dsRNA Bands Research Articles

Investigation of Leishmania RNA Virus 2 in Leishmania major and Leishmania tropica Strains Isolated from Cutaneous Leishmaniasis Patients in Türkiye

Leishmania RNA virus (LRV) is a double-stranded RNA (dsRNA) virus that is thought to contribute to the severe inflammatory response of the causative Leishmania parasite in the mammalian host by being present in many isolates of Leishmania spp. In our study, it was aimed to obtain data on the presence of Leishmania RNA Virus 2 (LRV2), which is thought to cause a change in the clinical course of leishmaniasis, in Leishmania major and Leishmania tropica isolates isolated from cutaneous leishmaniasis (CL) patients in Türkiye. Leishmania strains stored in liquid nitrogen tank by cryopreservation in Manisa Celal Bayar University Faculty of Medicine Parasite Bank were resuscitated under suitable conditions and cultivated in NNN and RPMI-1640 media. Then, the isolates were allowed to enter the logarithmic phase in a 26ºC incubator and DNA isolations were made using the "High Pure PCR Template Preparation Kit". Real-time polymerase chain reaction (Rt-PCR) melting analyzes were applied to the DNAs obtained by using primers and probes specific to the internal transcribed spacer-1 (ITS-1) gene region of Leishmania. After RNA isolation from promastigote suspension, cDNA synthesis was performed by reverse transcription. After gel electrophoresis with PCR amplification products, dsRNA band formation was evaluated in terms of LRV2 positivity under ultraviolet light. Among the 20 examined Leishmania spp. isolates (10 L.tropica and 10 L.major), four (three L.tropica, one L.major) were found to be positive for the presence of LRV2. Although the mechanism of LRV in recent studies has not been fully understood, it is known that it exacerbates the clinic of the disease and even has an effect on the formation of drug resistance by the parasite. It is important to obtain data on the presence of LRV in our country and to contribute to various clinical, drug development, prevalence studies, diagnosis and treatment of the disease in the future.

Prevalence and diversity of mycoviruses occurring in Chinese Lentinula edodes germplasm resource

Incidence and banding patterns of virus-like dsRNA elements in 215 Chinese genetically diverse Lentinula edodes strains collected from wide geographic distribution (or producing areas) were first investigated, and 17 viruses were identified including eight novel viruses. The results revealed a 63.3% incidence of dsRNA elements in the cultivated strains and a 67.2% incidence in the wild strains. A total of 10 distinguishable dsRNAs ranging from 0.6 to 12 kbp and 12 different dsRNA patterns were detected in the positive strains. The molecular information of these dsRNA elements was characterized, and the molecular information of the other 12 different viral sequences with (+) ssRNA genome was revealed in four L. edodes strains with complex dsRNA banding patterns. RT-PCR was also done to verify the five dsRNA viruses and 12 (+) ssRNA ones. The results presented may enrich our understanding of L. edodes virus diversity, and will promote further research on virus-host interactions. ImportanceViral infections involve complicated interactions including benign, harmful or possibly beneficial to hosts. Sometimes environment could lead to a transition in lifestyles from persistent to acute, resulting in a disease phenotype. The quality of spawn, such as the vulnerability to infection of viruses, is therefore important for mushroom production. Lentinula edodes, a wood rot basidiomycete fungus, was widely cultivated in the world for its edible and medicinal properties. In this study, the profile of dsRNA elements from Chinese genetically diverse L. edodes strains collected from wide geographic distribution or producing areas was first investigated. The molecular information of the dsRNA elements was characterized. Additionally, 12 different viral sequences with (+) ssRNA genome from four L. edodes strains with complex dsRNA banding patterns were identified. The results presented here will broaden our knowledge about mushroom viruses, and promote further studies of L. edodes production and the interaction between viruses and L. edodes.

Novel and diverse mycoviruses co-infecting a single strain of the phytopathogenic fungus Alternaria dianthicola.

