Donor Colonies Research Articles

Loss of coral thermotolerance following year-long in situ nursery propagation with a consecutively high summer heat-load

Exposure to more frequent ocean warming events is driving the loss of coral reef cover as the window of recovery between episodes of bleaching reduces. Coral propagation via in situ nurseries and subsequent outplanting have increased worldwide to support replenishing coral cover on degraded reefs. However, challenges in identifying fast-growing and bleaching-resistant target corals have limited how informative we can be regarding the resilience of outplanted corals. Here, we employed short-term thermal stress assays using the Coral Bleaching Automated Stress System (CBASS) to assess the thermal threshold of a fast-growing coral pre- and post-propagation on in situ nursery frames. We show that year-long nursery-propagated corals exhibit a statistically significant reduction in thermal thresholds (i.e., ED50s) compared to their corresponding reef-based donor colonies based on dose–response modelling of dark acclimated photosynthetic efficiency. RNA-Seq was then used to assess the underlying drivers of this thermotolerance reduction, identifying that processes involved in metabolic and oxidative stress management were disrupted in nursery versus donor heat-treated corals. Whether trade-offs during potential growth-focused phases (post-fragmentation), nursery conditions, and/or a consecutively high summer heat-load drove the lower thermal capacity remains to be determined. However, nursery corals expressed genes associated with telomere maintenance, which are typically expressed in stress-sensitive fast-growing corals under seasonal environmental stress, suggesting consecutively high summer heat-loading contributed to the observed patterns. Our results highlight that thermal tolerance is (i) variable and (ii) subject to acclimation to varying degrees across colonies. Thus, a path forward for reef practitioners to improve propagation efforts may entail the initial screening of a larger reef population from which thermally superior colonies can be selected for propagation.

Gardening Pocillopora spp. fragments and their potential for rebuilding reef systems in the southern Mexican Pacific

The degradation of coral reefs during the last decades has turned attention toward management and restoration interventions. This study seeks to operationalize coral gardening of Pocillopora spp. fragments in low profile bottom‐anchored nurseries and to compare survival and growth patterns between sites, time, and fragment size in the southern Mexican Pacific. After 357 days, fragments showed high survival (96.4%), growth rates (4.35 cm/year), and an increase in coral coverage from 3.62 ± 1.3% (mean ± SD) to 17.42 ± 4.8% (approximately 480%). Coral growth rate did not show differences between sites (pseudo‐F[1,635] = 0.21, p = 0.63), but corals grew more significantly during the upwelling season in the Gulf of Tehuantepec. According to linear and local regression analysis, the extension rate in nurseries was significantly higher when corals were smaller (<7 cm in diameter) being of relevance for operationalizing coral gardening from donor colonies; nevertheless, coral shrinkage (13.1%), when corals were smaller (i.e. during the early phases of the coral gardening protocol), calls for precaution and close monitoring. Operationalizing coral gardening of Pocillopora spp. fragments, including successful metrics in upwelling areas, are relevant for reef restoration in the eastern tropical Pacific; nevertheless, lessons regarding shrinkage and differential growth rates related to coral size should also be considered.

Bacterial communities associated with corals out-planted on the Great Barrier Reef are inherently dynamic over space and time

Coral propagation and out-planting are becoming commonly adopted as part of reef stewardship strategies aimed at improving reef resilience through enhanced natural recovery and rehabilitation. The coral microbiome has a crucial role in the success of the coral holobiont and can be impacted shortly after out-planting. However, long-term characterisation of the out-plant microbiome in relation to out-plant survival, and how these properties vary across reef sites, is unexplored. Therefore, at three reef sites on Opal Reef, Great Barrier Reef (Mojo, Sandbox and Rayban, 16°12′18″S 145°53′54″E), we examined bacterial communities associated with out-planted Acropora millepora coral and monitored coral survival over 12 months (February 2021–22). Bacterial communities of out-planted corals exhibited significant changes from donor colonies 7 days to 1.5 months after out-planting. Further, bacterial community composition differed for sites Sandbox and Rayban with low overall survival (0–43%) versus Mojo with higher overall survival (47–75%). After initial dissimilarity in bacterial communities of out-plants across sites at 1.5 months, and despite changes within sites over time, out-plants exhibited similar microbial communities across sites at 7 days and 6, 9 and 12 months. We hypothesise these trends reflect how bacterial communities are shaped by rapid changes in local environmental characteristics (e.g. from source to out-planting site), where out-plant bacterial communities ‘conform’ to out-planting site conditions. After initial changes, out-plant bacterial communities may then be under the influence of global environmental conditions—such as annual trends in temperature across seasons. Such outcomes indicate the importance of site selection in shaping initial coral bacterial communities and subsequent out-plant success. Importantly, continued differences in out-plant survival trajectory but similar bacterial communities across sites after 1.5 months indicate that other factors—apart from bacterial community changes—likely govern out-plant success in the longer term. Our research highlights the need to resolve drivers of small-scale site differences alongside higher resolution spatiotemporal monitoring of environmental conditions to distinguish key drivers of (i) microbial change during out-planting and (ii) out-plant survival to subsequently inform out-plant site selection to optimise future restoration efforts.

