Duplex-specific Nuclease Research Articles

Integration of DNA bio-gates and duplex-specific nuclease signal amplification: towards electrochemiluminescence detection of survivin mRNA.

Using the DNA bio-gate and duplex-specific nuclease assisted target recycling, a facile electrochemiluminescence assay was developed for the sensitive detection of survivin mRNA.

A G-quadruplex DNA-based, label-free and ultrasensitive strategy for microRNA detection.

MicroRNAs (miRNAs) have been considered to be potent biomarkers for early disease diagnosis and for cancer therapy. The rapid and selective detection of miRNAs without reverse transcription and labelling is highly desired. Herein, we report a simple and label-free miRNA detection method that is based on the Duplex-Specific Nuclease (DSN)-Assisted simple target miRNA recycling procedure. The interaction of the G-quadruplex DNA structure with N-methyl mesoporphyrin IX (NMM) led to a label-free signal output. Under the optimised conditions, this method allowed for simple, rapid, and sequence-specific detection of miR-141 over a dynamic range from 1 fM to 100 nM with a linear range from 1 pM to 100 nM. Moreover, our method offered an excellent capacity to discriminate between miRNA family members with just one mismatched nucleotide. This simple and label-free strategy holds great potential in applications in biomedical research and in early clinical diagnostics.

Multiplexed and amplified electronic sensor for the detection of microRNAs from cancer cells.

The detection of microRNA expression profiles plays an important role in early diagnosis of different cancers. On the basis of the employment of redox labels with distinct potential positions and duplex specific nuclease (DSN)-assisted target recycling signal amplifications, we have developed a multiplexed and convenient electronic sensor for highly sensitive detection of microRNA (miRNA)-141 and miRNA-21. The sensor is constructed by self-assembly of thiol-modified, redox species-labeled hairpin probes on the gold sensing electrode. The hybridizations between the target miRNAs and the surface-immobilized probes lead to the formation of RNA/DNA duplexes, and DSN subsequently cleaves the redox-labeled hairpin probes of the RNA/DNA duplexes to recycle the target miRNAs and to generate significantly amplified current suppression at different potentials for multiplexed detection of miRNA-141 and miRNA-21 down to 4.2 and 3.0 fM, respectively. The sensor is also highly selective toward the target miRNAs and can be employed to monitor miRNAs from human prostate carcinoma (22Rv1) and breast cancer (MCF-7) cell lysates simultaneously. The sensor reported here thus holds great potential for the development of multiplexed, sensitive, selective, and simple sensing platforms for simultaneous detection of a variety of miRNA biomarkers for clinic applications with careful selection of the labels.

An ultrasensitive electrochemical miRNAs sensor based on miRNAs-initiated cleavage of DNA by duplex-specific nuclease and signal amplification of enzyme plus redox cycling reaction

In this work, we reported a simple and ultrasensitive electrochemical sensing platform for microRNAs (miRNAs) detection by combination of duplex-specific nuclease (DSN) with signal amplification of alkaline phosphatase (ALP) plus redox cycling reaction. Specifically, biotinylated single-stranded DNA capture probes (CPs) immobilized on gold electrodes allowed streptavidin-conjugated alkaline phosphatase (SA-ALP) to be attached, facilitating the production of electrochemically active p-aminophenol (p-AP) from p-aminophenyl phosphate (p-APP) substrate. The resulting p-AP could be cycled by tris(carboxyethyl)phosphine (TCEP) after its electro-oxidization, enabling an increase in the anodic current of p-AP (known as p-AP redox cycling). If the CPs formed duplexes with miRNAs by hybridization, DNA in the DNA-miRNAs duplexes would be cleaved by DSN, making the biotin groups stripping from the electrode surface and the SA-ALP molecules incapable of attachment onto the electrode. In this process, miRNAs strands remained intact and could be released back to the sample solution for recycling. The oxidation current of p-AP decreased significantly with the increase of miRNAs concentration. As a result, a detection limit of 0.2fM for miRNA-21 detection was achieved.

