Dot Enzyme-linked Immunosorbent Assay Research Articles

Antiretroviral Therapy Suppresses RNA N6-Methyladenosine Modification in Peripheral Blood Mononuclear Cells from HIV-1-Infected Individuals.

RNA N6-methyladenosine (m6A) modification is important for regulating gene expression and innate immune responses to viral infection. HIV-1 in vitro infection induces a significant increase in m6A modification of cellular RNA; however, whether m6A levels of cellular RNA are affected by HIV-1 replication or by antiretroviral therapy (ART) in infected individuals remains unknown. Using dot blot or enzyme-linked immunosorbent assay, we measured RNA m6A levels of peripheral blood mononuclear cells (PBMCs) from healthy donors or HIV-1-infected individuals with or without ART. Using a reverse transcription-quantitative polymerase chain reaction array, we quantified expression levels of 84 type-I interferon (IFN-I)-responsive genes in PBMCs from some individuals of these three groups. RNA m6A levels in PBMCs from HIV-1 viremic patients (n = 10) were significantly higher (p ≤ .0001) compared with ART-treated individuals (n = 22) or 1.5-fold higher compared with healthy donors (n = 14). However, the increase in RNA m6A levels did not correlate with changes in the expression of 10 m6A-regulatory genes. We found significant upregulation and downregulation in the expression of several IFN-I-responsive genes from HIV-1 viremic patients (n = 4) and ART-treated patients (n = 6) compared with healthy donors (n = 5), respectively. Our results suggest that post-transcriptional m6A modification may contribute to the regulation of IFN-I-responsive gene expression during HIV-1 infection and ART.

Development and characterization of three novel mouse monoclonal antibodies targeting spike protein S1 subunit of Middle East Respiratory Syndrome Corona Virus.

Middle East Respiratory Syndrome Coronavirus is a highly pathogenic virus that poses a significant threat to public health. The purpose of this study is to develop and characterize novel mouse monoclonal antibodies targeting the spike protein S1 subunit of the Middle East Respiratory Syndrome Corona Virus (MERS-CoV). In this study, three mouse monoclonal antibodies (mAbs) against MERS-CoV were generated and characterized using hybridoma technology. The mAbs were evaluated for their reactivity and neutralization activity. The mAbs were generated through hybridoma technology by the fusion of myeloma cells and spleen cells from MERS-CoV-S1 immunized mice. The resulting hybridomas were screened for antibody production using enzyme-linked immunosorbent assays (ELISA). ELISA results demonstrated that all three mAbs exhibited strong reactivity against the MERS-CoV S1-antigen. Similarly, dot-ELISA revealed their ability to specifically recognize viral components, indicating their potential for diagnostic applications. Under non-denaturing conditions, Western blot showed the mAbs to have robust reactivity against a specific band at 116 KDa, corresponding to a putative MERS-CoV S1-antigen. However, no reactive bands were observed under denaturing conditions, suggesting that the antibodies recognize conformational epitopes. The neutralization assay showed no in vitro reactivity against MERS-CoV. This study successfully generated three mouse monoclonal antibodies against MERS-CoV using hybridoma technology. The antibodies exhibited strong reactivity against MERS-CoV antigens using ELISA and dot ELISA assays. Taken together, these findings highlight the significance of these mAbs for potential use as valuable tools for MERS-CoV research and diagnosis (community and field-based surveillance and viral antigen detection).

Highly specific and super-sensitive Dot-ELISA and colloidal gold immunochromatographic strip for detecting Xanthomonas oryzae pv. oryzicola of rice bacterial leaf streak