Alternaria dianthicola is a pathogenic fungus that causes serious leaf or flower blight on some medicinal plants worldwide. In this study, multiple dsRNA bands in the range of 1.2-10 kbp were found in a Alternaria dianthus strain HNSZ-1, and eleven full-length cDNA sequences of these dsRNA were obtained by high-throughput sequencing, RT-PCR detection and conventional Sanger sequencing. Homology search and phylogenetic analyses indicated that the strain HNSZ-1 was infected by at least nine mycoviruses. Among the nine, five viruses were confirmed to represent novel viruses in the families Hypoviridae, Totiviridae, Mymonaviridae and a provisional family Ambiguiviridae. Virus elimination and horizontal transmission indicated that the (-) ssRNA virus, AdNSRV1, might be associated with the slow growth and irregular colony phenotype of the host fungus. As far as we know, this is the first report for virome characterization of A. dianthus, which might provide important insights for screening of mycovirus for biological control and for studying of the interactions between viruses or viruses and their host.

High prevalence of CsRV2 in cultured Callinectes danae: Potential impacts on soft-shell crab production in Brazil

Crabs can be infected by a variety of pathogenic micro-organisms but the most damaging are viruses. Naturally-occurring Callinectes sapidus reovirus 1 (CsRV1) is thought to contribute to mortality of Callinectes sapidus in soft crab culture in the USA. In Brazil, soft crabs are frequently produced using Callinectes danae, which suffers a similar rate of mortality in culture as C. sapidus. This study investigated whether CsRV1 could be detected in healthy or dead Callinectes danae from Paraná, Brazil and kept in captivity, we also evaluated the relationship between viral infection, and biochemical and behavioral parameters. C. danae from Paranaguá Bay were kept in a recirculation system for 14 days and subjected to weekly biochemical analyses and a reflex action mortality predictors (RAMP) test. RT-qPCR assays for CsRV1 were negative for all samples. However, electrophoretic analysis of extracted RNA from some crabs showed a pattern of 12 dsRNA bands that indicated intense infection by a reovirus with a genome organization different from CsRV1. The banding pattern was indistinguishable from a putative novel reovirus detected in C. sapidus in Rio Grande do Sul, Brazil, provisionally called CsRV2. The prevalence of dsRNA of CsRV2 showed no significant difference between crabs that died and survived. Interestingly, the presence of CsRV2 dsRNA was correlated with a significant reduction in glycogen concentration in hepatopancreas and a decrease in reflex action. The results obtained in this study are an early glimpse of the occurrence of reoviruses in C. danae and their potential effects in soft-shell crab systems in Brazil.

Screening of some plant pathogenic fungi for the presence of dsRNA mycoviruses

Mycoviruses can infect many fungi and some may cause hypovirulence, which is a common phenomenon used in the biological control of certain fungal diseases of the plants. The most successful example regarding the use of mycoviruses and hypovirulent strains in biological control is the chestnut blight. In this study, the isolates of fungi, namely Phomopsis viticola from grapevine, Verticillium dahliae from cotton and olive, Rhizoctonia solani from cotton and Leucostoma spp., from cherry were screened for the presence of dsRNA mycoviruses. Isolation of dsRNAs was performed and dsRNA bands were analyzed by agarose gel electrophoresis. Putative dsRNA bands were detected in eight of 80 P. viticola isolates from grapevine, one of 50 V. dahliae isolates from olive, three of 50 V. dahliae isolates from cotton, six of 50 R. solani isolates from cotton and three of 50 Leucostoma spp., isolates from cherry. The estimated molecular sizes of the dsRNAs ranged from approximately 12.0 to 20.0 kb.

Detection and Molecular Characterization of Novel dsRNA Viruses Related to the Totiviridae Family in Umbelopsis ramanniana.

