Effective DNA Markers Research Articles

Assessment of the genetic polymorphism of genus Pinus L. the oligotrophic peat bog "Boloto Mshana"

Aim. To evaluate the molecular genetic polymorphism of representatives of the genus Pinus L. on the territory of the "Boloto Mshana" nature reserve, as well as to test the hypothesis about their possible local hybridization Methods. DNA extraction using CTAB and DNeasy Plant Pro Kit, polymerase chain reaction (PCR) with primers for the chloroplast DNA and genes encoding β-tubulin (TBP markers), electrophoresis of DNA in a polyacrylamide gel with silver nitrate staining. Results. DNA profiles of P. mugo, P. sylvestris and probably P. uliginosa (21 samples in total) were analyzed using one chloroplast DNA marker and two DNA markers based on introns of β-tubulin genes (ТВР, сТВР). The intraspecific genetic polymorphism of the species was compared and the probability of the existence of hybrid forms was investigated. Conclusions. The marker based on the 2nd intron of the β-tubulin genes turned out to be the most effective and informative DNA marker for studying representatives of the Pinus L. genus. P. sylvestris showed less genetic polymorphism by the investigated genetic markers, compared to P. mugo and P. uliginosa. Possible hybrid forms (P. mugo ✕ P. sylvestris) or P. uliginosa were also discovered.

Identification of two female-specific DNA markers in Verasper variegatus

Sex-specific DNA markers are powerful tools for genetic sex identification and sex control breeding of fish. Spotted halibut (Verasper variegatus) is a kind of marine flatfish with important nutritional and economic value, which exhibits significant sex-related growth dimorphism that the female individuals grow faster than the male individuals. However, there is no rapid, effective and universal sex-specific DNA marker used for genetic sex identification and sex control breeding in spotted halibut up to date. In the present study, whole genome resequencing was performed on 17 male and 17 female spotted halibut individuals to identify sex-specific markers. A total of 325.36 Gb and 328.99 Gb data were obtained from females and males, respectively. After reads mapping, sequencing depth and coverage analysis, 359 potential female-specific DNA sequences were identified. Then, after two rounds of verification, two female-specific 66 bp and 68 bp insertions were identified as female-specific markers which can accurately identify the genetic sex of spotted halibut through PCR amplification and 2% agarose gel electrophoresis. Subsequently, these two female-specific DNA markers and the PCR method were further validated using 117 spotted halibut individuals from another breeding population to confirm their genetic sex, which was in accordance with their phenotypic sex determined by histological section of the gonads. This may be the first two rapid, accurate and effective female-specific DNA markers used for genetic sex identification in spotted halibut. The identification of these two female-specific DNA markers will not only provide important genetic evidence to elucidate the sex determination mechanism of spotted halibut, but also help to advance the process of sex control breeding in spotted halibut.

Species Complexes in Capparis (Capparaceae) Resolved with Plastidial Markers

Capparis with about 142 taxa is the largest genus in the angiosperm family Capparaceae, and is of high medicinal and economic importance. Several taxa such as C. cartilaginea, C. cleghornii, C. incanescens, C. moonii, C. roxburghii, C. sepiaria, C. spinosa and C. spinosa subsp. himalayensis are difficult to distinguish from each other based on morphology, and they all have partly overlapping geographic distributions. This study assesses the potential of four plastidial loci (rbcL, matK, trnL-trnF, and psbA-trnH) to resolve three species complexes in Capparis. Successful amplification and sequencing, as well as statistical analyses, revealed matK, trnL-trnF, and their combination to be the most effective DNA markers. With these markers we were able to distinguish different Capparis taxa collected from their natural habitats and from the crude drug market. The species rank of C. himalayensis was reinstated based on morphology and molecular data. The phylogenetic relationships of the poorly known C. danielii and C. incanescens with C. sepiaria were clarified.