The influence of fragment type, time, and coral host genotype on early growth of nursery reared Acropora cervicornis

Identifying factors that influence nursery coral growth can help estimate nursery productivity and optimize yield. We examined the growth rates of Acropora cervicornis fragments from a nearshore nursery in Fort Lauderdale, Florida to determine how time after fragmentation, fragment type, donor colony nursery structure, and genotype influenced growth. Growth rates were calculated from linear extension measurements of fragments representing 10 coral host genotypes 27 and 61 days after fragmenting. Fragments were classified as apical (obtained from branch tips) or proximal (obtained midbranch), based on photographs. Donor colony nursery structure did not influence growth. A linear mixed‐effects model was performed to assess the influence of time, fragment type, and genotype on growth. Growth rates at 61 days were faster than at 27 days, and apical fragments grew faster than proximal fragments in 2 out of 10 genets at 61 days, providing some evidence for a trade‐off between growth and healing. We found no significant genet growth differences at 27 days. However, differences between genets were detected in 61‐day growth rates, suggesting that growth differences among distinct A. cervicornis genets propagated by asexual fragmentation may not emerge before 2 months, regardless of donor colony structure or fragment type. Our results suggest that restoration practitioners need not monitor growth between genets before 2 months to save resources from ongoing monitoring. In addition, scientists using coral fragments in experiments should be aware that growth differences between genets may take longer than 60 days to appear, posing some risk of confounding experimental results.

Conservation of Host, Translocation of Parasites—Monitoring of Helminths during Population Reinforcement of the European Ground Squirrel (Spermophilus citellus)

Gastrointestinal helminth parasites can be transferred during conservation translocations and impact their outcome. The current study applied non-invasive coprological sampling to investigate the helminth infection rates and dynamics in translocated and resident European ground squirrels, during and after a population reinforcement. The FLOTAC method was calibrated and applied for the first time for the target species. In the studied coprological samples, helminth eggs belonging to Acanthocephala and Nematoda were found; the latter were morphologically identified as belonging to the families Capillariidae (Enoplida) and Trichostrongylidae (Strongylida) and superfamily Spiruroidea (Spirurida). The overall helminth prevalence and their diversity were higher in the donor colony compared to the resident one before the reinforcement. Pronounced seasonal dynamics in the parasite prevalence and diversity were observed, and their values were considerably lower in spring than in summer in both translocated and resident hosts. A year after the start of the translocation, the helminth prevalence and number of species detected in the reinforced colony had increased significantly. This is in accordance with epidemiological models and other empirical studies that predict a positive relationship between the population density of a host and the prevalence and species richness of parasites.

Influence of virus abundances in donor colonies and nurse hives on queens of Apis mellifera during the rearing process.