Umbelopsis ramanniana is an oleaginous fungus belonging to the Mucoromycotina subphylum. Our group had previously detected four double-stranded RNA (dsRNA) bands in the U. ramanniana NRRL 1296 strain by gel electrophoresis. Here we describe the molecular characterization of its dsRNA elements as well as the discovery of four novel dsRNA viruses: Umbelopsis ramanniana virus 1 (UrV1), Umbelopsis ramanniana virus 2 (UrV2), Umbelopsis ramanniana virus 3 (UrV3), and Umbelopsis ramanniana virus 4 (UrV4). Full genomes of UrV1, UrV3, and UrV4 were determined using the full-length amplification of cDNAs (FLAC) technique; they contain two open reading frames (ORF), which putatively encode the coat protein (CP) and the RNA dependent RNA polymerase (RdRp), respectively. In case of UrV2, a partial ORF encoding a partial RdRp gene could be determined. Based on the phylogeny inferred from the RdRp sequences, UrV1 and UrV4 belong to the genus Totivirus, while UrV2 may belong to the genus Victorivirus. UrV3 nested to a novel, unclassified group of Totiviridae, which is related to the genus Totivirus. Hybridization analysis revealed that the dsRNA molecules of UrV1 and UrV4 correspond to the same 5.0-kbp electrophoretic band, whilst the probe for the UrV3 hybridized to the largest, 5.3-kbp and the 3.0-kbp bands of the dsRNA pattern of U. ramanniana. Interestingly, the probe for the UrV2 sequence did not hybridized to any dsRNA bands, but it could be amplified from the isolated 3.0-kbp fragment. By transmission electron microscopy, two different isometric virus particles with about 50 and 35 nm in diameter were detected in U. ramanniana NRRL 1296 indicating that this strain harbor multiple viruses. Beside U. ramanniana, dsRNA elements were also detected in other Umbelopsis isolates with different patterns consisting of 2 to 4 discrete and different sized (0.7–5.3-kbp) dsRNA molecules. Based on a hybridization analysis with UrV1 CP and RdRp probes, the bands with the size of around 5.0-kbp, which were present in all tested Umbelopsis strains, are presumed as possible full mycovirus genomes.

Full genome sequence of a new polymycovirus infecting Fusarium redolens.

By screening a collection of Fusarium spp. for the presence of dsRNA, the Fusarium redolens strain A63-1 was found harboring a pattern of multiple dsRNA bands when analyzed by agarose gel electrophoresis. Using NextSeq Illumina sequencing, the full sequences of eight dsRNA molecules were determined, compared to databases, and gathered into a new viral genome. This novel virus shares similarities with mycoviruses that were recently grouped in the proposed family "Polymycoviridae". Hence, the name "Fusarium redolens polymycovirus 1" is proposed for this virus. Each viral dsRNA contains only one ORF, except dsRNA 7, which has an additional one. Based on amino acid sequence similarities, the functions of the proteins encoded by dsRNA 1-4 can be hypothesized. On the other hand, the putative proteins encoded by dsRNA 5-8 exhibit no relevant homology to known proteins. In this report, the full genome sequence of this new virus is presented along with a primary bioinformatics analysis.

Characterization of a novel victorivirus isolated from the phytopathogenic fungus Botryosphaeria dothidea.

Botryosphaeria dothidea is an important pathogenic fungus that causes serious diseases in fruits and trunks of many wood plant species worldwide. In this study, 28 B. dothidea strains isolated from pear trunk samples showing stem wart or canker symptoms were used to detect double-stranded RNA (dsRNA) viruses. The dsRNA bands with the size of ~ 1.0 to ~ 6.0 kbp were examined from ten strains. Here, we reported a novel dsRNA mycovirus, tentatively named as Botryosphaeria dothidea victorivirus 2 (BdVV2), isolated from the B. dothidea strain MSD53. BdVV2 contained spherical virions that were ~ 38nm in diameter consisting of a single linear dsRNA genome of 5,090bp in length. The BdVV2 genome contained two overlapping open reading frames (ORFs) encoding a putative coat protein (CP) and an RNA-dependent RNA polymerase (RdRp), which shared significant amino acid identities of 68% and 60% with the corresponding proteins of Sphaeropsis sapinea RNA viruses 1 (SsRV1). Phylogenetic analyses based on the aa sequences of CP and RdRp both showed that BdVV2 was phylogenetically related to the members of the genus Victorivirus in the family Totiviridae. BdVV2 is thus a novel victorivirus isolated from the phytopathogenic fungus B. dothidea.

Diversity of dsRNA Viruses Infecting Rice Sheath Blight Fungus Rhizoctonia solani AG-1 IA

Rice sheath blight, caused by Rhizoctonia solani (Kühn), is a notorious soil-borne disease prevalent in many rice-growing regions. Although several sporadic studies of mycoviruses in R. solani AG-1 IA have been reported for single strain of R. solani AG-1 IA, there have been no reports describing the distribution and diversity of mycoviruses in natural populations. In this study, 43 R. solani AG-1 IA strains collected from different locations in China were examined for the presence of dsRNA elements to confirm the presence of viral infections. Electrophoretypes showed that 16 of the 43 fungal strains (37.2%) contained dsRNAs that can be characterized as viruses. Furthermore, the species-specific reverse transcription PCR (RT-PCR) showed dsRNA bands with similar sizes do not always contain the same virus but exist as mixed mycoviral infections. Thus, our findings indicate mycoviruses infecting R. solani AG-1 IA in China are diverse, widespread and universal.