Population validation of reproductive gene mutation loci and association with the litter size in Nubian goat

Litter size is an important component trait of doe reproduction. By improving it, production efficiency and economic benefits can be significantly provided. Genetic marker-assisted selection (MAS) based on proven molecular indicators could enhance the efficacy of goat selection, as well as litter size trait. Many molecular markers have been identified that they can be used to improve litter size in different goat breeds. However, the presence and value of these markers vary among goat breeds. In the present study, we used the reported loci on other breeds of goat as candidate loci to detect whether these loci appear in this Nubian goat population; then we proceed to genotype and detect surrounding loci (50 bp) by multiplex PCR and sequencing technology. As a result, 69 mutations (59 SNPs and 10 indels) were screened out from 23 candidate genes in Nubian goat population, 12 loci were significantly associated with the litter size of first-parity individuals; 5 loci were significantly associated with the litter size of second-parity individuals; 3 loci were significantly associated with the litter size of third-parity individuals. In addition, five loci were significantly associated with the average litter size. The additive effect value of KITLG: g.18047318 GA in first parity, KITLG: g.18152042GA in third parity, KISS-1: g.1341674 CG in first parity, and GHR: g.32134187GA in second parity exceed more than 0.40, and the preponderant alleles are G, C, A and G, respectively. Further, linkage disequilibrium analysis of 21 mutation loci shows that 3 haplotype blocks are formed, and the litter size of combination type AACC in KISS-1 gene and AAGG in KITLG gene are significantly lower than that of other combinations genotype in first parity (). These findings can provide effective candidate DNA markers for selecting superior individuals in Nubian goat breeding.

A pioneering approach for non-invasive sex identification of Chinese sturgeon at early stage

The Chinese sturgeon (Acipenser sinensis) is critically endangered in China. Owing to the lack of visible sexual dimorphism and effective DNA markers for sexing in this species, a novel non-invasive method for sex identification in Chinese sturgeons would be helpful for conservation management. The zona pellucida (ZP) gene and sex determining region Y-box 9 (Sox9) gene were considered as candidate genes involved in gonadal differentiation. Here, we first detected the differences in expression of the ZP3.2 and Sox9 genes in the gonads and ventral fins of 107 Chinese sturgeons aged 2, 3, 6, 7, and 9–11 years old, using quantitative real-time polymerase chain reaction (qRT-PCR) to develop non-invasive expression markers. The accuracy of the developed marker was confirmed using endoscopy in another 240 individuals in four different age groups (aged 5–8 years old).The expression levels of the ZP3.2 gene in the ovaries and ventral fins at different ages were significantly (p < 0.05; p < 0.05, respectively) higher than those in the counterparts of males. The expression levels of the Sox9 gene in the testes at different ages were significantly (p < 0.05) higher than those in the ovaries, whereas the expression levels of the Sox9 gene in the male ventral fins were low, similar to those observed in the female ventral fins. Furthermore, a sex identification accuracy of 78.33% to 86.66% for the ZP3.2 gene in the ventral fin was confirmed by conducting endoscopies on individuals of four different age groups.The differential expression of ZP3.2 in the ventral fins of female and male Chinese sturgeon can be used as an effective non-invasive sex indicator in individuals over 2 years of age. This work also provides a novel solution for non-invasive sex identification in other surgeon species.

DNA marker for resistance to Puccinia horiana in chrysanthemum (Chrysanthemum morifolium Ramat.) "Southern Pegasus".

White rust caused by Puccinia horiana Henn. adversely affects chrysanthemum (Chrysanthemum morifolium Ramat.) production. The breeding of resistant varieties is effective in controlling the disease. Here we aimed to develop DNA markers for the strong resistance to P. horiana. We conducted a linkage analysis based on the genome-wide association study (GWAS) method. We employed a biparental population for the GWAS, wherein the single nucleotide polymorphism (SNP) allele frequency could be predicted. The population was derived from crosses between a strong resistant “Southern Pegasus” and a susceptible line. The GWAS used simplex and double-simplex SNP markers selected out of SNP candidates mined from ddRAD-Seq data of an F1 biparental population. These F1 individuals segregated in a 1:1 ratio of resistant to susceptible. Twenty-one simplex SNPs were significantly associated with P. horiana resistance in “Southern Pegasus” and generated one linkage group. These results show the presence of a single resistance gene in “Southern Pegasus”. We identified the nearest SNP marker located 2.2 cM from P. horiana resistance locus and demonstrated this SNP marker-resistance link using an independent population. This is the first report of an effective DNA marker linked to a gene for P. horiana resistance in chrysanthemum.

Genome sequence of Hydrangea macrophylla and its application in analysis of the double flower phenotype.

