Donor Cells For Somatic Nuclear Transfer Research Articles

Chromatin accessibility memory of donor cells disrupts bovine somatic cell nuclear transfer blastocysts development.

The post-transfer developmental capacity of bovine somatic cell nuclear transfer (SCNT) blastocysts is reduced, implying that abnormalities in gene expression regulation are present at blastocyst stage. Chromatin accessibility, as an indicator for transcriptional regulatory elements mediating gene transcription activity, has heretofore been largely unexplored in SCNT embryos, especially at blastocyst stage. In the present study, single-cell sequencing assay for transposase-accessible chromatin (scATAC-seq) of in vivo and SCNT blastocysts were conducted to segregate lineages and demonstrate the aberrant chromatin accessibility of transcription factors (TFs) related to inner cell mass (ICM) development in SCNT blastocysts. Pseudotime analysis of lineage segregation further reflected dysregulated chromatin accessibility dynamics of TFs in the ICM of SCNT blastocysts compared to their in vivo counterparts. ATAC- and ChIP-seq results of SCNT donor cells revealed that the aberrant chromatin accessibility in the ICM of SCNT blastocysts was due to the persistence of chromatin accessibility memory at corresponding loci in the donor cells, with strong enrichment of trimethylation of histone H3 at lysine 4 (H3K4me3) at these loci. Correction of the aberrant chromatin accessibility through demethylation of H3K4me3 by KDM5B diminished the expression of related genes (e.g., BCL11B) and significantly improved the ICM proliferation in SCNT blastocysts. This effect was confirmed by knocking down BCL11B in SCNT embryos to down-regulate p21 and alleviate the inhibition of ICM proliferation. These findings expand our understanding of the chromatin accessibility abnormalities in SCNT blastocysts and BCL11B may be a potential target to improve SCNT efficiency.

ZFP57 regulates DNA methylation of imprinted genes to facilitate embryonic development of somatic cell nuclear transfer embryos in Holstein cows.

Aberrant epigenetic nuclear reprogramming, especially imprinting pattern disorders, is one of the major causes of failure of clone development from somatic cell nuclear transfer (SCNT). Previous studies showed that ZFP57 is a key protein required for imprint maintenance after fertilization. In this study, we found that imprinting control regions in several imprinted genes were significantly hypomethylated in cloned embryos compared with in vitro fertilization embryos, indicating a loss of imprinted gene methylation. The ZFP57 expression was capable of maintaining the correct degree of methylation at several imprinting control regions and correcting abnormal hypomethylation. Moreover, we successfully obtained bovine fetal fibroblasts overexpressing ZFP57, which were used as donors for SCNT. Our results demonstrated that overexpression of ZFP57 increased total and trophectoderm cell numbers and the ratio of inner cell mass to total cells, reduced the apoptosis rate and significantly enhanced the development of SCNT blastocysts in vitro, ultimately achieving a degree of methylation similar to that in in vitro fertilization embryos. We concluded that overexpression of ZFP57 in donor cells provided an effective method for enhancing nuclear reprogramming and developmental potential in SCNT embryos. The ZFP57 protein played a key role in maintaining the methylation of imprinted genes during early embryonic development, which may be effective for enhanced SCNT in cattle.

Establishment, characterization, and validation of novel porcine embryonic fibroblasts as a potential source for genetic modification.

Fibroblasts are the common cell type in the connective tissue-the most abundant tissue type in the body. Fibroblasts are widely used for cell culture, for the generation of induced pluripotent stem cells (iPSCs), and as nuclear donors for somatic cell nuclear transfer (SCNT). We report for the first time, the derivation of embryonic fibroblasts (EFs) from porcine embryonic outgrowths, which share similarities in morphology, culture characteristics, molecular markers, and transcriptional profile to fetal fibroblasts (FFs). We demonstrated the efficient use of EFs as nuclear donors in SCNT, for enhanced post-blastocyst development, implantation, and pregnancy outcomes. We further validated EFs as a source for CRISPR/Cas genome editing with overall editing frequencies comparable to that of FFs. Taken together, we established an alternative and efficient pipeline for genome editing and for the generation of genetically engineered animals.

A transgene-free method for rapid and efficient generation of precisely edited pigs without monoclonal selection.