Quantum dots and duplex-specific nuclease enabled ultrasensitive detection and serotyping of Dengue viruses in one step in a single tube

Leveraging on the enzymatic processing of Dengue virus (DV) RNA hybridized quantum dot-capped DNA capture probes (QD–CPs), an ultrasensitive assay for the detection and serotyping of DVs is described in the report. Briefly, DV-specific DNA CPs are first capped by QDs and then conjugated to magnetic beads. In a sample solution, strands of DV RNA form heteroduplexes with the QD–CPs on the magnetic beads. The CPs together with the QDs in the heteroduplexes are subsequently cleaved off the magnetic beads by a duplex-specific nuclease (DSN), releasing the QDs to the solution, freeing the target RNA strands, and availing them for another around of hybridization with the remaining QD–CPs. After removing the magnetic beads along with unreacted (uncleaved) QD–CPs by using a permanent magnet, ultrasensitive fluorescent detection of DV is realized through the cleaved QDs. Serotyping of DV is accomplished by a judicious design of the QD–CPs. The assay combines excellent signal generation by the highly fluorescent QDs and the effortlessness of utilizing magnetic beads in the removal of the unreacted QD–CPs. The highly efficient DSN cleavage in conjunction with its excellent mismatch discrimination ability permits serotyping of DVs in one tube with excellent sensitivity and selectivity.

A dual-amplified electrochemical detection of mRNA based on duplex-specific nuclease and bio-bar-code conjugates

On the basis of strong preference for cleaving double-stranded DNA or DNA in DNA:RNA heteroduplexes of duplex-specific nuclease (DSN), a dual-amplified electrochemical detection of mRNA was developed in this article, by coupling the enhancement of DSN and bio-bar-code conjugates. Capture probe was linked with magnetic nanoparticles (MNPs) at its 5′ end and bio-bar-code at its 3′ end. In the presence of target surviving mRNA, all hybridized S1 strands were cleaved off the biosensor by the DSN, and the bio-bar-code probe with CdS nanoparticles (CdS NPs) was released into the solution. The metal sulfide nanoparticles were measured by anodic stripping voltammetry (ASV) subsequently. This assay exhibited high sensitivity and selectivity with a detection limit of 0.48fM. In addition, we proved that this simple and cost-effective strategy is capable of detecting the target in complicated biological samples and holds great potential application in biomedical research and clinical diagnostics.

First Detection of Ligustrum necrotic ringspot virus, Cucumber mosaic virus, and Alternanthera mosaic virus in Mazus reptans in the United States.

Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans 'Alba' with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3' region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three 'Alba' in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of 'Alba' by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals.

Improving the genetic representation of rare taxa within complex microbial communities using DNA normalization methods.

Complex microbial communities typically contain a large number of low abundance species, which collectively, comprise a considerable proportion of the community. This 'rare biosphere' has been speculated to contain keystone species and act as a repository of genomic diversity to facilitate community adaptation. Many environmental microbes are currently resistant to cultivation, and can only be accessed via culture-independent approaches. To enhance our understanding of the role of the rare biosphere, we aimed to improve their metagenomic representation using DNA normalization methods, and assess normalization success via shotgun DNA sequencing. A synthetic metagenome was constructed from the genomic DNA of five bacterial species, pooled in a defined ratio spanning three orders of magnitude. The synthetic metagenome was fractionated and thermally renatured, allowing the most abundant sequences to hybridize. Double-stranded DNA was removed either by hydroxyapatite chromatography, or by a duplex-specific nuclease (DSN). The chromatographic method failed to enrich for the genomes present in low starting abundance, whereas the DSN method resulted in all genomes reaching near equimolar abundance. The representation of the rarest member was increased by approximately 450-fold. De novo assembly of the normalized metagenome enabled up to 18.0% of genes from the rarest organism to be assembled, in contrast to the un-normalized sample, where genes were not able to be assembled at the same sequencing depth. This study has demonstrated that the application of normalization methods to metagenomic samples is a powerful tool to enrich for sequences from rare taxa, which will shed further light on their ecological niches.

An ultrasensitive label-free electrochemical biosensor for microRNA-21 detection based on a 2'-O-methyl modified DNAzyme and duplex-specific nuclease assisted target recycling.

Based on a highly efficient 2'-O-methyl modified G-quadruplex-hemin DNAzyme and duplex-specific nuclease (DSN) assisted target recycling, a novel label-free electrochemical biosensor for microRNA-21 (miR-21) detection is developed here. By employing the strategy, this DNA biosensor can detect as low as 8 aM miR-21 and exhibits high discrimination ability even against a single-base mismatch.