Owing to its high ornamental value, the double flower phenotype of hydrangea (Hydrangea macrophylla) is one of its most important traits. In this study, genome sequence information was obtained to explore effective DNA markers and the causative genes for double flower production in hydrangea. Single-molecule real-time sequencing data followed by a Hi-C analysis were employed. Two haplotype-phased sequences were obtained from the heterozygous genome of hydrangea. One assembly consisted of 3,779 scaffolds (2.256 Gb in length and N50 of 1.5 Mb), the other also contained 3,779 scaffolds (2.227 Gb in length, and N50 of 1.4 Mb). A total of 36,930 genes were predicted in the sequences, of which 32,205 and 32,222 were found in each haplotype. A pair of 18 pseudomolecules was constructed along with a high-density single-nucleotide polymorphism (SNP) genetic linkage map. Using the genome sequence data, and two F2 populations, the SNPs linked to double flower loci (djo and dsu) were discovered. DNA markers linked to djo and dsu were developed, and these could distinguish the recessive double flower allele for each locus, respectively. The LEAFY gene is a very likely candidate as the causative gene for dsu, since frameshift was specifically observed in the double flower accession with dsu.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

Myostatin (MSTN) Gene Indel Variation and Its Associations with Body Traits in Shaanbei White Cashmere Goat.

Simple SummaryAs a major gene to regulate the muscle mass of animals, Myostatin (MSTN) plays a negative role in regulating the number and size of skeletal myocytes. Additionally, it is reported that mutations of MSTN gene contribute to the double-muscling (DBM) phenomenon. Therefore, mutations of MSTN gene will always be one of the hot spots. A 5 bp indel (c. –120 ins) in the 5’ untranslated region (5’ UTR) of goat MSTN gene was reported to relate to the growth traits of goat. However, all the sample sizes were limited. Herein, this study firstly enlarged the sample size (n = 1074, Shaanbei White Cashmere goat) to uncover the indel location, as well as its association with growing performance. Based on the data, the 5 bp insertion mutation in goat MSTN gene was significantly associated with the body height, height at hip cross, and chest width index in SBWC (p < 0.05), hinted that this insertion could be assigned to an effective molecular marker for growth trait in goat rearing.Myostatin (MSTN) gene, also known as growth differentiation factor 8 (GDF8), is a member of the transforming growth factor-beta super-family and plays a negative role in muscle development. It acts as key points during pre- and post-natal life of amniotes that ultimately determine the overall muscle mass of animals. There are several studies that concentrate on the effect of a 5 bp insertion/deletion (indel) within the 5’ untranslated region (5’ UTR) of goat MSTN gene in goats. However, almost all sample sizes were below 150 individuals. Only in Boer goats, the sample sizes reached 482. Hence, whether the 5 bp indel was still associated with the growth traits of goats in large sample sizes which were more reliable is not clear. To find an effective and dependable DNA marker for goat rearing, we first enlarged the sample sizes (n = 1074, Shaanbei White Cashmere goat) which would enhance the robustness of the analysis and did the association analyses between the 5 bp indel and growth traits. Results uncovered that the 5 bp indel was significantly related to body height, height at hip cross, and chest width index (p < 0.05). In addition, individuals with DD genotype had a superior growing performance than those with the ID genotype. These findings suggested that the 5 bp indel in MSTN gene are significantly associated with growth traits and the specific genotype might be promising for maker-assisted selection (MAS) of goats.

A novel 29 bp insertion/deletion (indel) variant of the &amp;lt;i&amp;gt;LHX3&amp;lt;/i&amp;gt; gene and its influence on growth traits in four sheep breeds of various fecundity

Abstract. Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth and reproduction. Insertion/deletion (indel) is a relatively simple and effective DNA marker. Therefore, four sheep breeds of various fecundity were used to explore the novel indel variants within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep LHX3 gene was found, and three genotypes were detected. Interestingly, the increasing trends of II (insertion/insertion) genotype frequency and I allelic frequency were the same as the growth of the fertility character. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity breed (TS) based on a χ2 test (P &lt; 0.05). Association analyses showed that body length was significantly different in female TS and STHS and that chest width was significantly different for the female TS and male STHS (P &lt; 0.05). These findings suggested that the 29 bp indel could extend the spectrum of genetic variations of the LHX3 gene in sheep and provide a valuable theoretical basis for the marker-assisted selection (MAS) in sheep breeding and genetics.

Development of diagnostic SCAR markers for genomic DNA amplifications in breast carcinoma by DNA cloning of high-GC RAMP-PCR fragments.

