DNeasy Mericon Food Kit Research Articles

Assessment of Commercial DNA Extraction Kits for Porcine Gelatin Detection Using RT-PCR and ddPCR

Gelatin is extensively applied in various industries, including food, beverages, cosmetics, and pharmaceuticals. Although the determination of gelatin species is essential for religious, health, and consumer preference reasons, a standardized analysis method is absent. The challenge in identifying gelatin through DNA-based methods arises from the low DNA content and extensive DNA denaturation in the gelatin matrix. This study assessed the efficacy of two commercial DNA extraction kits, namely the Processed Food DNA Extraction (PF kit) and the DNeasy Mericon Food Kit (DM kit), for extracting DNA from porcine gelatin powder and commercial products derived from gelatin. Additionally, we evaluate the amplification of the extracted porcine DNA using real time polymerase chain reaction (RT-PCR) and droplet digital polymerase chain reaction (ddPCR) techniques. The PF extraction kit demonstrated successful DNA extraction from porcine gelatin powder and commercial samples of porcine gelatin-based candies with a higher concentration (32.24-286.07 ng/uL) and purity (A260/A280 ratio of 1.82-2.33) compared to the DM kit (3.95-7.30 ng/uL and an A260/A280 ratio of 1.29-2.45). RT-PCR and ddPCR analyses yielded positive results for porcine DNA from gelatin powder for both PF and DM kits, albeit with differing Cq values and copy numbers. The choice of DNA extraction kit significantly impacted the amplification results when analyzing commercial samples of porcine gelatin-based candies. Using RT-PCR, all samples yielded negative results with the DM kit, while the PF kit detected one positive result for porcine DNA. Improved outcomes were observed with more sensitive analysis methods such as ddPCR, where the DM kit identified one positive result for porcine DNA while the PF kit detected positive results for all tested candies.

Porcine detection in commercial edible bird nest beverages using real time PCR targeting chromosomally encoded multiple porcine repetitive elements

Popular consumption of edible bird nest beverage (EBNB) is driven by its claimed anti-aging properties. Incorporation of other anti-aging and protein-rich compounds such as collagen and gelatin increase the adulteration potential of EBNB especially those from economical feasible porcine sources. In this study, fifteen commercial EBNB products were examined for the presence of porcine DNA using real time PCR targeting multiple porcine repetitive element (MPRE42). DNA extracted using DNeasy Mericon Food Kit (Qiagen) obtained 0.08–17 ng/µl DNA that is ample for downstream qPCR. Universal qPCR assay successfully amplified conserved 18 S rRNA genes in all samples except for B7 which might dictate presence of PCR inhibitors such as phenolic compounds. Porcine-specific MPRE42 assay detected the presence of porcine DNA in 40% of the EBNB products (B5, B10, B11, B16, B17, B20) with Cq value ranging from 33.85±0.33–38.55±1.23. Analysis of EBNB product (B3) being spiked with different amounts of porcine gelatin shows that porcine-specific MPRE42 assay can detect up to 0.5% (w/w) porcine gelatin in B3. A linear correlation between Cq values of the DNA extracted from spiked samples and serial diluted porcine gelatin were obtained which demonstrates potential quantitative application of this assay. In overall, upon strict validation according to ISO/IEC 17025, the method described in this study has a huge potential to be applied by enforcement and authorities for porcine gelatin detection in EBNB products.

Unveiling Porcine Contamination in Halal-uncertified Cosmetics: Detection through Existing Procedure using DNeasy Mericon Food Kit DNA Extraction and Real-time qPCR

The surge in cosmetic product consumption in Indonesia has spurred the growth of the local cosmetic industry. However, not all cosmetics in circulation adhere to the halal standards mandated by Indonesian authorities through the Law on Halal Product Guarantee. This study endeavors to establish a method for identifying pork-derived content in cosmetic cream products lacking the halal logo. The approach involves total DNA isolation using the Qiagen DNeasy Mericon Food Kit, followed by detecting the NDH5 gene using qPCR. Results indicated that the isolation kit effectively extracted DNA fragments from cosmetic products, yielding 0.6–0.8 ng/µL concentrations, with A260/280 ratios ranging from 0.90 to 1.76 and A260/230 ratios from 0.12 to 0.17. Analysis of five cosmetic cream samples revealed that three of them exhibited no contamination by pig-derived elements, with a cut-off value of 23.7×101. Consequently, the isolation method utilizing the kit and the subsequent detection of the NDH5 gene through qPCR emerge as a robust approach for identifying pig-derived ingredients in cream-based cosmetics.