Mycoviruses in the Plant Pathogen Ustilaginoidea virens Are Not Correlated with the Genetic Backgrounds of Its Hosts.

Ustilaginoidea virens, the causal agent of rice false smut, is one of the most devastating grain diseases that causes loss of yield in most rice-growing areas worldwide. In this study, we performed a dsRNA screen to isolate mycoviruses from 35 U. virens strains. The results revealed that 34 of the tested isolates were infected by various dsRNA elements, displaying highly viral diversity and mixed infections. We characterized a 5.3 kbp dsRNA from a typical isolate containing dsRNA segments with sizes ranging from 0.5 to 5.3 kbp. Sequence analysis of its genomic properties indicated that it is a novel victorivirus, named Ustilaginoidea virens RNA virus 5 (UvRV5), that belongs to the family Totiviridae. RT-PCR detection was performed and indicated that not all the dsRNA bands that were 5.3 kbp in size contained UvRV5. Moreover, the genetic relatedness of all the U. virens strains was estimated according to phylogenetic analysis of the partial intergenic spacer region (IGS) sequences. However, concordance was not found between the dsRNA profiles and the IGS-based genetic relatedness of their host fungi.

Identification of double-stranded RNA viruses in Brazilian strains of Metarhizium anisopliae and their effects on fungal biology and virulence

Brazil is the leading country in the use of the entomopathogenic fungus Metarhizium anisopliae against agricultural pests. Very little information has been documented about the diversity and the impact of mycoviruses on M. anisopliae compared to M. robertsii and M. brunneum. This study reports the discovery of mycoviruses associated with native Brazilian Metarhizium spp. strains from the entomopathogen collection of the University of São Paulo, including strains used for mass-production of aerial conidia in sugar-alcohol factories to meet their own demand for controlling sugarcane spittlebugs and used in commercial mycoinsecticides. We also investigated the potential effects of viral infection on the biological traits of some of these strains. Viral-like double-stranded RNA (dsRNA) was found in 61% of the 36 Metarhizium spp. strains analyzed and showed a large variation of different electrophoretic banding patterns consisting of 2 to 8 dsRNA bands in polyacrylamide gels (PAGE). No dsRNA was detected in any of the strains from commercial products used in this study. Efforts to “cure” strains with dsRNA revealed that the inhibitor of protein synthesis cycloheximide was not efficient in eradicating dsRNA viruses from Metarhizium spp. strains. Some dsRNA segments of M. anisopliae ESALQ 26 were lost following hyphal tip subculturing. The dsRNA-variants of M. anisopliae strains ESALQ 866, ESALQ 1256 and ESALQ 1595 were healed after either monoconidial or hyphal tip subculturing. Single spore cultures of M. anisopliae ESALQ 1256 exhibited significant differences in vegetative growth, conidia production, and virulence against Tenebrio molitor larvae, although these differences were not linked with dsRNA. Moreover, fungal variants free of or positive for dsRNA had similar heat and UV tolerance responses. Our results suggest that viral-like dsRNA are very common among Brazilian M. anisopliae strains, but there is sparse evidence that these mycoviruses are harmful to fungal biological traits.

Mutant swarms of a totivirus-like entities are present in the red macroalga Chondrus crispus and have been partially transferred to the nuclear genome.

Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C.crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C.crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C.crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae.

Isolation and characterization of two mitoviruses and a putative alphapartitivirus from Fusarium spp.