Gene-edited pigs for agricultural and biomedical applications are typically generated using somatic cell nuclear transfer (SCNT). However, SCNT requires the use of monoclonal cells as donors, and the time-consuming and laborious monoclonal selection process limits the production of large populations of gene-edited animals. Here, we developed a rapid and efficient method named RE-DSRNP (reporter RNA enriched dual-sgRNA/CRISPR-Cas9 ribonucleoproteins) for generating gene-edited donor cells. RE-DSRNP takes advantage of the precise and efficient editing features of dual-sgRNA and the high editing efficiency, low off-target effects, transgene-free nature, and low cytotoxic characteristics of reporter RNA enriched RNPs (CRISPR-Cas9 ribonucleoproteins), thus eliminating the need for the selection of monoclonal cells and thereby greatly reducing the generation time of donor cells from 3–4 weeks to 1 week, while also reducing the extent of apoptosis and chromosomal aneuploidy of donor cells. We applied RE-DSRNP to produce cloned pigs bearing a deletion edit of the wild-type p53-induced phosphatase 1 (WIP1) gene: among 32 weaned cloned pigs, 31 (97%) carried WIP1 edits, and 15 (47%) were homozygous for the designed fragment deletion, and no off-target event was detected. The WIP1 knockout (KO) pigs exhibited male reproductive disorders, illustrating the utility of RE-DSRNP for rapidly generating precisely edited animals for functional genomics and disease research. RE-DSRNP’s strong editing performance in a large animal and its marked reduction in the required time for producing SCNT donor cells support its application prospects for rapidly generating populations of transgene-free cloned animals.Supporting InformationThe supporting information is available online at 10.1007/s11427-021-2058-2. The supporting materials are published as submitted, without typesetting or editing. The responsibility for scientific accuracy and content remains entirely with the authors.

Evaluation of porcine urine-derived cells as nuclei donor for somatic cell nuclear transfer.

BackgroundSomatic cell nuclear transfer (SCNT) is used widely in cloning, stem cell research, and regenerative medicine. The type of donor cells is a key factor affecting the SCNT efficiency.ObjectivesThis study examined whether urine-derived somatic cells could be used as donors for SCNT in pigs.MethodsThe viability of cells isolated from urine was assessed using trypan blue and propidium iodide staining. The H3K9me3/H3K27me3 level of the cells was analyzed by immunofluorescence. The in vitro developmental ability of SCNT embryos was evaluated by the blastocyst rate and the expression levels of the core pluripotency factor. Blastocyst cell apoptosis was examined using a terminal deoxynucleotidyl transferase dUTP nick end-labeling assay. The in vivo developmental ability of SCNT embryos was evaluated after embryo transfer.ResultsMost sow urine-derived cells were viable and could be cultured and propagated easily. On the other hand, most of the somatic cells isolated from the boar urine exhibited poor cellular activity. The in vitro development efficiency between the embryos produced by SCNT using porcine embryonic fibroblasts (PEFs) and urine-derived cells were similar. Moreover, The H3K9me3 in SCNT embryos produced from sow urine-derived cells and PEFs at the four-cell stage showed similar intensity. The levels of Oct4, Nanog, and Sox2 expression in blastocysts were similar in the two groups. Furthermore, there is a similar apoptotic level of cloned embryos produced by the two types of cells. Finally, the full-term development ability of the cloned embryos was evaluated, and the cloned fetuses from the urine-derived cells showed absorption.ConclusionsSow urine-derived cells could be used to produce SCNT embryos.

Effect of Embryo Aggregation on In Vitro Development of Adipose-Derived Mesenchymal Stem Cell-Derived Bovine Clones.

Somatic cell nuclear transfer (SCNT) is a method with unique ability to reprogram the epigenome of a fully differentiated cell. However, its efficiency remains extremely low. In this work, we assessed and combined two simple strategies to improve the SCNT efficiency in the bovine. These are the use of less-differentiated donor cells to facilitate nuclear reprogramming and the embryo aggregation (EA) strategy that is thought to compensate for aberrant epigenome reprogramming. We carefully assessed the optimal time of EA by using in vitro-fertilized (IVF) embryos and evaluated whether the use of adipose-derived mesenchymal stem cells (ASCs) as donor for SCNT together with EA improves the blastocyst rates and quality. Based on our results, we determined that the EA improves the preimplantation embryo development per well of IVF and SCNT embryos. We also demonstrated that day 0 (D0) is the optimal aggregation time that leads to a single blastocyst with uniform distribution of the original blastomeres. This was confirmed in bovine IVF embryos and then, the optimal condition was translated to SCNT embryos. Notably, the relative expression of the trophectoderm (TE) marker KRT18 was significantly different between aggregated and nonaggregated ASC-derived embryos. In the bovine, no effect of the donor cell is observed on the developmental rate, or the embryo quality. Therefore, no synergistic effect of the use of both strategies is observed. Our results suggest that EA at D0 is a simple and accessible strategy that improves the blastocyst rate per well in bovine SCNT and IVF embryos and influence the expression of a TE-related marker. The aggregation of two ASC-derived embryos seems to positively affect the embryo quality, which may improve the postimplantation development.

Sheep models of F508del and G542Xcystic fibrosismutations show cellular responses to human therapeutics.