Honeybees are one of the three most important animals for mankind. In order to be safe and increase number of bee colonies for pollination, the breeding of queens is necessary. For several decades, bees were selected on economic and behavioral aspects. With the appearance of the neozootic mite Varroa destructor beekeepers were forced to adapt their methods. Varroa destructor can act as a vector for many different bee pathogenic viruses and by this potentiates its devastating impact. Methods of rearing queens were not evaluated since the mites' appearance. Besides scientific approaches, viruses received too little attention in regard to the rearing process of honeybee queens. Herein, we present a detailed analysis of virus abundances [Aparavirus, acute bee paralysis virus (ABPV); Triatovirus, black queen cell virus (BQCV); Cripavirus, chronic bee paralysis virus (CBPV); and Iflaviruses, deformed wings virus (DWV), Sacbrood virus (SBV), VDV-1] in breeding hives, donating first instar larvae, hives that are nursing these larvae until the pupa stage, and on queens of Apis mellifera in a breeding apiary. Nurse and donor colonies of the queen-rearing process were sampled in the year 2020 and analyzed by RT qPCR. Virus quantifications were correlated with queen mortalities and seasonal effects. Virus detections increased in reared queens, however, the elevated virus titers did not increase the mortality of the queens until their exclosure. Moreover, we observed a lower interrelation between virus abundance in queens and their original donor colonies, than between nurse hives and their nursed queens. The bee pathogenic viruses ABPV, BQCV, CBPV, DWV, SBV, and VDV-1 do not influence the mortality of bee queens during the rearing process. Whether respective virus loads result in sublethal or long-term effects remains to be elucidated.

Substantial advancement in aquaria rearing methods to assist recovery of an Endangered soft coral

Abstract The temperate soft coral Dendronephthya australis has been listed as Endangered in NSW, Australia, owing to its restricted geographic range, rapidly declining populations, and a number of escalating threats. Research to assess practical methods for aquarium cultivation of D. australis for rehabilitation of wild populations is considered a high priority. Previous attempts at restoration by transplanting D. australis fragments have had limited success, but identified key challenges, which included achieving attachment to substrates and identifying appropriate foods to maximize survival. This study presents the results of experiments promoting the attachment of cuttings (nubbins) removed from donor colonies to moveable substrates (small concrete discs). Using a balanced orthogonal experimental design, three feeding regimes were tested: live artemia, live rotifers and dry powdered zooplankton. Donor colony survival and growth were also monitored over a 6 month period in the field. An overall nubbin survival rate of 100% was achieved under all three feeding regimes. Attachment rates were similar across feeding treatments, although nubbin behavioural responses (percentage of open polyps before feeding) suggested some preference for live rotifers. The cutting removal process had no significant effect on donor colonies in the wild, indicating that this is a sustainable approach for restoration. Overall, this study substantially advances the methodology for maintaining an Endangered azooxanthellate soft coral in aquaria and provides valuable input for management programmes aimed at implementing transplantation into the wild to aid species recovery.

Comparing different farming habitats for mid-water rope nurseries to advance coral restoration efforts in the Maldives.

The need for comprehensive and effective coral restoration projects, as part of a broader conservation management strategy, is accelerating in the face of coral reef ecosystem decline. This study aims to expand the currently limited knowledge base for restoration techniques in the Maldives by testing the performance of mid-water rope nurseries in a lagoon and a reef habitat. We examined whether different coral farming habitats impacted fragment survival, health and growth of two coral genera and how the occurrence of mutualistic fauna, predation and disease influenced coral rearing success. Two nurseries were stocked with a total of 448 Pocillopora verrucosa and 96 Acropora spp. fragments, divided into different groups (four Pocillopora groups: lagoon nursery at 5 m; reef nursery at 5, 10 and 15 m; two Acropora groups: lagoon nursery at 5 m and reef nursery at 5 m). Eight fragment replicates from the same donor colony (Pocillopora genets: N = 14, Acropora genets N = 6) were used in each group and monitored for one year. Our results show that fragment survival was high in both farming habitats (>90%), with P. verrucosa surviving significantly better in the lagoon and Acropora spp. surviving and growing significantly faster in the reef nursery. P. verrucosa growth rates were similar between reef and lagoon habitat. Different rearing depths in the reef nursery had no impact on the survival of P. verrucosa but coral growth decreased considerably with depth, reducing fragments’ ecological volume augmentation and growth rates by almost half from 5 to 15 m depth. Further, higher fish predation rates on fragments were recorded on the reef, which did not impact overall nursery performance. Mutualistic fauna, which correlated positively with fragment survival, was more frequently observed in the lagoon nursery. The occurrence of disease was noted in both habitats, even though implications for fragment health were more severe in the lagoon. Overall, our study demonstrates that lagoon and reef nurseries are suitable for rearing large numbers of coral fragments for transplantation. Nevertheless, we recommend considering the specific environmental conditions of the farming habitat, in particular water quality and year-round accessibility, in each case and to adjust the coral farming strategy accordingly. We hope that this novel research encourages the increased application of mid-water rope nurseries for ‘coral gardening’ to advance coral reef recovery and climate resilience in the Maldives.