Analysis of the Quality of Isolated DNA in the Making of Guinea Pig DNA Test Standards

Analysis of the quality of DNA isolated from the manufacture of species DNA standards is one way to determine the quality of independently made species-specific DNA used in testing species DNA detection. This research was conducted to assess the quality of DNA isolated from the production of guinea pig DNA test standards. The benefit of this research is to provide an alternative reference for manufacturing species DNA standards. Moreover, this research is expected to enrich the methods of testing the quality of DNA isolated from different existing methods, using various test matrices. The DNA isolation method was carried out using the Dneasy Mericon Food kit. The quality of the isolated DNA was analyzed using a nanophotometer, measuring the parameters of concentration and purity values at the A260/A280 ratio. The results of DNA isolation indicated a concentration value of the isolated DNA ranging from 230.2 ng/µL to 238.5 ng/µL, with an average concentration value of 233.7 ng/µL. The purity value, read at the A260/A280 ratio, falls within the range of 2.04 – 2.11. Based on the study's results, it was found that the isolated DNA exhibited good DNA quality, making the DNA test standard suitable for use as a benchmark in species DNA testing.

Comparison of DNA Extraction Methods for the Detection of Canned Tuna Species with DNA Mini-Barcoding

Tuna is susceptible to species mislabeling due to its high demand, quick rate of production, and wide range of price points. DNA barcoding, a sequencing-based technique, allows for the detection of species mislabeling by targeting a standardized region of DNA. A mitochondrial control region (CR) DNA barcode has been found to be capable of species discrimination for tuna, but it is challenging to recover the entire DNA fragment from canned tuna. While a short fragment of CR, referred to as a “mini-barcode,” has shown some success with canned tuna species identification, more research is needed to improve identification rates. The objective of this study was to determine the optimal DNA extraction method for species identification of canned tuna using CR mini-barcoding. Four commercial DNA extraction kits were compared using a sample set of 24 different cans of tuna labeled as albacore, light tuna, skipjack, or yellowfin. All samples were tested in duplicate. The greatest success was found using the Qiagen DNeasy Blood and Tissue Kit and the Qiagen DNeasy Mericon Food Kit, which resulted in species identification for 42% of the samples. In comparison, the MP Biomedicals FastPrep-24 + Machery-Nagel NucleoSpin Tissue Kit resulted in species identification for 30% of the samples and the Qiagen DNeasy Blood and Tissue Kit + PowerClean Pro Cleanup Kit resulted in species identification for 21% of the samples. Overall, the top-performing DNA extraction methods for use with CR mini-barcoding of canned tuna products were determined to be the DNeasy Blood and Tissue Kit and the DNeasy Mericon Food Kit.

Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

DNA isolation in processed chicken meat products (nugget) using modified DNeasy Mericon Food kit (Qiagen)

DNA isolation is one of the important steps in conducting PCR-based or real-time PCR-based molecular analysis. This study aims to test the quality of DNA isolation extracted from samples of processed food products from chicken meat (chicken nuggets). The novelty of this research lies in the DNA isolation technique modified from the manual kit which is used to produce good-quality DNA isolation results. The extraction method used was the modified extraction method and the standard extraction method of the DNeasy Mericon Food kit. Analysis of DNA quality was measured using a nanophotometer, where the analysis of DNA quality was analyzed based on the parameters of concentration values and purity values. Based on research data, it is known that the modified DNA extraction method produces a concentration value of DNA isolation with an average concentration value of 1295.1 ng/µL. Meanwhile, the value of the purity of the isolated DNA was 2.10 on average. while the standard DNA extraction method resulted in an average DNA isolation concentration value of 111.53 ng/µL. While the value purity of the isolated DNA was at an average value of 1.926. From the research data analyzed, it was found that the modified DNA isolation method has the advantage that the concentration of isolated DNA obtained is higher than the standard method, while the purity value of the DNA isolated from the standard method has better purity when compared to the modified method.