Cancer is genetically heterogeneous regarding to molecular genetic characteristics and pathogenic pathways. A wide spectrum of biomarkers, including DNA markers, is used in determining genomic instability, molecular subtype determination and disease prognosis, and estimating sensitivity to different drugs in clinical practice. In a previous study, we developed highly effective DNA markers using improved random amplified polymorphic DNA (RAPD) with high-GC primers, which is a valuable approach for the genetic authentication of medicinal plants. In this study, we applied this effective DNA marker technique to generate genetic fingerprints that detect genomic alterations in human breast cancer tissues and then developed sequence-characterized amplified region (SCAR) markers. Three SCAR markers (BC10-1, BC13-4 and BC31-2) had high levels of genomic DNA amplification in breast cancer. The PHKG2 and RNF40 genes are either overlapping or close to the sequences of SCAR marker BC13-4, while SCAR marker BC10-1 is in the intron and overlap the DPEP1 gene, suggesting that alterations in the expression of these genes could contribute to cancer progression. Screening of breast cancer cell lines showed that the mRNA expression levels for the PHKG2 and DPEP1 were lower in non-tumorigenic mammary epithelial cell MCF10A, but elevated in other cell lines. The DPEP1 mRNA level in invasive ductal carcinoma specimens was significantly higher than that of the adjacent normal tissues in women. Taken together, high-GC RAMP-PCR provides greater efficacy in measuring genomic DNA amplifications, deletion or copy number variations. Furthermore, SCAR markers BC10-1 and BC13-4 might be useful diagnostic markers for breast cancer carcinomas.

Identification of Traditional She Medicine Shi-Liang Tea Species and Closely Related Species Using the ITS2 Barcode

Traditional She medicine is part of China’s cultural heritage and has become remarkably popular worldwide. The Shi-Liang tea is made from the processed leaves of Chimonanthus salicifolius S. Y. Hu and Chimonanthus zhejiangensis M. C. Liu. To ensure the safety and efficacy of Shi-Liang tea, we used DNA barcoding based on the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA to distinguish the original plant sources of Shi-Liang tea from closely related species. All 71 ITS2 sequences were aligned by Clustal-W, and genetic distances were computed using MEGA 6.0 according to the Kimura 2-parameter model. The results indicated that the sequence lengths of ITS2 regions of the original plants of Shi-Liang tea and closely related species ranged from 256 bp to 260 bp. Interspecific genetic distances ranged from 0 to 0.078. The neighbor-joining (NJ) tree showed that the original plants of Shi-Liang tea species can be easily differentiated from closely related species. Distinct molecular differences were found between the secondary structures of ITS2 sequences from Shi-Liang tea and closely related species. The results in the present investigation suggested that the ITS2 could be an effective DNA marker to identify the original plants of Shi-Liang tea and their closely related species. These DNA barcodes can greatly benefit the supervision of the commercial circulation of She medicine.

Relationship between genetic variants of POU1F1, PROP1, IGFBP3 genes and milk performance in Guanzhong dairy goats

The aim of this study was to determine and verify if the potential genetic variations in the POU1F1, PROP1 and IGFBP3 genes could be related to dairy goat milk performance. This study detected the polymorphisms of POU1F1-PstI, POU1F1-DdeI, POU1F1-AluI, PROP1-Hin6I and IGFBP3-XspI loci, and evaluated their associations with milk performance in Guanzhong dairy goats. The present results confirmed the previous genotypes and found three unreported genotypes in Guanzhong dairy goats (e.g. genotype D2D2 at POU1F1-DdeI locus, genotype TC at POU1F1-AluI locus, genotype X2X2 at IGFBP3-XspI locus, respectively). The genotypic frequencies of all analyzed loci were at Hardy-Weinberg equilibrium (P>0.05) except POU1F1-PstI locus (P<0.01). The PIC values of POU1F1-PstI locus and IGFBP3-XspI locus were 0.328 and 0.329, respectively, suggesting that these two loci possessed median polymorphism. Association analysis demonstrated no significant relationship between the POU1F1-PstI, POU1F1-DdeI, PROP1-Hin6I and IGFBP3-XspI loci and milk performance in Guanzhong dairy goats (P>0.05). Interestingly, in the POU1F1-AluI locus, this SNP was significantly associated with a total of six milk traits (P<0.05). Moreover, the individuals with genotype TT possessed superior morning milk fat content, afternoon milk fat content and average milk fat when compared with those of genotype TC (P=0.026, P=0.029, P=0.036, respectively); Consistently, genotype TT had higher morning milk acidity, afternoon milk acidity and average milk acidity than genotype TC (P=0.028, P=0.027, P=0.038, respectively). These findings suggested that the POU1F1-AluI locus had significantly effect on milk performance, and genotype TT could become an effective DNA marker for senior milk fat content or acidity, which could benefit to dairy goat selection and breeding through marker-assisted selection (MAS).