Development of Normalized Cdna Library from Fusarium Wilt Infected Roots of a Tolerant Banana Genotype 'Calcutta-4' Musa acuminata ssp. burmannicoides

Management of the most devasting disease, Fusarium wilt of banana, caused by the fungus Fusarium oxysporum f. sp., cubense, is a challenge to the plant pathologist and the banana grower. Currently, genomics is providing the way for understanding plant defense mechanism, having acquired an important place in crop improvement. To identify the relevant genes and to understand the defense mechanism induced during Fusarium wilt infection, a normalized cDNA library was constructed from infected root samples of a tolerant banana genotype, Musa acuminata spp. burmannicoides 'Calcutta-4', by duplex specific nuclease (DSN) based normalization, using the SMART (switching mechanism at 5' end of RNA transcript) full-length cDNA construction method. Sequencing and analysis of 600 clones revealed 392 non-redundant clones. In all, of 88% of the sequences were annotated using Musa genome database, and the remaining 12% were identified as novel loci not annotated. We observed several resistance genes, ROS scavenging genes and genes involved in ubiquitin-proteosome pathway in this study. These genes may have a possible role against Foc infection. These sequences would enrich the EST data developed against specific stress, which is an indispensable tool for predicting functional genes and understanding the defense mechanism.

Comparison of RNA-Seq by poly (A) capture, ribosomal RNA depletion, and DNA microarray for expression profiling.

BackgroundRNA sequencing (RNA-Seq) is often used for transcriptome profiling as well as the identification of novel transcripts and alternative splicing events. Typically, RNA-Seq libraries are prepared from total RNA using poly(A) enrichment of the mRNA (mRNA-Seq) to remove ribosomal RNA (rRNA), however, this method fails to capture non-poly(A) transcripts or partially degraded mRNAs. Hence, a mRNA-Seq protocol will not be compatible for use with RNAs coming from Formalin-Fixed and Paraffin-Embedded (FFPE) samples.ResultsTo address the desire to perform RNA-Seq on FFPE materials, we evaluated two different library preparation protocols that could be compatible for use with small RNA fragments. We obtained paired Fresh Frozen (FF) and FFPE RNAs from multiple tumors and subjected these to different gene expression profiling methods. We tested 11 human breast tumor samples using: (a) FF RNAs by microarray, mRNA-Seq, Ribo-Zero-Seq and DSN-Seq (Duplex-Specific Nuclease) and (b) FFPE RNAs by Ribo-Zero-Seq and DSN-Seq. We also performed these different RNA-Seq protocols using 10 TCGA tumors as a validation set.The data from paired RNA samples showed high concordance in transcript quantification across all protocols and between FF and FFPE RNAs. In both FF and FFPE, Ribo-Zero-Seq removed rRNA with comparable efficiency as mRNA-Seq, and it provided an equivalent or less biased coverage on gene 3′ ends. Compared to mRNA-Seq where 69% of bases were mapped to the transcriptome, DSN-Seq and Ribo-Zero-Seq contained significantly fewer reads mapping to the transcriptome (20-30%); in these RNA-Seq protocols, many if not most reads mapped to intronic regions. Approximately 14 million reads in mRNA-Seq and 45–65 million reads in Ribo-Zero-Seq or DSN-Seq were required to achieve the same gene detection levels as a standard Agilent DNA microarray.ConclusionsOur results demonstrate that compared to mRNA-Seq and microarrays, Ribo-Zero-Seq provides equivalent rRNA removal efficiency, coverage uniformity, genome-based mapped reads, and consistently high quality quantification of transcripts. Moreover, Ribo-Zero-Seq and DSN-Seq have consistent transcript quantification using FFPE RNAs, suggesting that RNA-Seq can be used with FFPE-derived RNAs for gene expression profiling.Electronic supplementary materialThe online version of this article (doi: 10.1186/1471-2164-15-419) contains supplementary material, which is available to authorized users.

Selective and flexible depletion of problematic sequences from RNA-seq libraries at the cDNA stage.