Emersion-Associated Responses of an Intertidal Coral and Its Suitability for Transplantation to Ecologically Engineer Seawalls

There is a growing interest in transplanting corals onto the intertidal section of artificial coastal defences (e.g., seawalls) as an ecological engineering strategy to enhance biodiversity on urban shores. However, this inevitably results in exposure to the harsh environmental conditions associated with emersion (aerial exposure). Although the effects of a multitude of environmental stressors on corals have been examined, their photophysiological and gene expression responses to emersion stress remain understudied, as does the among-genotype variation in these responses. In this study, we conducted an in situ experiment to test the effects of increased daily emersion duration on a locally common intertidal coral, Dipsastraea cf. lizardensis. Coral fragments (n = 3) from five genotypically distinct colonies were subjected to two treatments: (1) increased daily emersion duration (~4.5 h d−1) and, (2) control (~3 h d−1) for three consecutive days during spring low tide. We examined the post-experimental photophysiological responses and expression level of a stress-associated gene, Hsp16. Relative to the controls, coral fragments that were exposed to longer daily emersion duration displayed significantly reduced effective quantum yield, while endosymbiont density varied significantly among genotypes across the experimental conditions. We found no significant differences in chlorophyll a concentration and Hsp16 gene expression level, suggesting that changes in these processes may be gradual and the duration of treatment that the corals were subjected to is likely within their tolerance limits. Taken together, it appears that D. cf. lizardensis displays substantial capacity to cope with sup-optimal conditions associated with emersion which makes it a promising candidate for transplantation onto intertidal seawalls. However, within-species variation in their stress response indicates that not all genotypes respond similarly to emersion, and this should be taken into account when selecting donor colonies for transplantation.

Neighboring colonies influence uptake of thermotolerant endosymbionts in threatened Caribbean coral recruits

Intervention strategies to enhance coral resilience include manipulating associations with algal endosymbionts. While hosting thermotolerant Durusdinium trenchii can increase bleaching thresholds in Caribbean coral adults, its effects remain largely unknown during their early life stages. Here, we tested if Orbicella faveolata recruits could establish symbiosis with D. trenchii supplied by nearby “donor” colonies and examined the resulting ecological trade-offs to evaluate early Symbiodiniaceae manipulation as a scalable tool for reef restoration. We exposed aposymbiotic recruits to 29 °C or 31 °C and to fragments of Montastraea cavernosa (containing Cladocopium ITS2 type C3) or Siderastrea siderea (containing D. trenchii). After 60 days, recruits reared with D. trenchii donors hosted nearly three times more D. trenchii than those with Cladocopium donors, suggesting that recruits can acquire Symbiodiniaceae from nearby corals of different species. Temperature did not affect symbiont identity. Next, donor colonies were removed and surviving recruits were maintained for three months at ambient temperatures, after which a subset was exposed to a 60-day heat stress. Recruits previously reared at 31 °C survived twice as long at 34 °C as those reared at 29 °C, suggesting that pre-exposure to heat can prime recruits to withstand future thermal stress. Furthermore, recruits hosting primarily D. trenchii survived twice as long at 34 °C as those hosting little or no D. trenchii. However, the proportion of D. trenchii hosted was negatively correlated with polyp size and symbiont density, indicating a trade-off between growth (of both host and symbiont) and heat tolerance. These findings suggest that, while donor colonies may be effective sources for seeding coral recruits with thermotolerant symbionts, practitioners will need to balance the likely benefits and costs of these approaches when designing restoration strategies.