Rice bacterial leaf streak (BLS), caused by Xanthomonas oryzae pv. oryzicola (Xoc), is a worldwide destructive rice bacterial disease, and seriously affects the global rice industry. Effective integrated management measures for BLS depend on the timely and proper detection of Xoc. Here, two highly specific and super-sensitive monoclonal antibodies (MAbs) against Xoc were first prepared using the cultured Xoc RS105 as an immunogen. Then, two serological assays, Dot enzyme-linked immunosorbent assay (Dot-ELISA) and Colloidal gold immunochromatographic strip (CGICS), were developed for the super-sensitive and broad-spectrum detection of Xoc in homogenates prepared from field-collected rice plants. The newly created Dot-ELISA and CGICS assays can detect ten different Xoc strains from various provinces in China and other countries without cross-reactivity with the other ten tested plant bacteria. Furthermore, Dot-ELISA and CGICS can detect Xoc in bacterial suspensions diluted up to 9.78 × 103 CFU/mL and 4.88 × 103 CFU/mL, respectively, or in rice plant tissue homogenates diluted up to 1:51,200 (w/v, g/mL). Surprisingly, both Dot-ELISA and CGICS serological assays were more sensitive than the conventional PCR. Additionally, analysis results using field-collected rice samples showed that the newly created Dot-ELISA and CGICS were reliable in detecting Xoc in rice tissues. Thus, the two serological assays were highly valuable and effective for the diagnosis of rice bacterial leaf streak in rice-grown areas and for inspection and quarantine of Xoc.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Prediction, Synthesis and Evaluation of a Synthetic Peptide as an Enzyme-Linked Immunosorbent Assay (ELISA) Candidate for Screening of Bovine Antibodies against Theileria annulata.

Tick-borne diseases (TBDs) of livestock are endemic across various parts of tropical countries. Theileriosis is one such economically important TBD, caused by the Theileriidae family of organisms, which is transmitted by ticks. Theileria annulata, the causative agent of tropical theileriosis, contributes a significant loss to the dairy sector by causing anorexia, high fever, anemia, inflammatory changes in vital organs and icterus, thus, a loss in milk yield. Though vaccines are available, their protective efficacy is not absolute, and treatment is limited to early diagnosis of the causative agent. Routinely, microscopic identification of piroplasms in the erythrocytes (Giemsa-stained) of infected animals or schizonts in lymph node biopsies are practiced for diagnosis. PCR-based techniques (multiplex, uniplex, nested and real-time) have been reported to perform well in diagnosing active infection. Several attempts have been made using serological assays like Dot blot, ELISA and ICT, but the results were of variable sensitivity and specificity. Recombinant proteins like the Theileria annulata merozoite surface antigen (Tams1) and Theileria annulata surface protein (TaSP) have been explored as antigenic candidates for these assays. In the present study, we predicted an immunogenic peptide, i.e., TaSP-34, from the TaSP using various computational tools. The predicted peptide was custom synthesized. The diagnostic potential of the peptide was assessed by indirect plate ELISA to detect the bovine-IgM against Theileria annulata. Alongside, a recombinant truncated TaSP (rTaSP(tr)) was expressed and purified, which was used to compare the performance of the peptide as a diagnostic candidate. The IgM-based peptide ELISA was 100% sensitive and 92.77% specific as compared to PCR (Tams1 targeting), while 98.04% sensitivity and 97.44% specificity were observed in comparison with rTaSP(tr) ELISA. Almost perfect agreement between peptide ELISA and Tams1 PCR was observed with a Cohen's kappa coefficient (κ-value) of 0.901 and agreement of 95.31%. Further, the κ-value between the peptide ELISA and rTaSP(tr) ELISA was found to be 0.95, and the agreement was 97.65%, which shows a good correlation between the two tests. The findings suggest that the TaSP-34 peptide can be an efficient and new-generation diagnostic candidate for the diagnosis of T. annulata. Furthermore, the peptide can be synthesized commercially at a larger scale and can be a cost-effective alternative for the protein-based diagnostic candidates for T. annulata.

Visual and Super-Sensitive Detection of Maize Chlorotic Mottle Virus by Dot-ELISA and Au Nanoparticle-Based Immunochromatographic Test Strip.