Cystic Fibrosis (CF) is a genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. The F508del and G542X are the most common mutations found in US patients, accounting for 86.4% and 4.6% of all mutations, respectively. The F508del causes deletion of the phenylalanine residue at position 508 and is associated with impaired CFTR protein folding. The G542X is a nonsense mutation that introduces a stop codon into the mRNA, thus preventing normal CFTR protein synthesis. Here, we describe the generation of CFTRF508del / F508del and CFTRG542X / G542X lambs using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT). First, we introduced either F508del or G542X mutations into sheep fetal fibroblasts that were subsequently used as nuclear donors for SCNT. The newborn CF lambs develop pathology similar to CFTR −/− sheep and CF patients. Moreover, tracheal epithelial cells from the CFTRF508del / F508del lambs responded to a human CFTR (hCFTR) potentiator and correctors, and those from CFTRG542X / G542X lambs showed modest restoration of CFTR function following inhibition of nonsense‐mediated decay (NMD) and aminoglycoside antibiotic treatments. Thus, the phenotype and electrophysiology of these novel models represent an important advance for testing new CF therapeutics and gene therapy to improve the health of patients with this life‐limiting disorder.

In vitro Electroporation in the Presence of CRISPR/Cas9 Reagents as a Safe and Effective Method for Producing Biallelic Knock-Out Porcine Embryos

The production of genetically modified (GM) pigs is considered valuable in biomedical research for the development of model animals for various diseases and pigs with resistance against viral infection. The porcine genome may be modified using several methods, such as somatic cell nuclear transfer (SCNT) using GM cells as the SCNT donor, direct injection of the transgene or the genome editing components (GEC) into fertilized eggs referred to as zygotes, the in vitro electroporation (EP) of the zygotes in the presence of GECs, viral infection using retroviruses, injection of the GECs into the SCNT-treated embryos, and the in vitro EP of the SCNT-treated embryos in the presence of GECs. In our previous study, we administered a cytoplasmic injection of CRISPR/Cas9-based GEC into parthenogenetically-activated porcine oocytes (referred to as parthenotes) and observed that these oocytes comprised a mixture of genome-edited and genome-unedited cells, referred to as the “mosaic”. In contrast, when in vitro EP of the SCNT-treated embryos in the presence of GEC was performed, bi-allelic knock out (KO) of the target gene was detected in most oocytes (82%; 9/11). The production of bi-allelic KO piglets is particularly beneficial for investigating GM domestic animals as it does not require further breeding trials to obtain bi-allelic KO individuals, which would otherwise be a time-consuming and laborious task. In this context, the present study was aimed to confirm the efficiency of in vitro EP in producing bi-allelic KO porcine embryos without multiple breeding trials, for which parthenotes were subjected to EP in the presence of a ribonucleoprotein containing Cas9 protein and single-guide RNA (targeted toward GGTA1). The treated embryos were cultured until they transformed into blastocysts. The genomic DNA isolated from these blastocysts was used for molecular biology analysis to detect the possible insertion and deletion of sequences (indels) at the GGTA1 locus. Among the 32 blastocysts obtained, 21 (66%) were observed to be the bi-allelic KO ones. The remaining embryos either had a normal phenotype (25%; 8/32) or mosaic mutations (9%; 3/32). These findings confirm the efficiency of in vitro EP in producing bi-allelic KO porcine embryos.

In vitro Electroporation in the Presence of CRISPR/Cas9 Reagents as a Safe and Effective Method for Producing Biallelic Knock-Out Porcine Embryos

The production of genetically modified (GM) pigs is considered valuable in biomedical research for the development of model animals for various diseases and pigs with resistance against viral infection. The porcine genome may be modified using several methods, such as somatic cell nuclear transfer (SCNT) using GM cells as the SCNT donor, direct injection of the transgene or the genome editing components (GEC) into fertilized eggs referred to as zygotes, the in vitro electroporation (EP) of the zygotes in the presence of GECs, viral infection using retroviruses, injection of the GECs into the SCNT-treated embryos, and the in vitro EP of the SCNT-treated embryos in the presence of GECs. In our previous study, we administered a cytoplasmic injection of CRISPR/Cas9-based GEC into parthenogenetically-activated porcine oocytes (referred to as parthenotes) and observed that these oocytes comprised a mixture of genome-edited and genome-unedited cells, referred to as the “mosaic”. In contrast, when in vitro EP of the SCNT-treated embryos in the presence of GEC was performed, bi-allelic knock out (KO) of the target gene was detected in most oocytes (82%; 9/11). The production of bi-allelic KO piglets is particularly beneficial for investigating GM domestic animals as it does not require further breeding trials to obtain bi-allelic KO individuals, which would otherwise be a time-consuming and laborious task. In this context, the present study was aimed to confirm the efficiency of in vitro EP in producing bi-allelic KO porcine embryos without multiple breeding trials, for which parthenotes were subjected to EP in the presence of a ribonucleoprotein containing Cas9 protein and single-guide RNA (targeted toward GGTA1). The treated embryos were cultured until they transformed into blastocysts. The genomic DNA isolated from these blastocysts was used for molecular biology analysis to detect the possible insertion and deletion of sequences (indels) at the GGTA1 locus. Among the 32 blastocysts obtained, 21 (66%) were observed to be the bi-allelic KO ones. The remaining embryos either had a normal phenotype (25%; 8/32) or mosaic mutations (9%; 3/32). These findings confirm the efficiency of in vitro EP in producing bi-allelic KO porcine embryos.