Real-time qPCR to evaluate bacterial contamination of cosmetic cream and the efficiency of protective ingredients.

The absence of objectionable micro-organisms in cosmetics and the efficiency of preservatives are still mainly assessed by time-consuming cultivation-based methods. We explored the applicability of real-time quantitative polymerase chain reaction (qPCR) and reported on the behaviour of different bacteria in artificially contaminated creams. Real-time qPCR on DNA from Burkholderia cepacia, Pluribacter gergoviae, Pseudomonas aeruginosa and Sphingomonas paucimobilis identified specific primer pairs that amplify accurately and efficiently two strains/isolates of each species. Using DNeasy mericon Food Kit, we detected bacterial growth in an inoculated cosmetic cream and persistency of DNA from heat-inactivated bacteria. We were also able to monitor the growth inhibitory effect of caprylyl glycol and EDTA, also showing how different bacterial species interact depending on the presence/absence of these ingredients. Finally, creams supplemented with the protective cosmetic ingredients revealed the various behaviour of five strains/isolates from P. aeruginosa. Successfully extracting bacterial DNA from artificially contaminated cosmetic creams, we could perform real-time qPCR to identify and follow the growth of various strains of 4 bacteria species under different conditions. Real-time qPCR appears as a promising method to detect bacterial contamination in cosmetic creams and/or to monitor growth inhibition by ingredients.

Short Communication: Analysis of purity and concentration of extracted DNA on salted fish processed food products

Abstract. Sophian A. 2021. Short Communication: Analysis of purity and concentration of extracted DNA on salted fish processed food products. Asian J Nat Prod Biochem 19: 21-24. Analysis of purity and concentration of extracted DNA on salted fish processed food products was carried out in the microbiology and molecular biology testing laboratory of the Food and Drug Administration in Gorontalo. The purpose of this study was to analyze the extracted DNA on salted fish processed food products based on the concentration and purity values in the A260 / A230 and A260 / A280 wavelengths. The method used for purity and concentration analysis was the absorbance method using a nanophotometer. The samples used were 10 types of salted fish processed food products sampled from 5 (five) traditional markets in Gorontalo City. The sample was extracted using the spin column method with the Dneasy Mericon Food Kit (50) paint kit. 69514 (Qiagen). The research data showed that extracted sample concentration was in the range of 24,600 - 27,150 with an average of 25,745, while purity value measured at A260 / A280 wavelength was obtained with a purity range between 1,668 - 1,768 with an average of 1,729. Based on the results of this study, it can be concluded that the results of DNA extraction carried out on salted fish processed food products show a value that is in the category of good DNA extraction results.

Identification of Selected Tuna Species in Commercial Products.

This study was conducted to develop systems for the identification of four tuna species (skipjack tuna Katsuwonus pelamis, yellowfin tuna Thunnus albacares, bullet tuna Auxis sp. and Atlantic bonito Sarda sp). At first, raw samples of these species and a mix intended as internal control were prepared for the authentication of fish muscle tissue of the genus Thunnus sp., Auxis sp. and Sarda sp. DNA from raw muscle tissue, the mix and samples was extracted with the DNeasy mericon Food Kit (Qiagen GmbH, Hilden, Germany). The concentration and purity of DNA in raw samples were evaluated using a spectrophotometer. Primers and probe sequences were specifically designed to identify the selected species. In addition, primers and a probe for the endogenous 12S rRNA gene were designed to determine the presence of amplifiable fish (especially tuna) DNA in samples. Furthermore, the species specificity of the designed primers and probes was verified in DNA samples of various tuna and bonito species. Limit of detection for the selected species was calculated as well as the coefficient of determination R2 and efficiency of real-time PCR testing was determined. To evaluate the developed real-time PCR methods, 70 commercial tuna products were analysed. The results show that mislabelling of fish products can still be encountered and, moreover, the presence of an additional species can be identified.