Maize chlorotic mottle virus (MCMV) is the only species in the Mahromovirus genus and is often co-infected with one or several viruses of the Potyvirus genus, posing a great threat to the global maize industry. Effective viral integrated management measures are dependent on the timely and proper detection of the causal agent of the disease. In this work, six super-sensitive and specific monoclonal antibodies (mAbs) against MCMV were first prepared using purified MCMV virions as the immunogen. Then, the Dot enzyme-linked immunosorbent assay (Dot-ELISA) was established based on the obtained mAbs, and it can detect MCMV in infected maize leaf crude extracts diluted up to 1:10,240-fold (w/v, g/mL). Furthermore, a rapid and user-friendly Au nanoparticle-based immunochromatographic test strip (AuNP-ICTS) based on paired mAbs 7B12 and 17C4 was created for monitoring MCMV in point-of-care tests, and it can detect the virus in a 25,600-fold dilution (w/v, g/mL) of MCMV-infected maize leaf crude extracts. The whole test process for ICTS was completed in 10 min. Compared with conventional reverse transcription-polymerase chain reaction (RT-PCR), the detection endpoint of both serological methods is higher than that of RT-PCR, especially the Dot-ELISA, which is 12.1 times more sensitive than that of RT-PCR. In addition, the detection results of 20 blinded maize samples by the two serological assays were consistent with those of RT-PCR. Therefore, the newly created Dot-ELISA and AuNP-ICTS exhibit favorable application potential for the detection of MCMV in plant samples.

Development of silver nano-based indirect ELISA and Dot-ELISA methods for serological diagnosis of a bacterial fish pathogen Aeromonas veronii

Rapid and accurate detection of bacterial pathogens is critical in controlling disease outbreaks affecting farmed fish. The present study aimed to develop a novel serological diagnostic approach using nano‑silver based Enzyme-linked immunosorbent assay (ELISA) for speedy detection of Aeromonas veronii infections in Nile tilapia. A. veronii isolates used in ELISA assays were recovered from moribund Nile tilapia during a disease outbreak in a private fish farm in Egypt. A. veronii isolates were identified based on alignment analysis of the gyrB and 16S rRNA gene sequences. A. veronii antisera used in ELISA assays were prepared in tilapia, and the bacterial antigens were formalin-killed. The cut-off values were 0.46 and 0.48 in traditional and nano-based ELISA. There were no cross-reactions with bacterial isolates (Aeromonas hydrophila, Aeromonas caviae, Aeromonas sobria, Pseudomonas fluorescens, and Vibrio vulnificus). The lowest antigen concentration that produced positive results after checkerboard titration in indirect-ELISA (i-ELISA) and dot ELISA was 15 μg and 250 ng of prepared antigen, respectively. Nano-ELISA and nano-based dot-ELISA antigen concentration was 10 μg and 100 ng, respectively. Sera concentration was 1:100 in indirect-ELISA and dot-ELISA, while it was 1:50 in nano-based ELISA and nano dot-ELISA. The i-ELISA successfully detected anti-Aeromonas IgG antibodies with 83.33% sensitivity and 66.67% specificity, while in the dot-ELISA, the sensitivity and specificity were 83.33% and 100%, respectively. Nano dot-ELISA had 100% sensitivity, specificity, and accuracy. Nano dot-ELISA assays have higher specificity, sensitivity, and accuracy than traditional ELISAs in detecting A. veronii. Further studies are needed to develop a rapid test kit for on-site field diagnosis.

Development of Dot-ELISA and Colloidal Gold Immunochromatographic Strip for Rapid and Super-Sensitive Detection of Plum Pox Virus in Apricot Trees.

Plum pox virus (PPV) is a causal agent of the stone fruit tree sharka disease that often causes enormous economic losses. Due to its worldwide distribution and economic importance, rapid and reliable diagnostic technologies are becoming increasingly important for successful management of sharka disease. In this study, we have produced two super-sensitive and specific anti-PPV monoclonal antibodies (i.e., MAbs 13H4 and 4A11). Using these two MAbs, we have now developed a dot enzyme-linked immunosorbent assay (dot-ELISA) and a colloidal gold immunochromatographic strip (CGICS) assay. These two technologies can be used to quickly and reliably detect PPV. The results of these sensitivity assays confirmed that the dot-ELISA and CGICS assays could detect PPV infection in apricot tree leaf crude extracts diluted up to 1:5120 and 1:6400 (w/v), respectively. Further analyses using field-collected apricot tree leaf samples showed that the detection endpoint of the dot-ELISA was ~26 times above that obtained through RT-PCR, and the CGICS was as sensitive as RT-PCR. This present study is to broaden the knowledge about detection limits of dot-ELISA and CGICS for PPV monitoring. We consider that these newly developed dot-ELISA and CGICS are particularly useful for large scale PPV surveys in fields.