16 Embryo aggregation and adipose-derived mesenchymal donor cells in bovine somatic cell nuclear transfer

Somatic cell nuclear transfer (SCNT) is a powerful tool, but its efficiency remains low. The use of less differentiated donor cells or the embryo aggregation (EA) strategy improves the SCNT rates in several species. It remains unexplored whether the combined use of both strategies results in a synergistic effect that improves SCNT efficiency in bovine. To evaluate that, we assessed the optimal time of EA using IVF embryos (aim 1) and we evaluated whether the use of adipose-derived mesenchymal stem cells (ASC) as donor for SCNT together with EA improves the blastocyst rates and quality (aim 2). For aim 1, cumulus–oocyte complexes (COCs) were collected from slaughterhouse ovaries, invitro matured (TCM-199), fertilized (16×106 spermatozoa mL−1 for 5h) and cultured (synthetic oviductal fluid media in a humidified gas mixture at 39°C). After IVF, the zona pellucida was enzymatically removed and zona-free (ZF) embryos were cultured individually (1X) or 2 embryos placed together within a microwell (2X) (Day 0, n=70). This procedure was performed at Days 3, 4, 5, 6, or 7 (n=76, 78, 94, 96, 90, respectively) and blastocyst rate was assessed at Day 8. Contribution of both embryos to the 2X blastocyst was confirmed by staining Day 0 IVF embryos either with green or red Mitotracker (ThermoFisher Scientific) before EA. For aim 2, fibroblast (FB) and ASC cells were isolated from the skin and subcutaneous adipose tissue of the same adult animal, respectively. Cloned embryos were produced by ZF enucleation, fusion of one ASC or FB cell, and activation with 5μM ionomycin/6-(dimethylamino)purine (6DMAP). After activation, cloned embryos were aggregated (FB2X or ASC2X) or individually cultured (FB1X or ASC1X). Blastocyst rates were recorded at Day 7 of invitro culture. Three biological replicates were evaluated for each aim. Embryo developmental differences were determined using Fisher’s exact test. Relative expression of OCT4, SOX2, and KRT18 was measured by RTqPCR at the blastocyst stage and analysed by Kruskal–Wallis statistical test. Regarding aim 1, no differences for developmental rates were found for Day 0, 3, 4, and 5 groups (57%, 60%, 61.5%, 61%), but the blastocyst rate was only improved in Day 0 and Day 3 relative to their respective 1X controls (Day 0 2X 54.2% vs. Day 0 1X 25.5% and Day 3 2X 52.6% vs. Day 3 1X 25.3%). No aggregation occurred in Day 6 and Day 7 groups. All blastomeres were homogeneously distributed in the 2X blastocyst. Regarding aim 2, no effect of the donor cell was observed on the blastocyst rate (FB1X 26.8%, n=82; ASC1X 21.7%, n=198; FB2X 39.7%, n=126; ASC2X 33%, n=204), whereas EA improved the blastocyst rate of ASC-derived embryos (ASC1X 21.7% vs. ASC2X 33%). Overall, no synergistic effect of the use of both strategies was observed. Relative expression of KRT18 was significantly different between ASC1X and ASC2X embryos. Although OCT4 and SOX2 expression did not differ between groups, EA tended to bring the values closer to that of an IVF embryo. No effect of the donor cell was observed on the embryo relative expression. Our results suggest that EA at Day 0 improves the blastocyst rate in bovine SCNT and IVF embryos. EA of 2 ASC-derived embryos seemed to normalise the embryo quality and may improve post-implantation development.

Generation of Transgenic Cloned Buffalo Embryos Harboring the EGFP Gene in the Y Chromosome Using CRISPR/Cas9-Mediated Targeted Integration.