BackgroundA major hurdle to transcriptome profiling by deep-sequencing technologies is that abundant transcripts, such as rRNAs, can overwhelm the libraries, severely reducing transcriptome-wide coverage. Methods for depletion of such unwanted sequences typically require treatment of RNA samples prior to library preparation, are costly and not suited to unusual species and applications. Here we describe Probe-Directed Degradation (PDD), an approach that employs hybridisation to DNA oligonucleotides at the single-stranded cDNA library stage and digestion with Duplex-Specific Nuclease (DSN).ResultsTargeting Saccharomyces cerevisiae rRNA sequences in Illumina HiSeq libraries generated by the split adapter method we show that PDD results in efficient removal of rRNA. The probes generate extended zones of depletion as a function of library insert size and the requirements for DSN cleavage. Using intact total RNA as starting material, probes can be spaced at the minimum anticipated library size minus 20 nucleotides to achieve continuous depletion. No off-target bias is detectable when comparing PDD-treated with untreated libraries. We further provide a bioinformatics tool to design suitable PDD probe sets.ConclusionWe find that PDD is a rapid procedure that results in effective and specific depletion of unwanted sequences from deep-sequencing libraries. Because PDD acts at the cDNA stage, handling of fragile RNA samples can be minimised and it should further be feasible to remediate existing libraries. Importantly, PDD preserves the original RNA fragment boundaries as is required for nucleotide-resolution footprinting or base-cleavage studies. Finally, as PDD utilises unmodified DNA oligonucleotides it can provide a low-cost option for large-scale projects, or be flexibly customised to suit different depletion targets, sample types and organisms.Electronic supplementary materialThe online version of this article (doi: 10.1186/1471-2164-15-401) contains supplementary material, which is available to authorized users.

Absolute and Direct MicroRNA Quantification Using DNA–Gold Nanoparticle Probes

DNA-gold nanoparticle probes are implemented in a simple strategy for direct microRNA (miRNA) quantification. Fluorescently labeled DNA-probe strands are immobilized on PEGylated gold nanoparticles (AuNPs). In the presence of target miRNA, DNA-RNA heteroduplexes are formed and become substrate for the endonuclease DSN (duplex-specific nuclease). Enzymatic hydrolysis of the DNA strands yields a fluorescence signal due to diffusion of the fluorophores away from the gold surface. We show that the molecular design of our DNA-AuNP probes, with the DNA strands immobilized on top of the PEG-based passivation layer, results in nearly unaltered enzymatic activity toward immobilized heteroduplexes compared to substrates free in solution. The assay, developed in a real-time format, allows absolute quantification of as little as 0.2 fmol of miR-203. We also show the application of the assay for direct quantification of cancer-related miR-203 and miR-21 in samples of extracted total RNA from cell cultures. The possibility of direct and absolute quantification may significantly advance the use of microRNAs as biomarkers in the clinical praxis.

Highly Sensitive and Selective Strategy for MicroRNA Detection Based on WS2 Nanosheet Mediated Fluorescence Quenching and Duplex-Specific Nuclease Signal Amplification

MicroRNAs (miRNAs) play vital roles in physiologic and pathologic processes and are significant biomarkers for disease diagnostics and therapeutics. However, rapid, low-cost, sensitive, and selective detection of miRNAs remains a challenge because of their short length, sequence homology, and low abundance. Herein, we report for the first time that WS2 nanosheet can exhibit differential affinity toward short oligonucleotide fragment versus ssDNA probe and act as an efficient quencher for adsorbed fluorescent probes. This finding is utilized to develop a new strategy for simple, sensitive, and selective detection of miRNA by combining WS2 nanosheet based fluorescence quenching with duplex-specific nuclease signal amplification (DSNSA). This assay exhibits highly sensitive and selective with a detection limit of 300 fM and even discriminate single-base difference between the miRNA family members. The result indicates that this simple and cost-effective strategy holds great potential application in biomedical research and clinical diagnostics.

Amplified fluorescence sensing of miRNA by combination of graphene oxide with duplex-specific nuclease

A graphene oxide-based fluorescent sensing system for sensitive detection of miRNA with a duplex-specific nuclease-aided signal amplification strategy.

Enzyme-assisted target recycling (EATR) for nucleic acid detection.

Fast, reliable and sensitive methods for nucleic acid detection are of growing practical interest with respect to molecular diagnostics of cancer, infectious and genetic diseases. Currently, PCR-based and other target amplification strategies are most extensively used in practice. At the same time, such assays have limitations that can be overcome by alternative approaches. There is a recent explosion in the design of methods that amplify the signal produced by a nucleic acid target, without changing its copy number. This review aims at systematization and critical analysis of the enzyme-assisted target recycling (EATR) signal amplification technique. The approach uses nucleases to recognize and cleave the probe-target complex. Cleavage reactions produce a detectable signal. The advantages of such techniques are potentially low sensitivity to contamination and lack of the requirement of a thermal cycler. Nucleases used for EATR include sequence-dependent restriction or nicking endonucleases or sequence independent exonuclease III, lambda exonuclease, RNase H, RNase HII, AP endonuclease, duplex-specific nuclease, DNase I, or T7 exonuclease. EATR-based assays are potentially useful for point-of-care diagnostics, single nucleotide polymorphisms genotyping and microRNA analysis. Specificity, limit of detection and the potential impact of EATR strategies on molecular diagnostics are discussed.