Conjugated silver nanoparticles as a diagnostic tool for circulating hydatid antigens

Cystic hydatid disease is one of the most significant worldwide zoonotic diseases. The causative agent is the larval stage of Echinococcus granulosus. The diagnosis of cystic echinococcosis by clinical symptoms and scanning alone is often difficult and confusing. The definite diagnosis needs sensitive and reliable serological tests. This study aimed to evaluate a nano silver-based enzyme linked immunosorbent assay (ELISA) in the detection of circulating hydatid antigen in human serum samples. The study included 66 human serum samples (36 hydatidosis confirmed cases, 15 cases infected with other parasites, and 15 normal subjects as negative control). The circulating protoscolices antigen was assayed by the nano-silver dot ELISA, nano-silver sandwich ELISA and the traditional methods (dot ELISA and sandwich ELISA). Our study revealed that the sensitivity and specificity of the nano-silver dot ELISA were 97.2% and 93.3%, respectively. The sensitivity and specificity of nano-silver sandwich ELISA were 94.4% and 96.7% respectively. The nano-silver-based ELISA showed higher sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy than the traditional ELISA. In conclusion, the nano-silver-based ELISA can be proposed as a confirmatory test in the diagnosis of cystic echinococcosis.

Performance evaluation of a laboratory-developed light-initiated chemiluminescence assay for quantification of egg white-specific IgE.

BackgroundSpecific IgE (sIgE) testing has become one of the most important tools for diagnosing IgE‐mediated food allergy. Enzyme‐linked immunosorbent assay (ELISA) and dot‐enzyme‐linked immunosorbent assay (Dot‐ELISA) have been used to measure sIgE in clinical widely. Light‐initiated chemiluminescence assay (LICA) is a new method for measuring allergen‐sIgE. We aimed to establish a LICA method for quantitative detection of egg white‐sIgE and evaluate its performances.MethodsThe best chemibeads coupling method in detecting egg white‐sIgE was selected, and a LICA method for quantitative detection of egg white‐sIgE was established. The precision study was performed according to Clinical and Laboratory Standards Institute (CLSI) EP5‐A2. Detection capability which contains limit of blank (LoB), limit of detection (LoD), and limit of quantitation (LoQ) was evaluated according to National Health Commission of the People's Republic of China (NHC) WS/T 514–2017. Linear range was evaluated according to CLSI EP6‐A. All data were analyzed using SPSS software.ResultsPrecision contains repeatability and intermediate precision. The CV of repeatability ranged from 2.72% to 7.29%, and the CV of intermediate precision ranged from 4.93% to 8.64%. The LoB, LoD, and LoQ of the assay were 0.000 kUA/L, 0.053 kUA/L, and 0.076 kUA/L. The assay linear range was 0.076–34.125 kUA/L (r = 0.9979 ≥ 0.9900).ConclusionThis laboratory‐developed LICA method can detect egg white‐sIgE, and performance meets clinical requirements. This method shows rapid turnaround cycles and high sensitivity. It can be used as an alternative method for clinical detection of egg white‐sIgE.

Natural Infection of Cichorium intybus (Asteraceae) by Groundnut Ringspot Virus (Genus Orthotospovirus) Isolates in Brazil.

