala(2), N-Me-Phe(4), Gly(5)-ol]-enkephalin (DAMGO) and morphine and imaged in real time single vesicles recycling receptors to the cell surface. We determined single vesicle recycling kinetics and the number of receptors contained in them. Then we demonstrated that rapid vesicular delivery of recycling MORs to the cell surface was mediated by the actin-microtubule cytoskeleton. Recycling was also dependent on Rab4, Rab11, and the Ca(2+)-sensitive motor protein myosin Vb. Finally, we showed that recycling is acutely modulated by the presence of agonists and the levels of cAMP. Our work identifies a novel trafficking mechanism that increases the number of cell surface MORs during acute agonist exposure, effectively reducing the development of opioid tolerance.

Characterization of temperature inducible promoters from a novel rolling circle replicating plasmid of Enterococcus faecium DJ1

Limited studies have been performed on the characterization of small size plasmids of Enterococcus faecium with the intention of evaluating the strength of their promoters in Escherichia coli. The complete nucleotide sequence (3.825Kb) and structural organization of E. faecium DJ1 cryptic plasmid pNJAKD is presented. Seven promoter sequences from the pNJAKD plasmid of E. faecium have been identified. The regions coding for the putative promoters were either amplified using PCR based techniques or chemically synthesized as oligonucleotides of different sizes. These were subsequently cloned in the pEGFP vector at the Pvu II site. The efficiency of putative promoter fragments were measured using the intensity of eGFP fluorescence in E. coli JM101, DH5α and BL21(DE3), among which AKD3 exhibited moderate to strongest promoter activity at temperatures of 30, 37, and 42°C.

Targeting Neurons of Rat Nucleus Tractus Solitarii with the Gene Transfer Vector Adeno-Associated Virus Type 2 to Up-Regulate Neuronal Nitric Oxide Synthase

Adeno-associated virus (AAV) has distinct advantages over other viral vectors in delivering genes of interest to the brain. AAV mainly transfects neurons, produces no toxicity or inflammatory responses, and yields long-term transgene expression. In this study, we first tested the hypothesis that AAV serotype 2 (AAV2) selectively transfects neurons but not glial cells in the nucleus tractus solitarii (NTS) by examining expression of the reporter gene, enhanced green fluorescent protein (eGFP), in the rat NTS after unilateral microinjection of AAV2eGFP into NTS. Expression of eGFP was observed in 1-2 cells in the NTS 1day after injection. The number of transduced cells and the intensity of eGFP fluorescence increased from day 1 to day 28 and decreased on day 60. The majority (92.9±7.0%) of eGFP expressing NTS cells contained immunoreactivity for the neuronal marker, protein gene product 9.5, but not that for the glial marker, glial fibrillary acidic protein. We observed eGFP expressing neurons and fibers in the nodose ganglia (NG) both ipsilateral and contralateral to the injection. In addition, eGFP expressing fibers were present in both ipsilateral and contralateral nucleus ambiguus (NA), caudal ventrolateral medulla (CVLM) and rostral ventrolateral medulla (RVLM). Having established that AAV2 was able to transduce a gene into NTS neurons, we constructed AAV2 vectors that contained cDNA for neuronal nitric oxide synthase (nNOS) and examined nNOS expression in the rat NTS after injection of this vector into the area. Results from RT-PCR, Western analysis, and immunofluorescent histochemistry indicated that nNOS expression was elevated in rat NTS that had been injected with AAV2nNOS vectors. Therefore, we conclude that AAV2 is an effective viral vector in chronically transducing NTS neurons and that AAV2nNOS can be used as a specific gene transfer tool to study the role of nNOS in CNS neurons.

Altered Actin Dynamics and Functions of Osteoblast-Like Cells in Parabolic Flight may Involve ERK1/2

Osteoblasts are sensitive to mechanical stressors such as gravity and alter their cytoskeletons and functions to adapt; however, the contribution of gravity to this phenomenon is not well understood. In this study, we investigated the effects of acute gravitational changes on the structure and function of osteoblast ROS17/2.8 as generated by parabolic flight. The changes in microfilament cytoskeleton was observed by immunofluorescence stain of Texas red conjugated Phalloidin and Alexa Fluor 488 conjugated DNase I for F-actin and G-actin, respectively. To examine osteoblast function, ALP (alkaline phosphatase) activity, osteocalcin secretions and the expression of ALP, COL1A1 (collagen type I alpha 1 chain) and osteocalcin were detected by modified Gomori methods, radioimmunity and RT-PCR, respectively. Double fluorescence staining of phosphorylated p44/42 and F-actin were performed to observe their colocalization relationship. The established semi-quantitative analysis method of fluorescence intensity of EGFP was used to detect the activity changes of COL1A1 promoter in EGFP-ROS cells with MAPK inhibitor PD98059 or F-actin inhibitor cytochalasin B. Results indicate that the altered gravity induced the reorganization of microfilament cytoskeletons of osteoblasts. After 3 h parabolic flight, F-actin of osteoblast cytoskeleton became thicker and directivity, whereas G-actin shrunk and became more concentrated at the edge of nucleus. The excretion of osteocalcin, the activity of ALP and the expression of mRNA decreased. Colocalization analysis indicated that phosphorylated p44/42 MAPK was coupled with F-actin. Inhibitor PD98059 and cytochalasin B decreased the fluorescence intensity of EGFP-ROS cells. Above results suggest that short time gravity variations induce the adjustment of osteoblast structure and functional and ERK1/2 signaling maybe involve these responses. We believe that it is an adaptive method of the osteoblasts to gravity alteration that structure alteration inhibits the function performing.

Robust cardiomyocyte-specific gene expression following systemic injection of AAV: in vivo gene delivery follows a Poisson distribution

Newly-isolated serotypes of AAV readily cross the endothelial barrier to provide efficient transgene delivery throughout the body. However, tissue-specific expression is preferred in most experimental studies and gene therapy protocols. Previous efforts to restrict gene expression to the myocardium often relied on direct injection into heart muscle or intracoronary perfusion. Here, we report an AAV vector system employing the cardiac troponin T promoter (cTnT). Using luciferase and eGFP, the efficiency and specificity of cardiac reporter gene expression using AAV serotype capsids: AAV-1, 2, 6, 8 or 9 were tested after systemic administration to 1 week old mice. Luciferase assays showed that the cTnT promoter worked in combination with each of the AAV serotype capsids to provide cardiomyocyte-specific gene expression, but AAV-9 followed closely by AAV-8 was the most efficient. AAV9-mediated gene expression from the cTnT promoter was 640-fold greater in the heart compared to the next highest tissue (liver). eGFP fluorescence indicated a transduction efficiency of 96% using AAV-9 at a dose of only 3.15×1010 viral particles per mouse. Moreover, the intensity of cardiomyocyte eGFP fluorescence measured on a cell-by-cell basis revealed that AAV-mediated gene expression in the heart can be modeled as a Poisson distribution; requiring an average of nearly two vector genomes per cell to attain an 85% transduction efficiency.