Sex control technology is of great significance in the production of domestic animals, especially for rapidly breeding water buffalo (bubalus bubalis), which served as a research model in the present study. We have confirmed that a fluorescence protein integrated into the Y chromosome is fit for sexing pre-implantation embryos in the mouse. Firstly, we optimized the efficiency of targeted integration of exogenous gene encoding enhanced green fluorescent protein (eGFP) and mCherry in Neuro-2a cells, mouse embryonic stem cells, mouse embryonic cells (NIH3T3), buffalo fetal fibroblast (BFF) cells. The results showed that a homology arm length of 800 bp on both sides of the target is more efficient that 300 bp or 300 bp/800 bp. Homology-directed repair (HDR)-mediated knock-in in BFF cells was also significantly improved when cells were supplemented with pifithrin-μ, which is a small molecule that inhibits the binding of p53 to mitochondria. Three pulses at 250 V resulted in the most efficient electroporation in BFF cells and 1.5 μg/mL puromycin was found to be the optimal concentration for screening. Moreover, Y-Chr-eGFP transgenic BFF cells and cloned buffalo embryos were successfully generated using CRISPR/Cas9-mediated gene editing combined with the somatic cell nuclear transfer (SCNT) technique. At passage numbers 6–8, the growth rate and cell proliferation rate were significantly lower in Y-Chr-eGFP transgenic than in non-transgenic BFF cells; the expression levels of the methylation-related genes DNMT1 and DNMT3a were similar; however, the expression levels of the acetylation-related genes HDAC1, HDAC2, and HDAC3 were significantly higher (p < 0.05) in Y-Chr-eGFP transgenic BFF cells compared with non-transgenic cells. Y-Chr-eGFP transgenic BFFs were used as donors for SCNT, the results showed that eGFP reporter is suitable for the visualization of the sex of embryos. The blastocyst rates of cloned buffalo embryos were similar; however, the cleavage rates of transgenic cloned embryos were significantly lower compared with control. In summary, we optimized the protocol for generating transgenic BFF cells and successfully generated Y-Chr-eGFP transgenic embryos using these cells as donors.

134 Generation of NANOS2 knockout goats using CRISPR/Cas9 and somatic cell nuclear transfer techniques

The NANOS2 gene, encoding an RNA binding protein, is known to play a critical role in the development of germline for all organisms studied to date. The male mice with biallelic NANOS2 knockouts (KOs) are sterile due to apoptosis of prospermatogonia shortly after birth but with morphologically intact seminiferous tubules. Thus, the choice of NANOS2 for targeting could be a viable strategy to develop germline ablated males that would serve as recipients for exogenous spermatogonial stem cell transplantation. The goat is a potential model of human physiology and an agriculturally important species. Here, we report successful generation of NANOS2 KO goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We first designed 4 single-guide RNAs (sgRNAs) specific for the single exon of goat NANOS2 (GenBank: NC_030825.1). The targeting vectors were constructed by using the pX330 plasmid (Addgene: 42230) and transfected into sheep fetal fibroblasts. Mutation efficiency analysis showed that 3 of them (out of 4, 75.0%) were efficient in directing Cas9 to generate targeted cleavages, with mutation efficiencies of 10-30%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with one of targeting vectors (sgRNA: GCTGGAGACCCAAGGGACTG). Colony screening with PCR/restriction fragment length polymorphism (RFLP) assays confirmed that we achieved biallelic mutations in the targeting site in 6 of 89 (6.7%) male and 6 of 172 (3.5%) female colonies. Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of NANOS2. Three male and two female colonies with NANOS2 null mutations were identified and used as cell donors for SCNT. In total, 202 cloned 1-cell stage embryos (130 male or 72 female) were generated and surgically transferred into 12 synchronized recipients. Six of them (6 of 12, 50.0%) were confirmed pregnant by ultrasonography on Day 40-45 of gestation. Four pregnancies developed to term, resulting in six offspring (five males and one female). Sequence analysis and PCR/RFLP assays showed that both male and female offspring carried the mutations in NANOS2, which were identical to the donor colonies from which they originated. Our results indicated that CRISPR/Cas9 combined with SCNT is an efficient system for generating NANOS2 KO goats. The phenotypic analysis to assess the effects of NANOS2 KO on the development of germline in male cloned goats is in progress.