Accelerated Varroa destructor population growth in honey bee (Apis mellifera) colonies is associated with visitation from non-natal bees

A leading cause of managed honey bee colony mortality in the US, Varroa destructor populations typically exceed damaging levels in the fall. One explanation for rapid population increases is migration of mite carrying bees between colonies. Here, the degree to which bees from high and low mite donor colonies move between apiaries, and the effect visitation has on Varroa populations was monitored. More bees from low mite colonies (n = 37) were detected in receiver apiaries than bees from high mite colonies (n = 10, p < 0.001). Receiver colony Varroa population growth was associated with visitation by non-natal bees (p = 0.03), but not high mite bees alone (p = 0.19). Finally, colonies lacking robbing screens experienced faster Varroa population growth than screened neighbors (p = 0.01). Results indicate visiting non-natal bees may vector mites to receiver colonies. These results do not support the current two leading theories regarding mite immigration – the “mite bomb” theory (bees from high mite colonies emigrating to collapsing colonies), or the “robbing” theory (natal robbing bees return home with mites from collapsing colonies). Potential host-parasite effects to bee behavior, as well as important management implications both for Varroa treatment regimens and breeding Varroa resistant bees are discussed.

Fish predation hinders the success of coral restoration efforts using fragmented massive corals.

As coral reefs continue to decline globally, coral restoration practitioners have explored various approaches to return coral cover and diversity to decimated reefs. While branching coral species have long been the focus of restoration efforts, the recent development of the microfragmentation coral propagation technique has made it possible to incorporate massive coral species into restoration efforts. Microfragmentation (i.e., the process of cutting large donor colonies into small fragments that grow fast) has yielded promising early results. Still, best practices for outplanting fragmented corals of massive morphologies are continuing to be developed and modified to maximize survivorship. Here, we compared outplant success among four species of massive corals (Orbicella faveolata, Montastraea cavernosa, Pseudodiploria clivosa, and P. strigosa) in Southeast Florida, US. Within the first week following coral deployment, predation impacts by fish on the small (<5 cm2) outplanted colonies resulted in both the complete removal of colonies and significant tissue damage, as evidenced by bite marks. In our study, 8–27% of fragments from four species were removed by fish within one week, with removal rates slowing down over time. Of the corals that remained after one week, over 9% showed signs of fish predation. Our findings showed that predation by corallivorous fish taxa like butterflyfishes (Chaetodontidae), parrotfishes (Scaridae), and damselfishes (Pomacentridae) is a major threat to coral outplants, and that susceptibility varied significantly among coral species and outplanting method. Moreover, we identify factors that reduce predation impacts such as: (1) using cement instead of glue to attach corals, (2) elevating fragments off the substrate, and (3) limiting the amount of skeleton exposed at the time of outplanting. These strategies are essential to maximizing the efficiency of outplanting techniques and enhancing the impact of reef restoration.

134 Generation of NANOS2 knockout goats using CRISPR/Cas9 and somatic cell nuclear transfer techniques

The NANOS2 gene, encoding an RNA binding protein, is known to play a critical role in the development of germline for all organisms studied to date. The male mice with biallelic NANOS2 knockouts (KOs) are sterile due to apoptosis of prospermatogonia shortly after birth but with morphologically intact seminiferous tubules. Thus, the choice of NANOS2 for targeting could be a viable strategy to develop germline ablated males that would serve as recipients for exogenous spermatogonial stem cell transplantation. The goat is a potential model of human physiology and an agriculturally important species. Here, we report successful generation of NANOS2 KO goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We first designed 4 single-guide RNAs (sgRNAs) specific for the single exon of goat NANOS2 (GenBank: NC_030825.1). The targeting vectors were constructed by using the pX330 plasmid (Addgene: 42230) and transfected into sheep fetal fibroblasts. Mutation efficiency analysis showed that 3 of them (out of 4, 75.0%) were efficient in directing Cas9 to generate targeted cleavages, with mutation efficiencies of 10-30%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with one of targeting vectors (sgRNA: GCTGGAGACCCAAGGGACTG). Colony screening with PCR/restriction fragment length polymorphism (RFLP) assays confirmed that we achieved biallelic mutations in the targeting site in 6 of 89 (6.7%) male and 6 of 172 (3.5%) female colonies. Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of NANOS2. Three male and two female colonies with NANOS2 null mutations were identified and used as cell donors for SCNT. In total, 202 cloned 1-cell stage embryos (130 male or 72 female) were generated and surgically transferred into 12 synchronized recipients. Six of them (6 of 12, 50.0%) were confirmed pregnant by ultrasonography on Day 40-45 of gestation. Four pregnancies developed to term, resulting in six offspring (five males and one female). Sequence analysis and PCR/RFLP assays showed that both male and female offspring carried the mutations in NANOS2, which were identical to the donor colonies from which they originated. Our results indicated that CRISPR/Cas9 combined with SCNT is an efficient system for generating NANOS2 KO goats. The phenotypic analysis to assess the effects of NANOS2 KO on the development of germline in male cloned goats is in progress.