The filamentous fungus Fusarium spp. includes several important plant pathogens. We attempted to reveal presence of double-stranded (ds) RNAs in the genus. Thirty-seven Fusarium spp. at the MAFF collection were analyzed. In the strains of Fusarium coeruleum, Fusarium globosum and Fusarium solani f. sp. pisi, single dsRNA bands were detected. The strains of F. coeruleum and F. solani f. sp. pisi cause potato dry rot and mulberry twig blight, respectively. Sequence analyses revealed that dsRNAs in F. coeruleum and F. globosum consisted of 2423 and 2414 bp, respectively. Using the fungal mitochondrial translation table, the positive strands of these cDNAs were found to contain single open reading frames with the potential to encode a protein of putative 757 and 717 amino acids (molecular mass 88.5 and 84.0 kDa, respectively), similar to RNA-dependent RNA polymerases of members of the genus Mitovirus. These dsRNAs in F. coeruleum and F. globosum were assigned to the genus Mitovirus (family Narnaviridae), and these two mitoviruses were designated as Fusarium coeruleum mitovirus 1 and Fusarium globosum mitovirus 1. On the other hand, a positive strand of cDNA (1950 bp) from dsRNA in F. solani f. sp. pisi contained an ORF potentially encoding a putative RdRp of 608 amino acids (72.0 kDa). The putative RdRp was shown to be related to those of members of the genus of Alphapartitivirus (family Partitiviridae). We coined the name Fusarium solani partitivirus 2 for dsRNA in F. solani f. sp. pisi.

First Report of Grapevine leafroll-associated virus 2 Infecting Muscadine (Vitis rotundifolia) and Summer Grape (Vitis aestivalis) in the United States.

A study, designed to gain some knowledge of viruses infecting native grapes in the southeastern United States, presently limited to a single paper (4), was initiated in spring of 2012. In the first phase of this investigation, 28 samples of muscadine (Vitis rotundifolia) and summer (V. aestivalis) grapes were collected from different locations in Mississippi (MS) and the Great Smoky Mountains National Park (GSMNP) and were analyzed for the presence of dsRNAs. A muscadine sample of cv. Burgaw (MS-07) from an experimental field in southern MS and a sample of summer grape from GSMNP (GSM-1) contained similar patterns of multiple dsRNA bands reminiscent of closterovirus infections. These dsRNAs were reverse transcribed and subjected to PCR with taxon-specific degenerate primers targeting HSP70h gene of closterovirids as described (5). DNA bands of ~600 bp, amplified from both samples, were cloned and sequenced. Pairwise comparisons showed that two viruses share 75% common nucleotides (nt) and 82% amino acids (aa) in the genome portion sequenced. Comparisons with available sequences in NCBI/GenBank revealed that these viruses are distinct isolates of Grapevine leafroll-associated virus 2 (GLRaV-2). GLRaV-2 is known to occur as divergent molecular variants characterized by different pathological effects on specific indicators ranging from leafroll to graft incompatibility (2). The GSM-1 isolate was most closely related to Red Globe isolate of GLRaV-2 (GLRaV-2RG; AF314061), reported to induce graft incompatibility (1), with 87% identical nt (95% aa). However, isolate MS-07 was most closely related (96% nt and 97% aa identity) to leafroll-inducing isolate 93/955 (GLRaV-2 93/955; NC_007448.1) (3). Virus-specific DIG labeled probe produced strong hybridization signals with nucleic acids extracted from MS07 and GSM-1 and blotted onto a positively charged membrane, thus confirming GLRaV-2 infections. No signal could be observed in negative controls. Finally, a set of GLRaV-2 specific primers (LR-2F: 5'TCGGCGTACATCCCAACTTAC3' and LR-2R: 5'CTGAGTGAAACGCACTGATC3'), designed to amplify a 422-bp-long PCR product, was applied in one-step RT-PCR tests performed on total nucleic acid extracts from additional 65 samples (60 muscadines and five summer grapes). GLRaV-2 was found in an additional four samples of muscadines (cvs. Burgaw and Hunt and two samples of an unknown cultivar) collected in MS and in one sample of summer grape collected 200 m away from the original source in GSMNP. As further ascertained, all GLRaV-2 isolates from muscadines belonged to "93/955 subgroup," whereas the additional isolate from summer grape shared 98% identical nt with the isolate GSM-1. No specific symptoms could be associated with the presence of GLRaV-2 in summer grapes or muscadines. This is the first report of GLRaV-2 in muscadines and summer grapes in the United States. Furthermore, the occurrence of GLRaV-2 in summer grapes in a natural ecosystem and in muscadines in Mississippi where there is no sizable V. vinifera industry provides important clues on ecology and possible origin of this virus.