6 Invitro validation of gene edited phenotypes using CRISPR-dCas9 transcriptional activators

Despite the extensive advantages of gene-edited large animals for agriculture and biomedical purposes, they represent a large monetary and time investment due to high husbandry costs, long gestation lengths, and few offspring; that is, 9 months for one calf and almost 4 months for pigs. Even with known DNA sequences before somatic cell nuclear transfer (SCNT), inserted transgenes are often not expressed as expected. Therefore, there is a need to phenotypically validate the gene modifications invitro before investing time and resources in the creation of a gene-edited large animal; however, many gene targets are tissue specific and not expressed in SCNT donor cells. In this work, we show that CRISPR-dCas9 transcriptional activators (TAs) can be used to validate functional transgene insertion in nonexpressing SCNT donor cells, in our case fetal fibroblasts. To demonstrate this concept, we first generated a DNA knockin of the H2B-GFP sequence into the porcine LGR5 locus. CRISPR/Cas9 nuclease was used to create a double-stranded break in the genomic DNA downstream of the LGR5 promoter. A homology-directed repair template plasmid containing H2B-GFP flanked by 1000bp homology arms flanking the cut site was co-transfected with the Cas9 and gRNA, and cells were seeded at low density for colony outgrowth. Colonies were genotyped by PCR and sequencing to verify successful targeted transgene integration. To test whether TAs allow for invitro validation of transgene expression, 5×105 wildtype or gene-edited fibroblasts were nucleofected (Lonza) with 500ng total of four gRNA plasmids (Addgene #43860) designed to target the 1-kb region upstream of the LGR5 transcriptional start site in combination with 500ng VP64-dCas9 (Addgene #47107). Detection of green fluorescent protein (GFP) was analysed by fluorescent microscopy followed by flow cytometry; at least 30 000 events were recorded for each treatment (Cytoflex). Our results show that GFP was detected in on average 28.6% of the gene-edited cells transfected with LGR5 TAs but not detected in gene-edited cells that were not transfected with LGR5 TAs (0%) or in wild-type cells transfected with the LGR5 TAs (0%). The experiment was repeated three times. Next, to prove that our invitro validation replicates the invivo phenotype, the gene-edited colonies heterozygous for the insertion were used for SCNT to generate piglets. Epidermal cells, which contain a population of LGR5+ stem cells, were isolated from the skin and sorted for GFP expression. The RT-qPCR results from GFP+ or GFP− cells showed the presence of LGR5 transcripts in the GFP+ cells but not GFP− cells. In conclusion, TAs were necessary and sufficient to detect LGR5-promoter driven H2B-GFP expression in gene-edited fibroblasts invitro, which faithfully recapitulates the invivo phenotype of the gene-edited animal. Further preliminary data from our laboratory suggest that our novel method can be used to detect successful gene knockouts in addition to transgene knockins and can be used to validate phenotypic outcomes of DNA modifications before the generation of gene-edited animals.

Comparative study of the developmental competence of cloned pig embryos derived from spermatogonial stem cells and fetal fibroblasts

Spermatogonial stem cells (SSC) are promising resources for genetic preservation and restoration of male germ cells in humans and animals. However, no studies have used SSC as donor nuclei in pig somatic cell nuclear transfer (SCNT). This study investigated the potential for use of porcine SSC as a nuclei donor for SCNT and developmental competence of SSC-derived cloned embryos. In addition, demecolcine was investigated to determine whether it could prevent rupture of SSC during SCNT. When the potential of SSC to support embryonic development after SCNT was compared with that of foetal fibroblasts (FF), SSC-derived SCNT embryos showed a higher (p<.05) developmental competence to the blastocyst stage (47.8%) than FF-derived embryos (25.6%). However, when SSC were used as donor nuclei in the SCNT process, cell fusion rates were lower (p<.05) than when FF were used (61.9% vs. 75.8%). Treatment of SSC with demecolcine significantly (p<.05) decreased rupture of SSC during the SCNT procedure (7.5% vs. 18.8%) and increased fusion of cell-oocyte couplets compared with no treatment (74.6% vs. 61.6%). In addition, SSC-derived SCNT embryos showed higher blastocyst formation (48.4%) than FF-derived embryos without (28.4%) and with demecolcine treatment (17.4%), even after demecolcine treatment. Our results demonstrate that porcine SSC are a desirable donor cell type for production of SCNT pig embryos and that demecolcine increases production efficiency of cloned embryos by inhibiting rupture of nuclei donor SSC during SCNT.

205 Towards the correction of meconium ileus with cystic fibrosis transmembrane conductance regulator (CFTR) intestinal expression in CFTR knockout sheep