An improved DNA marker technique for genetic characterization using RAMP-PCR with high-GC primers.

Random amplified polymorphic DNA (RAPD) is a widely used molecular marker technique. As traditional RAPD has poor reproducibility and productivity, we previously developed an improved RAPD method (termed RAMP-PCR), which increased the reproducibility, number of bands, and efficiency of studies on polymorphism. To further develop the efficiency of this method, we used high-GC content primers for improved RAMP-PCR with DNA samples from Lonicera japonica. Comparison of amplification profiles obtained by standard RAPD primers with those obtained by regular PCR and RAMP-PCR, and high-GC primers with regular PCR and RAMP-PCR showed that the average number of bands and polymorphisms per primer gradually and significantly increased (from 6.4 to 15.0 and from 4.6 to 10.2, respectively). Cluster dendrograms showed similar results, indicating that this new method is consistent and reproducible. A total of 22 samples from different species, including plants, animals, and humans, were used for RAMP-PCR with high-GC primers. Multiple bands were successfully amplified from all samples, demonstrating that this method is a reliable technique with consistent results and may be of general interest in studies on different genera and species. We developed highly effective DNA markers, which can provide a more effective and potentially valuable approach than traditional RAPD for the genetic identification of various organisms, particularly of medicinal plants.

Molecular specificity and detection for Pseudanabaena (cyanobacteria) species based on rbcLX sequences

In decades, Pseudanabaena species have been frequently reported as cyanobacterial bloom components. However, these species are always overlooked because they cannot be observed easily owing to their small sizes. This study aimed to characterize Pseudanabaena species and detect them in field waters by developing an effective DNA marker. A region with approximately 600 bp in the rbcLX sequences was specific to Pseudanabaena species alone compared with other cyanobacterial genera. Therefore, new primers specific for Pseudanabaena were generated. By using this molecular tool, seasonal and spatial dynamics of Pseudanabaena populations of six sites in Lushui Reservoir, China were measured from July 2010 to August 2011. Pseudanabaena species existed in the reservoir throughout the year, and cell abundance ranged between 104 and 106 equivalent cells/L, with the peak at 8.07 × 106 equivalent cells/L. The seasonal dynamics pattern of Pseudanabaena was similar to that of Microcystis but showed a slight lag at the transitional points of water temperature in the reservoir.

Genetic analysis of prolactin gene in Pakistani cattle

Prolactin (PRL) is a polypeptide hormone, secreted mainly by the anterior pituitary gland. It is involved in many endocrine activities. The key functions of PRL are related to reproduction and lactation in mammals. To ascertain the presence of polymorphisms in the bovine PRL gene (bPRL), the bPRL gene was sequenced. Five mutations were identified in exonic region and eleven in associated intronic regions in 100 cattle from four Pakistani cattle breeds. Haplotype of predicted amino acid changes represent a common alteration at codon 222 from R-Arginine into K-Lysine in all four breeds. Significant statistical variations were observed in the distribution of single nucleotide polymorphism (SNP) in various cattle populations. However, on basis of present study, an association of these SNPs with milk performance traits in four Pakistani cow breeds cannot be truly replicated but at least can be effective DNA markers for some of the breeds studied. Linkage analysis between these SNPs on larger populations can be useful for the association with milk production traits. Furthermore, present study may be used for marker-assisted selection and management in cattle breeding program in local cattle breeds.