Evaluation of DNA Extraction Methods for Culture-Independent Real-Time PCR-Based Detection of Listeria monocytogenes in Cheese

Listeria monocytogenes, the causative agent of listeriosis, is a foodborne pathogen with significant public health and economic impacts. The control of pathogen presence in food requires rapid and sensitive methods. Real-time PCR is considered to be a fast and accurate tool for the detection of foodborne pathogens. A crucial step for the success of a culture-independent PCR-based detection is the template DNA extraction. Two open-formula extraction procedures and five kits were used to extract DNA prior to detection of L. monocytogenes in cheese. The extraction procedures were evaluated in quantitative PCR analyses of the total extracted bacterial DNA from cheese samples artificially contaminated with L. monocytogenes. The results of the study suggested that all seven extraction procedures can be used to obtain intact and amplifiable bacterial DNA, although with different L. monocytogenes detection limits in four types of cheese. PowerFood Microbial DNA Isolation Kit and DNeasy Mericon Food Kit performed the best with detection limits of 2.1 × 102 to 4.7 × 102 CFU/g in all analysed cheese samples. No differences in PCR detection limits of low numbers were found when different L. monocytogenes serotypes (1/2a, 1/2b, 1/2c and 4b) were used, despite the relatively lower DNA extraction efficiency observed in L. monocytogenes serotype 1/2c strain. Six out of seven evaluated methods demonstrated quantitative response with linear calibration lines and quantification limits of 4.6 × 102 to 9.3 × 103 CFU/g. The results demonstrated that culture-independent sample preparation and total DNA extraction, followed by target-specific DNA amplification have a potential to direct determination of low L. monocytogenes numbers in cheese within hours.

The Quality of DNA Isolated from Processed Food and Feed via Different Extraction Procedures.

The extraction of DNA is a critical step for species identification by PCR analysis in processed food and feed products. In this study, eight DNA extraction procedures were compared—DNeasy Blood and Tissue Kit, DNeasy mericon Food Kit, chemagic DNA Tissue 10 Kit, Food DNA Isolation Kit, UltraPrep Genomic DNA Food Mini Prep Kit, High Pure PCR Template Preparation Kit, phenol—chloroform extraction, and NucleoSpin Food—Using self-prepared samples from both raw and heat-processed and/or mechanically treated muscles and different types of meat products and pet food (pork, beef, and chicken). The yield, purity, and suitability of DNA for PCR amplification was evaluated. Additionally, comparisons between the effectiveness of various extraction methods were made with regard to price, and labor- and time-intensiveness. It was found that the DNeasy mericon Food Kit was the optimal choice for the extraction of DNA from raw muscle, heat-treated muscle, and homemade meat products from multiple and single species.

A quantitative comparison of two kits for DNA extraction from canned tuna

The most common methods that can be used for species identification of tuna include methods based on detection of species-specific DNA via the polymerase chain reaction (PCR) method. The problem with DNA detection in processed products is the possibility of DNA fragmentation during the technological process. The quantity and quality of extracted DNA is a crucial step for species identification based on the DNA analysis. In this study, two DNA extraction methods (DNeasy Blood & Tissue Kit and DNeasy mericon Food Kit) for tuna DNA isolation were compared. Eight food products of canned tuna (three of them were declared as Thunnus albacares and five products were declared as Katsuwonus pelamis) with a different addition of various ingredients were tested. Furthermore, three different times of proteolysis (30 min, 60 min, overnight) for each sample and each extraction kit were evaluated. The DNA concentration was determined by a Qubit dsDNA HS Assay Kit fluorescence method and quantified using a Qubit fluorometer. The DNA purity was evaluated using the A260/A280 ratio of absorbances measured on a spectrophotometer. The main indicator of DNA quality and quantity was its amplifiability in the subsequent real-time PCR for Thunnus species, Thunnus albacares and Katsuwonus pelamis. Based on the results, both kits can be used for tuna species determination in highly heat-treated products with different composition, nevertheless, the DNeasy mericon Food Kit provided better statistical values in some parameters. The effect of different times of proteolysis was significant in most of the samples with regard to the crossing point values determined by real-time PCR.