Leaf chicory (Cichorium intybus L.) is a nutritionally rich vegetable used in regional cuisine in Brazil. Plants of C. intybus displaying symptoms (viz. chlorotic and necrotic ringspots, mosaic, and leaf deformation) similar to that induced by orthotospoviruses (genus Orthotospovirus, family Tospoviridae) were observed in three fields (≈ 0.2 ha each) in Gama County, in the Federal District, Brazil, from September 2016 to January 2020 in plants of the cultivars 'Folha-Larga' and 'Spadona' (Fig. 1). Incidence of symptomatic plants was nearly 10% in each field. Transmission electron microscopic examination of thin sections from symptomatic leaf samples showed typical membrane-bounded orthotospovirus particles within cisternae of spongy parenchymal cells (Fig 2). Two individual leaf samples per field were collected and submitted to dot enzyme-linked immunosorbent assay with polyclonal antisera against N protein of tomato spotted wilt virus (TSWV), groundnut ringspot virus (GRSV) and tomato chlorotic spot virus (TCSV). Symptomatic samples strongly reacted only against GRSV antibodies. Total RNA was extracted (Trizol®, Sigma) from all six samples and used as template in RT-PCR assays. The primer J13 (5'-CCCGGATCCAGAGCAAT-3') was employed for cDNA synthesis using M-MLV reverse transcriptase. PCR assays were done with the primer pair BR60/BR65 (Eiras et al., 2001) to obtain ≈ 500 bp fragment of untranslated region and partial N gene in the S RNA segment from each sample. Purified RT-PCR products of two randomly selected individual samples were directly sequenced (GenBank MW467981 and MZ126602) and their BLASTn analyses displayed 99 to 100% nucleotide identity to GRSV isolates previously reported infecting C. endivia L. in Brazil (Jorge et al., 2021). Our analyses combining N protein serology and N-gene sequencing (both directed to the S RNA segment) allowed us to confirm the GRSV infection of C. intybus, but the potential reassortant nature of these isolates (Webster et al., 2015; Silva et al., 2019) are unknown since their M RNA segments were not characterized. Individual leaf extracts (in phosphate buffer, pH 7.0) of the sequenced isolates were mechanically inoculated onto ten seedlings of two C. intybus cultivars ('Folha Larga' and 'Pão-de-Açúcar') and three plants each of the indicator hosts Capsicum chinense PI 159236, Nicandra physalodes; Nicotiana rustica; Datura stramonium; and tomato cv. Santa Clara. Systemic chlorotic and necrotic ringspots, mosaic, and leaf deformation developed in the indicator hosts and infection by GRSV was confirmed via serological assays 20 days after inoculation. However, no symptoms and no serological reaction to GRSV antibodies were observed on the C. intybus cultivars even after two successive mechanical inoculations. This transmission failure might be due to factors such as the requirement of the thrips vector(s), physicochemical barriers in the foliage or the presence of non-mechanically transmissible helper agent(s) necessary to ensure GRSV infection of C. intybus. The natural infection of C. intybus by a not fully characterized orthotospovirus (mostly likely TSWV) has been observed since 1938 in Brazil (Kitajima, 2020). Our report of GRSV infecting C. intybus is thus confirming previous speculations that similar symptoms in this vegetable crop were induced by orthotospovirus infection in Brazil.

Production of peptide-specific antibody against protein P10 of Southern rice black-striked dwarf virus

Virus Southern rice black-striked dwarf virus (SRBSDV) disease caused serious damage rice growing areas in Northern and Central Vietnam over the past decade. While the application of SRBSDV diagnostic methods based on the Reverse transcription polymerase chain reaction (RT-PCR) technique was impossible due to technical complexity, simpler SRBSDV diagnostic techniques using specific antibody have not yet been developed in Vietnam. The biggest difficulty right now was the absence of commercial specific antibodies against SRBSDV. To develop diagnostic techniques by enzyme-linked immunosorbent assay (ELISA) for SRBSDV detection, in a previous study, we created antibodies against SRBSDV from the 66 kDa recombinant SRBSDV protein P10 expressed in E. coli; the obtained antibodies had a titer of 1:5000 dilution. Here, we continued to produce polyclonal antibodies against SRBSDV from small antigenic peptide (PASTTDVTHYGGY) derived from the P10 envelope protein, which was consevative in Vietnamese SRBSDV population. Titer of the purified IgG antibody was exmined using Dot enzyme-linked immunosorbent assay (Dot-ELISA) which showed a titer of 1:40000 dilution. The specific binding between anti-peptide IgG antibodies diluted at 1:40000 and the recombinant P10 protein in E. coli extraction was confirmed by using western blotting. In Dot-ELISA, our antibodies could distinguish between the SRBSDV-infected and non-infected rice samples. Our research results open up a new opportunity for developing the rapid diagnosis Southern rice black-striked dwarf virus membrane-type kit in Vietnam.