Translocations of European ground squirrel (Spermophilus citellus) along altitudinal gradient in Bulgaria – an overview

The European ground squirrel (Spermophiluscitellus) is a vulnerable species (IUCN) living in open habitats of Central and South-eastern Europe. Translocations (introductions, reintroductions and reinforcements) are commonly used as part of the European ground squirrel (EGS) conservation. There are numerous publications for such activities carried out in Central Europe, but data from South-eastern Europe, where translocations have also been implemented, are still scarce. The present study summarises the methodologies used in the translocations in Bulgaria and analyses the factors impacting their success. Eight translocations of more than 1730 individuals were performed in the period 2010 to 2018. These included 4 reinforcements, 3 reintroductions and 1 introduction. Two of the translocations are still ongoing. Five of the completed six (83%) translocations were successful, although in two cases the number of individuals was critically low. The relatively higher success in Bulgaria than in Central Europe is probably due to using the gained experience. Most of the translocations (6) used a soft release approach. In 6 cases, the animals settled 100 to 720 metres away from the release site, implying management and protection of suitable habitat beyond the translocation area. In 7 of the translocations, the altitude between the donor colony and the release site varied from 470 to 1320 m which could have a hindering effect on the adaptation of animals due to the specific conditions in the mountains. The main reasons for failure are probably poorly selected and maintained habitats and bad climatic conditions (rainy and cool weather) during the translocation action. European funds are of critical importance for translocations, with only two translocations funded by other sources. Based on the gathered data, the current paper also gives some recommendations for improvement in translocation activities.

Experiences in Transplanting Wood Ants into Plantations for Integrated Pest Management

Ants can function efficiently as biocontrol agents in open field horticulture. Temperate wood ants can control forest pests, including species damaging forest regeneration plots and fruit plantations. Thus, they possess potential as biocontrol agents in open field horticulture, if they can persist in these systems. Here we present observationson activity and survival of wood ants transplanted from forests into different types of plantations. Mound fragments were transplanted into a conifer seedling plot, an organic and a conventional Christmas tree plantation, and into an organic apple plantation. Colonies survived at least one year in all types of plantations. In some cases, however, ants moved to new locations or migrated between mound fragments, leaving some inactive. Our compiled experiences suggest that this can be prevented by providing a minimum mound size, keeping a minimum spacing between mounds and incorporation of sand and scent marked wood pieces from donor colonies to imitate naturally occurring nests. We also observed that the ants preyed upon and significantly reduced the number of winter moth larvae (Operophtera brumata – a pest in apple and other fruit orchards) in two of four apple varieties. In conclusion, wood ants were tolerant to highly diferente habitat settings and will likely persist in most types of perennial horticultural systems, if managed properly. As they prey on winter moths and multiple other pest species, they are a potential new biocontrol agent for open agricultural systems.

A Study of the Regenerative Potential of Bone Marrow Cells of Donor Mice that Carry the egfp Gene in Irradiated Mice

A study of the regenerative potential of bone marrow cells of donor mice that express the enhanced green fluorescent protein was conducted in mice irradiated at a dose of 7 Gy. Expression of this protein allowed us to carry out monitoring of the presence of donor cells in recipient blood over the entire lifespan of the recipient. The lifespan of young recipients increased by 93% after transplantation; for old recipients it increased by 15%. Total acceptance of the bone marrow, spleen, thymus, and blood of the recipient with donor bone marrow cells was demonstrated over the entire life of the recipient. Only the donor colonies were detected with the studied irradiation dose and number of transplanted cells (11.7 ± 0.4) · 106 on the spleen surface. The percentage of bone marrow and spleen cells that expressed the CD117 and CD34 stem cell markers in the recipient mice was above the control level for a long period of time after the irradiation. More than half of the cells with CD117, CD34, CD90.2, and CD45R/B220 phenotypes in the studied organs were donor cells. Further detailed study of the peculiarities of the engraftment of bone marrow cells, both without preliminary treatment of recipients and after the effects of extreme factors, will allow improvement of the methods of cell therapy.