Potential use of DNA barcoding for the identification of Salvia based on cpDNA and nrDNA sequences

An effective DNA marker for authenticating the genus Salvia was screened using seven DNA regions (rbcL, matK, trnL–F, and psbA–trnH from the chloroplast genome, and ITS, ITS1, and ITS2 from the nuclear genome) and three combinations (rbcL+matK, psbA–trnH+ITS1, and trnL–F+ITS1). The present study collected 232 sequences from 27 Salvia species through DNA sequencing and 77 sequences within the same taxa from the GenBank. The discriminatory capabilities of these regions were evaluated in terms of PCR amplification success, intraspecific and interspecific divergence, DNA barcoding gaps, and identification efficiency via a tree-based method. ITS1 was superior to the other marker for discriminating between species, with an accuracy of 81.48%. The three combinations did not increase species discrimination. Finally, we found that ITS1 is a powerful barcode for identifying Salvia species, especially Salvia miltiorrhiza.

Applying DNA barcodes for identification of plant species in the family Araliaceae

An effective DNA marker in authentication of the family Araliaceae was screened out of the five DNA regions (matK, rbcL, ITS2, psbA-trnH and ycf5). In the present study, 1113 sequences of 276 species from 23 genera (Araliaceae) were collected from DNA sequencing and GenBank, in which 16 specimens were from 5 provinces in China and Japan. All of the sequences were assessed in the success rates of PCR amplifications, intra- and inter-specific divergence, DNA barcoding gaps and efficiency of identification. Compared with other markers, ITS2 showed superiority in species discrimination with an accurate identification of 85.23% and 97.29% at the species and genus levels, respectively, in plant samples from the 589 sequences derived from Araliaceae. Consequently, as one of the most popular phylogenetic markers, our study indicated that ITS2 was a powerful barcode for Araliaceae identification.

Genetic Kinship Investigation from Blood Groups to DNA Markers

The forensic application of hereditary characteristics became possible after the discovery of human blood groups by Karl Landsteiner in 1901. The foundation for their use in kinship investigation was laid by Emil von Dungern and Ludwig Hirschfeld in 1910 by clarification of the inheritance of the ABO groups. Up to the middle of the 20th century further red cell membrane systems were discovered. From the 1920s Fritz Schiff and Georg Strassmann fought for the introduction of blood groups into forensic kinship investigation. A new era of hemogenetics was opened from 1955 as genetic polymorphisms were described in serum proteins. Starting in 1958 there followed the complex HLA system of white blood cells, which from 1963 was joined by polymophisms in erythrocyte enzymes. Therefore, from the 1980s, it was possible to clarify the majority of kinship cases with a combination of conventional markers. From 1990 to 2000 the conventional markers were gradually replaced by the more effective DNA markers. Simultaneously typing shifted from the phenotype level to the genotype level. The genomic structure of con ventional genetic markers could also now be explained. As a reflection of scientific progress the legal situation also changed, particularly in the form of the official guidelines for kinship investigation.

Analysis of genetic diversity and phylogenetic relationship of red deer subspecies in XinJiang, China

Polymorphisms for seven microsatellite loci in three red deer subspecies (9 populations) found in XinJiang were detected by polymerase chain reaction (PCR), 12% nondenaturation polyacrylamide gel electrophoresis and the Sanguinetti silver staining method. Numbers of alleles, average effective numbers of alleles (E) and the average rate of homozygosity, allelic frequencies of seven microsatellite loci, polymorphism information content (PIC), mean heterozygosity (H) and genetic distances among the populations were calculated for each population. Dendrograms were constructed based on genetic distances by the neighbor-joining method (NJ), utilizing molecular evolutionary genetics analysis software PHYLIP (3.6). The phylogenetic tree was constructed based on allelic frequencies using maximum likelihood (ML); the bootstrap value was estimated by bootstrap test in the tree. Lastly, phylogenesis was analyzed. The results showed that four of the seven microsatellite loci were highly polymorphic, but BMS2508 and Celjp0023 showed no polymorphism and BM5004 was a neutral polymorphism. It is our conclusion that the four microsatellite loci are effective DNA markers for the analysis of genetic diversity and phylogenetic relationships among the three red deer subspecies. The mean PIC, H and E-values across the microsatellite loci were 0.5393, 0.5736 and 2.64, which showed that these microsatellite loci are effective DNA markers for the genetic analysis of red deer. C.e. songaricus populations from Regiment 104, 151 and Hami are clustered together. C.e. yarkandensis populations from Regiment 35, Xaya and Alaer are clustered together. These two clusters also cluster together. Lastly, C.e. sibiricus populations from Burqin, Regiment 188 and the first two clusters were clustered together. The phylogenetic relationship among different red deer populations is consistent with the known origin, history of breeding and geographic distributions of populations.