Immunodetection of Furcraea Necrotic Streak Virus-FNSV in fique plants (Furcraea macrophylla Baker) using a polyclonal antibody IgY produced in chicken egg yolk

The necrotic streak of the fique (Furcraea spp.) or “Macana” disease is considered the most limiting disease for this crop in Colombia, whose causal agent is the Furcraea Necrotic Streak Virus - FNSV (RNA+). Currently, there are no strategies to control the disease, being necessary to develop methods for detection of this pathogen in the planting material before being taken to the field. In this study, polyclonal antibodies produced in egg yolk (IgY) were produced and assesses for detection FNSV. Two immunoenzymatic methodologies were standardized: dot blot immunobinding assay (DBIA) and enzyme-linked immunosorbent assay (ELISA), determining their specificity and sensitivity. The detection limit by DBIA corresponded to 8 μg/mL of purified virus suspension using 10 μg/mL of primary antibody. In the ELISA test, the primary antibody concentration of 3 μg/mL (1:800 dilution) detected the antigen at concentrations between 10 and 70 μg/mL. The polyclonal antibody anti-FNSV IgY allowed the detection of FNSV in samples of purified virus and extracts of roots and leaves of fique plants with symptoms of “Macana” disease and did not produce any signal with the control samples. Results showed the potential of using egg yolk IgY in immunological tests for the detection of FNSV in fique plants.

Immunoanalysis of different antigenic preparations of Angiostrongylus cantonensis for neuroangiostrongyliasis diagnosis improvement.

BACKGROUND Angiostrongylus cantonensis is the etiological agent of neuroangiostrongyliasis in humans, which is developed in gastropods and vertebrate species, mainly rodents. Human transmission occurs through consumption of molluscs and paratenic hosts infected with L3, and the migration of larvae to the central nervous system causes eosinophilic meningitis. Laboratory diagnosis is based on molecular and immunological tests, using young or adult females as a source of antigens. However, these tests give positive results only after several weeks of symptoms onset and also cross-reactions with others parasite infections may occur.OBJECTIVES The purpose of this work was to study different antigenic preparations of distinct evolutionary phases of A. cantonensis, in order to improve serological techniques for disease immunodiagnosis.METHODS For this purpose, antigenic fractions of different evolutionary forms were evaluated by Dot-enzyme-linked immunosorbent assay (Dot-ELISA) and Western blot using serum samples.FINDINGS All analysed fractions showed reactivity with serum samples from patients with neuroangiostrongyliasis, especially female membrane alkaline (FAM) and female soluble alkaline (FAS) fractions together with female soluble saline (FSS), improving the technique specificity.MAIN CONCLUSIONS The results point to the possibility of use of raw female antigens in association with alkaline membrane antigens extracted from adult worms to aid in diagnosis and helps initiate neuroangiostrongyliasis surveillance and control actions.

Three highly sensitive monoclonal antibody-based serological assays for the detection of tomato mottle mosaic virus