Development and comparison of a porcine gelatin detection system targeting mitochondrial markers for Halal authentication

This study aimed to compare the sensitivity of porcine-specific primers targeting different mitochondrial DNA for the detection of porcine gelatin in ramen stock powder designated “Halal” using SYBR Green I real-time PCR. Four mitochondrial DNA markers (D-loop, ATP8, ND5, and 12S rRNA) were used to detect the porcine gelatin DNA. Extraction of DNA from porcine gelatin and spiked mixtures was successfully performed using a DNeasy Mericon Food Kit. Each primer had high porcine specificity for D-loop, ATP8, and ND5 genes, but not the 12S rRNA gene. Also, the detection limit for each primer was tested in a serial dilution of porcine gelatin DNA (10, 1, 0.1, 0.05, 0.01, and 0.005 ng) and ramen stock powder spiked with porcine gelatin (1, 0.1, 0.05, and 0.025%). Assays targeting both D-loop and ND5 genes were able to detect a level as low as 0.01 ng, while the detection limit for the ATP8 gene was 0.05 ng in pure porcine gelatin. The detection limits of D-loop, ATP8, and ND5 genes were 0.05%, 0.1%, and 1% (w/w) in ramen stock powder spiked with porcine gelatin, respectively. In conclusion, a novel detection system targeting the mitochondrial D-loop was superior to the others and could be an effective and simple method to authenticate Halal products.

Rapid detection of collagens using a closed-tube LAMP method

Identification methods of collagens and gelatins have been studied many years due to religious and food safety issues. Some researchers detected the collagen while others took up their study based on DNA at the first time. In this work, we used a closed-tube loop-mediated isothermal amplification (LAMP) technique to differentiate collagen and gelatin samples. DNA was extracted by DNeasy mericon Food Kit and was dissolved in 30 µl elution buffer, optimum concentration of Mg2+, deoxyribonucleoside triphosphates(dNTPs), betaine in LAMP reaction is 6.0 mmol/L, 2.0 mmol/L, and 0.8 mmol/L, respectively. After LAMP reaction, samples being detected changed their initial color to green, others’ were colorless or brown slightly. The research offered a simple, fast detection technique to differentiate collagen and gelatin samples derived from porcine, bovine and channel catfish (Ictalurus punctatus) , the collagens’ species can be determined by color variation in reaction tubes within two hour.

Clearing muddied waters: Capture of environmental DNA from turbid waters.

Understanding the differences in efficiencies of various methods to concentrate, extract, and amplify environmental DNA (eDNA) is vital for best performance of eDNA detection. Aquatic systems vary in characteristics such as turbidity, eDNA concentration, and inhibitor load, thus affecting eDNA capture efficiency. Application of eDNA techniques to the detection of terrestrial invasive or endangered species may require sampling at intermittent water sources that are used for drinking and cooling; these water bodies may often be stagnant and turbid. We present our best practices technique for the detection of wild pig eDNA in water samples, a protocol that will have wide applicability to the detection of elusive vertebrate species. We determined the best practice for eDNA capture in a turbid water system was to concentrate DNA from a 15 mL water sample via centrifugation, purify DNA with the DNeasy mericon Food kit, and remove inhibitors with Zymo Inhibitor Removal Technology columns. Further, we compared the sensitivity of conventional PCR to quantitative PCR and found that quantitative PCR was more sensitive in detecting lower concentrations of eDNA. We show significant differences in efficiencies among methods in each step of eDNA capture, emphasizing the importance of optimizing best practices for the system of interest.

PCR based assay for the detection of cow milk adulteration in buffalo milk

It is very common in India that with low priced cow milk adulterated high priced buffalo milk. Various techniques are available in market to identify the origin of milk but all these techniques have their own limitations. Thus, DNA based technologies are preferred now a days to identify the origin of food products from animal sources due to high sensitivity and specificity. Currently a PCR based method was developed to identify cow milk in raw buffalo milk. DNA was isolated from milk by DNeasy Mericon food kit (Quiagen,USA) which resulted in DNA of requisite quality for downstream applications. A bovine specific primer targeting D-loop (displacement) of mt- DNA (mitochondrial) was selected and standardized to amplify cow DNA. Specificity of primer was tested across the species in the genomic DNA isolated from both milk and blood. The protocol can be sensitive to detect upto 5% level of cow milk in the buffalo milk. Designed protocol was efficient, robust and sensitive and could be used as a platform test in routine quality analysis laboratory. Hence, it could be a great alternative for other protein based methods to identify cow milk in buffalo milk.