Cystic fibrosis (CF) is a human autosomal genetic disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is responsible for Cl − anion transport in epithelial cells. We previously generated CFTR +/− and CFTR −/− lambs using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. The CFTR −/− lambs display many features similar to humans with CF, including meconium ileus (MI), pancreatic fibrosis, portal fibrosis and biliary hyperplasia, small gallbladder, and absence of the vas deferens. Although MI affects only 15 to 20% of human babies with CF, it was observed in 100% of newborn CFTR −/− lambs and was the primary cause of death. We here hypothesized that the transgenic expression of ovine CFTR cDNA under regulation of the rat intestinal fatty acid binding protein (iFABP) promoter would promote the correction of MI in CFTR −/− sheep. In this study, we constructed the pcDNA3.1&amp;gt;iFABP&amp;gt;CFTR expression vector in order to generate iFABP&amp;gt;CFTR transgenic CFTR −/− sheep. PCR and sequence analysis of all junction regions confirmed the presence of the inserts in the vector. We transfected male and female CFTR −/− sheep fetal fibroblasts with the construct. Three days after transfection, limiting dilution and G418 selection were used for the isolation of resistant single cell derived colonies. A total of 15 male colonies containing the pcDNA3.1&amp;gt;iFABP&amp;gt;CFTR vector was confirmed by PCR and sequence analysis. Three male cell colonies were used as nuclear donors for SCNT. In total, 129 one-cell-stage cloned embryos were generated and transferred into 11 estrus-synchronized recipients. Four recipients (4/11; 36.3%) were confirmed pregnant at Day 40 to 45 of gestation. One pregnancy went to term and resulted in the birth of a single lamb. The necropsy indicated the same abnormalities, including MI, seen in CFTR −/− lambs. A PCR assay confirmed the presence of the iFABP&amp;gt;CFTR transgene in the genome of the cloned offspring. The lack of MI correction is likely due to the low expression of CFTR in this particular colony. Western blot analysis is in progress. Additional embryo transfers will be performed using different single-cell-derived colonies.

Production of microhomologous-mediated site-specific integrated LacS gene cow using TALENs

Gene editing tools (Zinc-Finger Nucleases, ZFN; Transcription Activator-Like Effector Nucleases, TALEN; and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas)9, CRISPR-Cas9) provide us with a powerful means of performing genetic engineering procedures. A combinational approach that utilizes both somatic cell nuclear transfer (SCNT) and somatic cell gene editing facilitates the generation of genetically engineered animals. However, the associated research has utilized markers and/or selected genes, which constitute a potential threat to biosafety. Microhomologous-mediated end-joining (MMEJ) has showed the utilization of micro-homologous arms (5–25 bp) can mediate exogenous gene insertion. Dairy milk is a major source of nutrition worldwide. However, most people are not capable of optimally utilizing the nutrition in milk because of lactose intolerance. Sulfolobus solfataricus β-glycosidase (LacS) is a lactase derived from the extreme thermophilic archaeon Sulfolobus solfataricus. Our finally aim was to site-specific integrated LacS gene into cow's genome through TALEN-mediated MMEJ and produce low-lactose cow. Firstly, we constructed TALENs vectors which target to the cow's β-casein locus and LacS gene expression vector which contain TALEN reorganization sequence and micro-homologous arms. Then we co-transfected these vectors into fetal derived skin fibroblasts and cultured as monoclone. Positive cell clones were screened using 3′ junction PCR amplification and sequencing analysis. The positive cells were used as donors for SCNT and embryo transfer (ET). Lastly, we detected the genotype through PCR of blood genomic DNA. This resulted in a LacS knock-in rate of 0.8% in TALEN-treated cattle fetal fibroblasts. The blastocyst rate of SCNT embryo was 27%. The 3 months pregnancy rate was 20%. Finally, we obtained 1 newborn cow (5%) and verified its genotype. We obtained 1 site-specific marker-free LacS transgenic cow. It provides a basis to solve lactose intolerance by gene engineering breeding. This study also provides us with a new strategy to facilitate gene knock-ins in livestock using techniques that exhibit improved biosafety and intuitive methodologies.

Porcine somatic cell nuclear transfer donor sources affect transplant success: A meta-analysis

Herd boars, male domestic pigs used for stud, are economically important, and somatic cell nuclear transfer (SCNT) is a promising technology to expand herd boar yields. However, live births are dictated by donor cell source, and fetal donors may offer more advantages than adult donors. A meta-analysis was conducted to better understand how donor sources affect SCNT outcomes. Of the 1,431 records viewed, 10 were selected for review. Blastocyst formation rates, successful pregnancies, and live births were assessed to measure efficacy. SCNT blastocyst formation differed between adult and fetal donors among the studies. SCNT pigs had more malformed fetuses as well, which negatively affected the post-birth mortality. Organs of porcine fetuses are limited by deficiencies of maternal nutrient and growth hormones, which compromise post-birth adaptations. SCNT pregnancy success is neither determined by donor source nor by live births. Live births are also tied to donor age. Embryos from fetal donors are more frequently healthy likely due to less differentiation and less reprogramming of reconstructed embryos. Adult donors in contrast have more cell differentiation and as such accumulate more mutations and damage. This may reduce reconstructed embryo viability. Finally, SCNT efficiency may be improved with more in vitro passages, but more work is required to validate this concept.

Efficient Generation of Somatic Cell Nuclear Transfer-Competent Porcine Cells with Mutated Alleles at Multiple Target Loci by Using CRISPR/Cas9 Combined with Targeted Toxin-Based Selection System.