In recent years, tomato mottle mosaic virus (ToMMV) has become one of the most important viral pathogens affecting solanaceous crop production in Yunnan, Hainan, and Shandong provinces of China, often causing huge yield reductions. To provide farmers and vegetable industry with reliable and easy-to-use ToMMV detection methods, we immunized BALB/c mice with purified ToMMV and obtained six hybridoma cell lines (i.e., 2D6, 9C12, 26A10, 3A4, 23A4 and 17B11) that secrete anti-ToMMV monoclonal antibodies (MAbs) through the hybridoma technology. Using these MAbs as the detection antibody, we developed three serological assays: antigen-coated-plate enzyme-linked immunosorbent assay (ACP-ELISA), dot enzyme-linked immunosorbent assay (dot-ELISA) and tissue print enzyme-linked immunosorbent assay (tissue print-ELISA) for ToMMV detection. Our test results showed that these three newly developed serological methods can be used to specifically detect ToMMV infection in plant samples, but not tobacco mosaic virus, tomato mosaic virus, cucumber green mottle mosaic virus and cucumber mosaic virus. Sensitivity analyses further showed that ACP-ELISA and dot-ELISA can be used to detect ToMMV infection in plant crude extracts diluted at 1:81,920 and 1:40,960 (weight/volume, g/mL), respectively. Surprisingly, the detection limit of the developed dot-ELISA was 26 times higher than that of traditional RT-PCR. Using field-collected plant samples, we have demonstrated that these three new serological methods are accurate and easy-to-use for large-scale detection of ToMMV in fields.

Identification of a Novel Major Allergen in Buckwheat Seeds: Fag t 6.

Buckwheat is one of the five main allergenic foods (eggs, milk, wheat, buckwheat, and peanuts). Oleosin is an important type of allergen in some allergic foods. However, although most diagnostic nut and seed extracts are defatted, some patients with food allergies may have false negative diagnostic results of oleosin in vitro. Recently, we found that the serum of buckwheat allergic patients responded strongly to an 18 kDa protein. Mass spectrometry analysis showed it is the oleosin protein family. We further purified and evaluated the allergenicity of this buckwheat oleosin-type allergen, which is involved in the formation of buckwheat oil bodies. The tartary buckwheat oleosin allergen was named Fag t 6, according to the WHO/IUIS Allergen Nomenclature Subcommittee criteria. The DNA sequence of tartary buckwheat oleosin was cloned. Dot blot and enzyme-linked immunosorbent assay (ELISA) showed half of the 20 buckwheat allergic patients' serum had strong reactivity with purified buckwheat Fag t 6. Circular dichroism experiment analysis of its thermal stability showed a Tm of 64.65 ± 0.65 °C. A buckwheat allergy showed possible cross-reaction with a wheat allergy. In summary, this study not only increases our understanding of buckwheat allergies and oil-soluble allergens in general, it may also be used to improve diagnostic tests for buckwheat allergies in the future.

Application of a recombinant replicase to localize the Trionyx sinensis hemorrhagic syndrome virus and evaluate its effects on antiviral genes of T. sinensis

Trionyx sinensis Hemorrhagic Syndrome Virus (TSHSV) is an arterivirus newly discovered in Chinese softshell turtles. Little is known about the effect of antibodies against the virus or the distribution of the virus in different organs of infected turtles. In this study, a partial protein of TSHSV-HP4 was produced using a prokaryotic expression system, and its polyclonal antibody was generated. The polyclonal antibody was confirmed by western blot and dot enzyme-linked immunosorbent assay (dot-ELISA). The distribution of TSHSV in different organs of T. sinensis was examined by immunohistochemistry (IHC) and the expression of immune-related genes was analyzed using quantitative real-time polymerase chain reaction (qRT-PCR). The results indicated that the recombinant TSHSV-HP4 protein was successfully expressed, and the generated polyclonal antibody showed specific binding to viral particles in the lung tissues of infected turtles. The IHC assay indicated that the virus was highly localized in various cells, including intestinal lymphocytes, enterocytes, kidney epithelial cells, spleen cells, lung macrophages, and cardiomyocytes. The qRT-PCR analysis revealed that TSHSV was detected in all organs tested, including the lungs, liver, kidneys, spleen, and heart. The numbers of viral mRNA copies in lung and heart tissues were significantly higher in the virus-antibody group than in the virus group. The interferon-stimulated genes (ISGs), myxovirus resistance protein 2 (MX2) and radical S-adenosyl methionine domain containing 2 (RSAD2) were highly upregulated in all groups of infected turtles. Antibody-dependent enhancement (ADE) seemed to occur after stimulation by the polyclonal antibody, because significantly greater expression of the two genes was detected in the virus-antibody group than in the virus group. Overall, these results are important in understanding the cell localization of TSHSV and the immune response of infected turtles.