28 Generation of Immunoglobulin Heavy Constant Mu (IGHM) Knockout Goats Using CRISPR/Cas9 and Somatic Cell Nuclear Transfer

Towards the goals of inactivating endogenous goat immunoglobulin (Ig) genes and producing fully human polyclonal antibodies in transchromosomal goats carrying a human artificial chromosome comprising the entire human Ig gene repertoire, we report here the successful generation of IgM heavy chain knockout (IGHM−/−) goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. Two single-guide RNAs (sgRNAs) were designed specific for exon 1 of the goat IGHM constant region (GenBank: EU182621.1). The gene-targeting vectors were constructed by using pX330 plasmid (Plasmid No. 42230, Addgene, Cambridge, MA, USA) and transfected into 2 × 105 goat fetal fibroblast cells. Gene-targeting efficiency of each targeting vector was determined by PCR-restriction fragment length polymorphism (RFLP) assay 3 days post-transfection. Our results showed that one of the sgRNAs, 5′-GAAAGGCGCTTGAGGAATGC-3′, was efficient in directing Cas9 to generate targeted cleavages in exon 1 of IGHM constant region, with a mutation efficiency of 20%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with the targeting vector. Colony screening with the PCR-RFLP assay confirmed that we achieved targeted gene disruption in exon 1 in 11/49 (22.4%) of the colonies (7 colonies with biallelic and 4 with monoallelic gene disruption). Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of exon 1. One of the colonies harboring a 1-nucleotide (nt) deletion was used as nuclear donors for SCNT. A total of 102 1-cell-stage cloned embryos were generated and surgically transferred into 6 synchronized recipients. Three of the recipients (3/6, 50.0%) were confirmed pregnant by ultrasonography on Day 40 to 45 of gestation. Two pregnancies were sacrificed for IGHM−/− fetal fibroblast isolation and one pregnancy was allowed to go to term, which led to the birth of a live and seemingly healthy kid. This goat was reared conventionally and appeared healthy until 5 weeks of age when it was killed because of commensal virus infection. The PCR-RFLP assay and sequence analysis showed that this cloned goat carried a biallelic 1-nt deletion in exon 1 of IGHM, which was identical to the donor colony it was originated from. No lymphoid follicles were observed in lymph nodes and spleen by histology, and immunohistochemistry for B cells (CD20) and T cells (CD3) demonstrated a lack of B cells in lymph nodes and spleen but the presence of T cells, confirming that IGHM has been successfully knocked out.

Norwegian honey bees surviving Varroa destructor mite infestations by means of natural selection.

BackgroundManaged, feral and wild populations of European honey bee subspecies, Apis mellifera, are currently facing severe colony losses globally. There is consensus that the ectoparasitic mite Varroa destructor, that switched hosts from the Eastern honey bee Apis cerana to the Western honey bee A. mellifera, is a key factor driving these losses. For >20 years, breeding efforts have not produced European honey bee colonies that can survive infestations without the need for mite control. However, at least three populations of European honey bees have developed this ability by means of natural selection and have been surviving for >10 years without mite treatments. Reduced mite reproductive success has been suggested as a key factor explaining this natural survival. Here, we report a managed A. mellifera population in Norway, that has been naturally surviving consistent V. destructor infestations for >17 years.MethodsSurviving colonies and local susceptible controls were evaluated for mite infestation levels, mite reproductive success and two potential mechanisms explaining colony survival: grooming of adult worker bees and Varroa Sensitive Hygiene (VSH): adult workers specifically detecting and removing mite-infested brood.ResultsMite infestation levels were significantly lower in surviving colonies and mite reproductive success was reduced by 30% when compared to the controls. No significant differences were found between surviving and control colonies for either grooming or VSH.DiscussionOur data confirm that reduced mite reproductive success seems to be a key factor for natural survival of infested A. mellifera colonies. However, neither grooming nor VSH seem to explain colony survival. Instead, other behaviors of the adult bees seem to be sufficient to hinder mite reproductive success, because brood for this experiment was taken from susceptible donor colonies only. To mitigate the global impact of V. destructor, we suggest learning more from nature, i.e., identifying the obviously efficient mechanisms favored by natural selection.