The recent advancement in genome editing such a CRISPR/Cas9 system has enabled isolation of cells with knocked multiple alleles through a one-step transfection. Somatic cell nuclear transfer (SCNT) has been frequently employed as one of the efficient tools for the production of genetically modified (GM) animals. To use GM cells as SCNT donor, efficient isolation of transfectants with mutations at multiple target loci is often required. The methods for the isolation of such GM cells largely rely on the use of drug selection-based approach using selectable genes; however, it is often difficult to isolate cells with mutations at multiple target loci. In this study, we used a novel approach for the efficient isolation of porcine cells with at least two target loci mutations by one-step introduction of CRISPR/Cas9-related components. A single guide (sg) RNA targeted to GGTA1 gene, involved in the synthesis of cell-surface α-Gal epitope (known as xenogenic antigen), is always a prerequisite. When the transfected cells were reacted with toxin-labeled BS-I-B4 isolectin for 2 h at 37 °C to eliminate α-Gal epitope-expressing cells, the surviving clones lacked α-Gal epitope expression and were highly expected to exhibit induced mutations at another target loci. Analysis of these α-Gal epitope-negative surviving cells demonstrated a 100% occurrence of genome editing at target loci. SCNT using these cells as donors resulted in the production of cloned blastocysts with the genotype similar to that of the donor cells used. Thus, this novel system will be useful for SCNT-mediated acquisition of GM cloned piglets, in which multiple target loci may be mutated.

28 Generation of Immunoglobulin Heavy Constant Mu (IGHM) Knockout Goats Using CRISPR/Cas9 and Somatic Cell Nuclear Transfer

Towards the goals of inactivating endogenous goat immunoglobulin (Ig) genes and producing fully human polyclonal antibodies in transchromosomal goats carrying a human artificial chromosome comprising the entire human Ig gene repertoire, we report here the successful generation of IgM heavy chain knockout (IGHM−/−) goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. Two single-guide RNAs (sgRNAs) were designed specific for exon 1 of the goat IGHM constant region (GenBank: EU182621.1). The gene-targeting vectors were constructed by using pX330 plasmid (Plasmid No. 42230, Addgene, Cambridge, MA, USA) and transfected into 2 × 105 goat fetal fibroblast cells. Gene-targeting efficiency of each targeting vector was determined by PCR-restriction fragment length polymorphism (RFLP) assay 3 days post-transfection. Our results showed that one of the sgRNAs, 5′-GAAAGGCGCTTGAGGAATGC-3′, was efficient in directing Cas9 to generate targeted cleavages in exon 1 of IGHM constant region, with a mutation efficiency of 20%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with the targeting vector. Colony screening with the PCR-RFLP assay confirmed that we achieved targeted gene disruption in exon 1 in 11/49 (22.4%) of the colonies (7 colonies with biallelic and 4 with monoallelic gene disruption). Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of exon 1. One of the colonies harboring a 1-nucleotide (nt) deletion was used as nuclear donors for SCNT. A total of 102 1-cell-stage cloned embryos were generated and surgically transferred into 6 synchronized recipients. Three of the recipients (3/6, 50.0%) were confirmed pregnant by ultrasonography on Day 40 to 45 of gestation. Two pregnancies were sacrificed for IGHM−/− fetal fibroblast isolation and one pregnancy was allowed to go to term, which led to the birth of a live and seemingly healthy kid. This goat was reared conventionally and appeared healthy until 5 weeks of age when it was killed because of commensal virus infection. The PCR-RFLP assay and sequence analysis showed that this cloned goat carried a biallelic 1-nt deletion in exon 1 of IGHM, which was identical to the donor colony it was originated from. No lymphoid follicles were observed in lymph nodes and spleen by histology, and immunohistochemistry for B cells (CD20) and T cells (CD3) demonstrated a lack of B cells in lymph nodes and spleen but the presence of T cells, confirming that IGHM has been successfully knocked out.

Taillessness in a Cloned Cow is Not Genetically Transmitted.

Somatic cell nuclear transfer (SCNT), commonly referred to as cloning, results in the generation of offspring that, except for mitochondrial DNA, are genetically identical to the nuclear donor. We previously used a genetically modified bovine cell line as the donor for SCNT and obtained a calf, named Daisy, that was born without a tail. To determine whether the missing tail was a result of the genetic modification, we performed recloning experiments by using either cells from a sacrificed pregnancy of a second clone (Daisy's “twin” clone) or cells from tailless Daisy as donors for SCNT. Cloned fetuses from aborted pregnancies and a cloned live calf that died shortly after birth were examined and confirmed to all possess tails. Hence, the observed phenotype of Daisy's lacking tail is not due to the introduced transgene or a mutation present in the cell that was used for her production. Rather, the missing tail has most likely arisen from an epigenetic reprogramming error during development.