Prevalence and diversity of mycoviruses infecting the plant pathogen Ustilaginoidea virens

Rice false smut caused by Ustilaginoidea virens is a destructive disease in many rice-growing areas. Mycoviruses have been described in many fungal species, but there is little information regarding mycoviruses in U. virens. In this study, double-stranded (ds) RNA banding patterns were assessed in 198 wild-type isolates of U. virens obtained from different geographical regions in China. The presence of viral infections was unusually common in U. virens: 188 of the 198 isolates contained dsRNA elements with viral characteristics, and the presence of mixed infections with two or more related or unrelated mycoviruses was commonly detected. The GX-1 isolate contained four dsRNA mycoviruses: Ustilaginoidea virens RNA virus 1 (UvRV1) belonging to Totiviridae, Ustilaginoidea virens RNA virus 4 (UvRV4) belonging to an unclassified family which includes the Curvularia thermal tolerance virus, and the last two probably belonging to Partitiviridae. Biological comparisons of virus-free and infected fungal isolates revealed that UvRV1 strain GX-1 and UvRV4 were likely cryptic, since the infected strains did not show apparent symptoms or debilitation. Northern blotting experiments revealed that UvRV1 strain GX-1 and UvRV4 were frequently found in U. virens, irrespective of the place of origin, and similarly sized dsRNA bands were not always of similar sequence. Thus, our findings suggest that mycoviruses infecting U. virens in China are widespread and highly diverse.

Detection and characterization of a novel Gammapartitivirus in the phytopathogenic fungus Colletotrichum acutatum strain HNZJ001

Spherical virus-like particles about 40nm in diameter were observed under transmission electron microscope (TEM) and two dsRNA bands (dsRNA-1 and dsRNA-2) were detected on agarose gel after extraction from the mycelial preparation of a Colletotrichum acutatum strain HNZJ001 that isolated from an anthracnose lesion on immature pepper fruit. The complete nucleotide sequences of the dsRNAs were determined. DsRNA-1 (1762nt) and dsRNA-2 (1381nt) each contained a single open reading frame and potentially encoded 62kDa and 40kDa proteins, respectively. The 62kDa protein showed similarity to the RNA-dependent RNA polymerase (RdRp) of partitiviruses, while the 40kDa product had no significant similarity to any published capsid protein throughout all databases, besides of low homology with the hypothetical “capsid” protein of a few partitiviruses in fungus Ustilaginoidea virens. Genome comparison and phylogenetic analysis indicated that the virus is closely related to the mycovirus in the family Partitiviridae. The results suggested a novel two-segment dsRNA virus be detected. We name it Colletotrichum acutatum partitivirus 1 (CaPV1). RT-PCR detection, using a primer pair based on the RdRp of the dsRNA-1 showed very high efficiency of CaPV1 transmission into the progenies of the fungus. Virus curing and fungal phenotype observation for evaluation of the impact of CaPV1 in host fungus were also carried out.

The complete nucleotide sequence of a novel partitivirus isolated from the plant pathogenic fungus Verticillium albo-atrum.

We have characterized the bisegmented genome of a novel double-stranded RNA (dsRNA) virus isolated from the plant pathogenic fungus Verticillium albo-atrum. We determined that its larger segment (dsRNA1) was 1747 base pairs in length and potentially encoded an RNA-dependent RNA polymerase of 539 amino acids, whereas the smaller segment (dsRNA2) was 1517 base pairs long and was predicted to encode a capsid protein of 435 amino acids. Homology searches and phylogenetic analysis confirmed that, as expected from its dsRNA banding profile, the identified virus was a new member of the family Partitiviridae, and we have therefore designated it V. a lbo- a trum partitivirus 1 (VaaPV1). This is the first report of a mycovirus identified in V. albo-atrum.