A highly sensitive and selective homogenous assay for profiling microRNA expression

A highly sensitive and selective homogeneous microRNA (miRNA) assay is described in this report. It is based on the cleavage of DNAzyme moieties from miRNA-hybridized DNAzyme-capped capture probes (DZ-CPs) from magnetic beads by a duplex-specific nuclease (DSN). After removing the magnetic beads together with the unreacted DZ-CPs by using a permanent magnet, amplified colorimetric detection of the target miRNA is realized through the cleaved DNAzyme moieties-catalyzed oxidation of 3,3′,5,5′-tetramethylbenzidine. The exceptional amplification power of the DSN and the cumulative nature of the signal generation process permit the colorimetric detection of miRNAs down to subfemtomolar levels. The isothermal amplification scheme together with the simple assay protocol makes direct profiling miRNA in real-world samples possible.

A Highly Sensitive and Selective Electrochemical Biosensor for Direct Detection of MicroRNAs in Serum

On the basis of hybridized target microRNA (miRNA) strand initiated cleavage of hybridized deoxyribonucleic acid (DNA) capture probes (CPs) by a duplex-specific nuclease (DSN), a highly sensitive and selective label-free miRNA biosensor is developed in this article. Briefly, thiolated DNA CPs are immobilized onto a gold electrode through self-assembly. The electrode is then hybridized to a sample solution containing the target miRNA. The hybridized CPs in the miRNA-CP duplexes are simultaneously cleaved by the DSN, releasing the target miRNA strands back to the sample solution. The released target miRNA strands again hybridize with the remaining CPs on the electrode, thus forming an isothermal amplification cycle. The distinct difference in electrochemical impedance between a control and the DSN cleaved biosensor allows label-free detection of miRNA down to femtomolar levels. The mismatch discrimination ability of the DSN permits miRNA expression to be profiled with high selectivity. The exceptional amplification power of the DSN along with the simple assay protocol makes direct miRNA expression profiling possible in real-world samples with minimal or no sample pretreatments. Attempts are made in direct profiling circulating miRNAs in serum and miRNAs in total RNA extracted from cancer cells.

A new method for stranded whole transcriptome RNA-seq

This report describes an improved protocol to generate stranded, barcoded RNA-seq libraries to capture the whole transcriptome. By optimizing the use of duplex specific nuclease (DSN) to remove ribosomal RNA reads from stranded barcoded libraries, we demonstrate improved efficiency of multiplexed next generation sequencing (NGS). This approach detects expression profiles of all RNA types, including miRNA (microRNA), piRNA (Piwi-interacting RNA), snoRNA (small nucleolar RNA), lincRNA (long non-coding RNA), mtRNA (mitochondrial RNA) and mRNA (messenger RNA) without the use of gel electrophoresis. The improved protocol generates high quality data that can be used to identify differential expression in known and novel coding and non-coding transcripts, splice variants, mitochondrial genes and SNPs (single nucleotide polymorphisms).

Construction and sequence analysis of a normalized full-length cDNA library of Dendrobium officinale

In order to obtain functional genes, a normalized stems cDNA library was constructed from medicinal plant Dendrobium officinale. SMART (switching mechanism at 5' end of RNA transcript) cDNA synthesis combined with DSN (duplex-specific nuclease) normalization was applied to construct the normalized full-length cDNA library of D. officinale. The titer of cDNA library was about 1.3 x 10(6) cfu x mL(-1) and the average insertion size was about 1.5 kb with high recombination rate (93.9%). Random selected 163 positive clones were sequenced at single side. Bio-information analysis indicated that 147 from 150 high-quality unique sequences matched corresponding homologous proteins, and they participated in various biological processes based on GO (gene ontology). There were 8 clones with complete coding sequence, which presumed to be full-length genes. These results showed preliminarily that we successfully constructed a normalized full-length cDNA library of D. officinale which could be used to screen the functional genes related to metabolic pathways of medicinal ingredients.