A Multiyear Survey and Identification of Pepper- and Tomato-Infecting Viruses in Yunnan Province, China.

During pepper and tomato production seasons in 2013–2017, large-scale virus disease surveys were conducted in different regions of Yunnan Province, China. A total of 1,267 pepper and tomato samples with various virus-like symptoms were collected and analyzed for virus infections through dot enzyme-linked immunosorbent assay (dot-ELISA), polymerase chain reaction (PCR), and reverse-transcription (RT)-PCR. The detection results showed that 19 different viruses were present in about 50.9% of the assayed samples, and among these viruses, seven viruses were found in both pepper and tomato samples. Mixed infections with two to three of the 15 identified mixed infection types were found in the pepper samples and 10 identified mixed infection types were found in the tomato samples. Among the infected samples, Tomato spotted wilt orthotospovirus (TSWV) was the most common virus, with a detection rate of about 20.0% followed by Pepper vein yellows virus (PeVYV, 13.0%). This survey revealed for the first time that pepper is a natural host of Tobacco vein distorting virus (TVDV) worldwide and tomato is a natural host of Potato leafroll virus (PLRV) in China. PeVYV, Tobacco mild green mosaic virus (TMGMV) and Wild tomato mosaic virus (WTMV) were first time found in pepper and Tomato mottle mosaic virus (ToMMV) and Chilli veinal mottle virus (ChiVMV) were first time found in tomato in Yunnan Province. Finally, the virus incidences were higher in Kunming, Yuxi, Chuxiong, and Honghe region than other regions.

Milk As a New Diagnostic Tool for Rapid Detection of Fascioliasis in Dairy Goats Using Excretory/Secretory Antigen

Fascioliasis is a serious livestock illness of particular importance for dairy goats; the objectives of this study were to describe effects of F. gigantica on milk composition and to use this information to estimate economic damages linked with Fasciola spp. infections. Furthermore, the study sought to standardize the use of milk instead of serum for early diagnosis of fascioliasis in dairy goats. One-hundred samples of goat milk along with corresponding blood samples were obtained at random from flocks in Cairo and Giza Governorates. The ELISA and DOT-ELISA were performed in both serum and milk of dairy goats. Total mesophilic count (mean value) was 2.12 × 106 ± 1.63 × 105CFU/ml in enzyme-linked immunosorbent assay (ELISA) positive samples and 1.46 × 104 ± 8.58 × 102CFU/ml in ELISA-negative samples. The mean values were significantly different (P < 0.05). The mean values of percentages of fat, SNF, protein, salts, lactose, pH, and MSCC/ml in ELISA-positive samples were 2.3 ± 0.17, 8.21 ± 0.63, 3.08 ± 0.18, 0.90 ± 0.06, 3.64 ± 0.28, 6.93 + 0.53, and 1.18 × 106 ± 9.07 × 104cells/ml, respectively. A significant difference (P < 0.05) between the mean values of two composition parameters, i.e., percent of fat and MSCC/ml in ELISA-positive and -negative samples, for Fasciola gigantica was observed. The antigen used for the diagnosis of F. gigantica was excretory/secretory (E/S) antigen. The dilutions of (E/S) concentrations after checkerboard titration for indirect ELISA were 20μg/ml protein and for dot-ELISA, 300ng/μl. Sera dilution was 1:100 in the two tests, and milk dilution was 1:50 for indirect ELISA, and 1:25 for dot-ELISA. The two tests were performed using known F. gigantica positive and negative goat sera and known rat hyper immunized negative and positive sera against E/S antigen of F. gigantica as well as known sera for paramphistomes without F. gigantica infection. The cutoff values in indirect ELISA were 0.45 for sera and 0.35 for milk. The application of different serological technique in goat farms reveals a good test in rapid diagnosis of fascioliasis especially the uses of dot ELISA when using the milk instead of the serum.