First Report of Lettuce chlorosis virus Infecting Bean in Spain

In September 2011, symptoms typically associated with Bean yellow disorder virus (BYDV) such as intervenal mottling and yellowing on middle and lower leaves combined with brittleness were observed in green bean (Phaseolus vulgaris L.) produced in commercial greenhouses from Granada and Almeria provinces, Spain. The affected plants were all observed in greenhouses infested with Bemisia tabaci. However, collected samples tested negative for BYDV using a specific RT-PCR test (4). Electrophoretic double stranded (ds) RNA analysis from symptomatic plants revealed the presence of a slightly diffused high molecular weight dsRNA band of ~8.5 kb, similar to that produced by the crinivirus Lettuce cholorosis virus (LCV) (3). The dsRNA was purified and used for cDNA synthesis and PCR by uneven PCR (1) using primers derived from LCV genome sequences (GenBank FJ380118 and FJ380119). Amplified DNA fragments were cloned in pGEM-T Easy vector (Promega, Madison, WI) and sequenced. Two different sequences were obtained and the nucleotide and amino acid sequences were analysed using BLAST. Both showed the highest identity with different regions of the LCV genome. The sequence of the first product had 92% nucleotide and 98% amino acid sequence identity with the polyprotein (Orf1a) homologue from RNA1 of LCV (KC602376). The sequence from the second product (KC602375) revealed the highest nucleotide and amino acid identity with the heat shock protein 70 homologue from LCV (90% and 99%, respectively). Based on these sequences, two sets of specific primers were designed (LCVSP 3-forward 5'-AGTGACACAAGTTGGAGCCGAC-3', LCVSP 4-low 5'-CAGTGTTTGTTGGATATCTGGGG-3') and (LCVSP 1-forward 5'-TGTTGGAAGGTGGTGAGGTC-3', LCVSP 2-low 5'-CAGAGACGAGTCATACGTACC-3') and each produced amplicons of the expected size (463 and 434 nt, respectively) when used in RT-PCR from the collected field samples. Subsequent field surveys from 2012 to 2013 in commercial bean greenhouses confirmed the presence of LCV that apparently had replaced BYDV. Groups of 15 to 20 adults of B. tabaci introduced in clip cages were fed for 24 h on 12 green bean plants infected with LCV and later transferred to six seedlings of bean and six of lettuce (Lactuca sativa L.). After 2 and 4 weeks, total RNA from the lettuce and bean plants was extracted using Plant RNA Reagent (Invitrogen) and subjected to RT-PCR analysis with the LCV-SP 1-2 and LCVSP 3-4 primer sets. All six plants of bean and none of lettuce showed positive for LCV-SP and a repeat experiment revealed identical results. We also seeded and produced lettuce plants within a bean greenhouse that was naturally infected with the virus and infested with B tabaci whiteflies. Under these conditions, we observed that whiteflies migrated freely from the infected bean plants to lettuce. After 4 and 6 weeks, lettuce plants neither produced symptoms nor tested positive for LCV by RT-PCR. This result confirms the existence of a new putative strain of LCV, Lettuce chlorosis virus-SP, unable to infect lettuce plants. To date, natural infections of LCV have not been reported outside California, where the virus failed to infect P. vulgaris (2). This is also the first report of LCV in Spain that infects members of the family Leguminosae. Green bean in southeast Spain was produced in ~9,000 ha of greenhouses until the introduction of BYDV a decade ago, causing considerable economic damage. The recent finding of LCV-SP has urged the local phytosanitary inspections to include this virus in lab tests and to emphasize disease management strategies based on whitefly control.

The nucleotide sequence and genome organization of two victoriviruses from the rice false smut fungus Ustilaginoidea virens

Ustilaginoidea virens is the causal agent of false smut disease of rice. The dsRNA-Ls from a U. virens strain of Uv0901 containing three dsRNA bands were separated and sequenced. The dsRNA-Ls, with molecular weight of 5 kbp, were demonstrated to be two dsRNA segments referenced as dsRNA-L1 and dsRNA-L2. The two dsRNAs each contained two overlapped open reading frames, and showed significant similarity to those of capsid protein and RNA-directed RNA polymerase, respectively, of members of the family Totiviridae. Homology research and phylogenic analysis indicated that the dsRNA-L1 was a conspecific species of the previous reported Ustilaginoidea virens RNA virus 1, named Ustilaginoidea virens RNA virus Uv0901, and the dsRNA-L2 was a new number of the Victorivirus in the family Totiviridae, designed as Ustilaginoidea virens RNA virus 3.

Detection of Beet Necrotic Yellow Vein Virus by Double Stranded RNA Analysis

Beet necrotic yellow vein virus (BNYVV), the type member of the Benyvirus genus, has a multipartite, positive-sense single-stranded RNA genome, which consists generally of four, or in some isolates five, distinct RNA species. In this study, 108 BNYVV infected soil samples were collected from Isparta province, Turkey. Sugar beet plants cv Kasandra were grown in these soil samples using bait plant techniques and root samples were then analyzed by dsRNA analysis. The RNA was purified by CF-11 cellulose chromatography and gel electrophoresis. In 108 samples tested, dsRNA profiles were observed in 53 samples. No dsRNA bands were observed in negative control used in the analysis.