Assessment of DNA quality in processed tuna muscle tissues

Authentication of tuna fish products is necessary to assure consumers of accurate labelling of food products. The quality of species specific DNA crucially affects the efficiency of amplification during the subsequent PCR. The problem in DNA detection in canned products lies in the possibility of the fragmentation of DNA during the processing technologies and the use of ingredients (oil, salt, spice), that may inhibit the PCR reaction. In this study three DNA extraction methods were compared: DNeasy Blood and Tissue Kit, DNeasy mericon Food Kit and Chemagic DNA tissue 10 Kit. The quantity and quality of DNA were evaluated by measuring DNA concentration and ratios A260/A280. Several parameters were estimated: the effect of whole and mechanically treated muscle, sterilization procedure used in canned process (high temperature in combination with high pressure) and addition of raw materials. The highest DNA concentrations were observed in non-processed muscle that is not influenced by the sterilization process. Canned whole muscle demonstrated lower DNA yield, and furthermore, the mechanical treatment (canned ground) resulted in lower values of DNA concentration that was registered by using all three types of DNA extraction kits. DNeasy mericon Food Kit produced DNA of higher concentration in non-processed sample, Chemagic DNA tissue 10 Kit delivered higher DNA yields than kits DNeasy Blood and Tissue Kit and DNeasy mericon Food Kit in canned samples, although the purity was lower, but still within the range 1.7 - 2.0. DNA was considered to be satisfactorily pure in all three types of samples and using all three types of DNA isolation. In case of the samples enriched of ingredients and treated with sterilization process as whole or ground muscle Chemagic DNA tissue 10 Kit produced in all samples (whole and ground muscle) the highest values of DNA concentration, but almost all values of A260/A280 were lower than 1.7. Therefore DNeasy mericon Food Kit appears to be a favorite one, in all samples with whole muscle gives higher values of DNA concentrations than DNeasy Blood and Tissue Kit. Addition of ingredients influenced the DNA yield in terms of decreasing in samples containing vinegar and lemon, but some of the ingredients resulted surprisingly in higher yield of DNA. This was not consistent in whole and ground muscle, and the differences were described also among particular kits. The impact of ingredients was not conclusively approved and their importance to the suitability of extracted DNA for PCR amplification is needed to be discussed in further analysis.

Detection of cow milk paneer in mixed/buffalo milk paneer through conventional species specific Polymerase Chain Reaction

Due to higher market demand of buffalo milk paneer, lower price cow milk is often adulterated with higher cost buffalo milk for preparation of paneer. Till date no rapid technique is available in market to ensure that paneer is made from buffalo milk. Currently a PCR based method has been developed to authenticate the buffalo milk paneer. DNA was isolated from paneer by DNeasy Mericon food kit. A set of bovine specific primers (P1) targeting D-loop (displacement loop) of mt- DNA was selected and standardized to amplify cow DNA resulted 126bp amplicon. Using this PCR based approach even upto 1% level of cow milk adulteration in buffalo milk paneer could be detected.

Extraction of DNA from gastric content in different stages of digestion

In order to clarify the availability of DNA suitable for PCR amplification from gastric content three different preparation systems were applied on a cohort of 48 specimens. A fluorescence-based quantification system was applied to investigate the respective DNA concentrations after the extraction process. The Abbott mSample Preparation System DNA as well as the Qiagen DNA Mini Kit and DNeasy Mericon Food Kit resulted in successful preparation results from all materials. However, the chemistry provided in the specialized DNeasy Mericon Food Kit resulted in the best results from poorly digested material. In contrast, the Abbott magnetic beads system resulted in the highest DNA yields from liquidized gastric content in further stages of digestion. The degree of digestion of stomach content should be considered when the method for DNA preparation is chosen in forensic casework.