Regional restoration benchmarks for Acropora cervicornis

Coral gardening plays an important role in the recovery of depleted populations of threatened Acropora cervicornis in the Caribbean. Over the past decade, high survival coupled with fast growth of in situ nursery corals have allowed practitioners to create healthy and genotypically diverse nursery stocks. Currently, thousands of corals are propagated and outplanted onto degraded reefs on a yearly basis, representing a substantial increase in the abundance, biomass, and overall footprint of A. cervicornis. Here, we combined an extensive dataset collected by restoration practitioners to document early (1–2 yr) restoration success metrics in Florida and Puerto Rico, USA. By reporting region-specific data on the impacts of fragment collection on donor colonies, survivorship and productivity of nursery corals, and survivorship and productivity of outplanted corals during normal conditions, we provide the basis for a stop-light indicator framework for new or existing restoration programs to evaluate their performance. We show that current restoration methods are very effective, that no excess damage is caused to donor colonies, and that once outplanted, corals behave just as wild colonies. We also provide science-based benchmarks that can be used by programs to evaluate successes and challenges of their efforts, and to make modifications where needed. We propose that up to 10% of the biomass can be collected from healthy, large A. cervicornis donor colonies for nursery propagation. We also propose the following benchmarks for the first year of activities for A. cervicornis restoration: (1) >75% live tissue cover on donor colonies; (2) >80% survivorship of nursery corals; and (3) >70% survivorship of outplanted corals. Finally, we report productivity means of 4.4 cm yr−1 for nursery corals and 4.8 cm yr−1 for outplants as a frame of reference for ranking performance within programs. Such benchmarks, and potential subsequent adaptive actions, are needed to fully assess the long-term success of coral restoration and species recovery programs.

Rat Liver Repopulation by Transplanted Late Gestation Fetal Hepatocytes

Hepatocyte transplantation has the potential to be an effective therapy for liver failure. However, the application of this therapy has been hampered by identification of an appropriate cell population and limited understanding of the factors accounting for the ability of cells to repopulate injured liver. Late gestation (E19) fetal hepatocyte proliferation in the rat is mitogen‐independent in vivo and in vitro. Fetal hepatocytes also differ from adult hepatocytes with regard to ribosome biogenesis, translation control, gene expression and cell cycle regulation. Our current studies are based on the hypothesis that histone posttranslational modifications (PTMs) acting through effects on chromatin structure account for the fetal hepatocyte signaling phenotype and that this phenotype will result in a selective growth advantage for fetal cells in the injured adult liver microenvironment. Late gestation fetal hepatocytes were isolated using antibodies against hepatic and ductal cell surface markers. The engraftment and repopulating ability of these cells was assessed using the mitomycin C dipeptidyl peptidase IV (DPPIV) transplant model. Liver harvested at 4 and 42 weeks posttransplantation contained well defined donor hepatocyte and endothelial colonies. Morphologic and phenotypic analysis using antibodies against well characterized markers revealed the formation of ductal colonies by 10 months. The average size of the donor colonies increased so that by 10 months up to 30% of the liver was repopulated by donor‐derived cells. Characterization of the donor cells pretransplant revealed that a large subpopulation of the hepatocytes also expressed ductal markers. Transcriptomic analysis revealed that these cells represent a distinct subpopulation of less well differentiated hepatocytes. Mass spectrometry‐based profiling of 77 modifications across 26 lysines on Histones H1, H2A, H3 &amp; H4 revealed 23 significant changes including differential methylation of H3K27, H3K36 and H4K20 as well as acetylation of H3K4 comparing fetal to adult hepatocytes. In contrast, only 5 sites were significant comparing the two subpopulations of fetal hepatocytes. In conclusion, late gestation fetal hepatocytes are capable of extensive long‐term liver repopulation. These cells possess a histone PTM profile that is distinct from that of adult hepatocytes and may contribute to the maintenance of a fetal hepatocyte phenotype upon transplantation.Support or Funding InformationThe studies were supported by NIH grants R01DK100301 and P41GM108569. Support was also provided by the Rhode Island Hospital Department of Pediatrics.