Distal Mouse Chr Research Articles

Arlm1 is a male-specific modifier of astrocytoma resistance on mouse Chr 12

While many cancers show a sex bias, the genetic basis and molecular mechanisms underlying sex bias are not always clear. Astrocytoma and glioblastoma show male predominance in humans. We have shown previously that glial tumors forming in the Nf1-/+; Trp53-/+cis (NPcis) mouse model also show a sex bias in some genetic contexts. Using cross-species comparisons we have identified candidate male-specific modifiers of astrocytoma/glioblastoma. Linkage analysis of B6X(B6X129)-NPcis mice identifies a modifier of astrocytoma resistance specific to males, named Arlm1, on distal mouse Chr 12. Arlm1 is syntenic to human Chr 7p15, 7p21, 7q36, and 14q32 regions that are altered in human glioblastoma. A subset of these genes shows male-specific correlations to glioblastoma patient survival time and represents strong candidates for the Arlm1 modifier gene. Identification of male-specific modifier genes will lead to a better understanding of the molecular basis of male predominance in astrocytoma and glioblastoma.

Molecular characterization of the translocation breakpoints in the Down syndrome mouse model Ts65Dn

Ts65Dn is a mouse model of Down syndrome: a syndrome that results from chromosome (Chr) 21 trisomy and is associated with congenital defects, cognitive impairment, and ultimately Alzheimer's disease. Ts65Dn mice have segmental trisomy for distal mouse Chr 16, a region sharing conserved synteny with human Chr 21. As a result, this strain harbors three copies of over half of the human Chr 21 orthologs. The trisomic segment of Chr 16 is present as a translocation chromosome (Mmu17(16)), with breakpoints that have not been defined previously. To molecularly characterize the Chrs 16 and 17 breakpoints on the translocation chromosome in Ts65Dn mice, we used a selective enrichment and high-throughput paired-end sequencing approach. Analysis of paired-end reads flanking the Chr 16, Chr 17 junction on Mmu17(16) and de novo assembly of the reads directly spanning the junction provided the precise locations of the Chrs 16 and 17 breakpoints at 84,351,351 and 9,426,822bp, respectively. These data provide the basis for low-cost, highly efficient genotyping of Ts65Dn mice. More importantly, these data provide, for the first time, complete characterization of gene dosage in Ts65Dn mice.

Genetic Dissection of Mouse Distal Chromosome 1 Reveals Three Linked BMD QTLs With Sex-Dependent Regulation of Bone Phenotypes

Genetic analyses with mouse congenic strains for distal Chr1 have identified three closely linked QTLs regulating femoral vBMD, mid-diaphyseal cortical thickness, and trabecular microstructure in a sex-dependent fashion. The homologous relationship between distal mouse Chr 1 and human 1q21-24 offers the possibility of finding common regulatory genes for cortical and trabecular bone. The distal third of mouse chromosome 1 (Chr 1) has been shown to carry a major quantitative trait locus (QTL) for BMD from several inbred mouse strain crosses. Genetic and functional analyses are essential to identify genes and cellular mechanisms for acquisition of peak bone mass. Nested congenic sublines of mice were developed with a C57BL/6J (B6) background carrying <1- to 9-Mbp-sized segments donated from C3H/HeJ (C3H). Isolated femurs from 16-wk-old female and male mice were measured by pQCT and microCT40 for volumetric (v)BMD, mid-diaphyseal cortical thickness, and distal trabecular phenotypes. Static and dynamic histomorphologic data were obtained on selected females and males at 16 wk. We found that the original BMD QTL, Bmd5, mapped to distal Chr 1 consists of three QTLs with different effects on vBMD and trabecular bone in both sexes. Compared with B6 controls, femoral vBMD, BMD, and cortical thickness (p < 0.0001) were significantly increased in congenic subline females, but not in males, carrying C3H alleles at QTL-1. Both females and males carrying C3H alleles at QTL-1 showed marked increases in BV/TV by microCT compared with B6 mice (p < 0.0001). Females increased BV/TV by increasing trabecular thickness, whereas males increased trabecular number. In addition, the microCT40 data showed two unique QTLs for male trabecular bone, QTL-2 and QTL-3, which may interact to regulate trabecular thickness and number. These QTLs are closely linked with and proximal to QTL-1. The histomorphometric data revealed sex-specific differences in cellular and bone formation parameters. Mice and humans share genetic homology between distal mouse Chr 1 and human Chr 1q20-24 that is associated with adult human skeletal regulation. Sex- and compartment-specific regulatory QTLs in the mouse suggest the need to partition human data by sex to improve accuracy of mapping and genetic loci identification.

Regulation of Murine Telomere Length by Rtel: An Essential Gene Encoding a Helicase-like Protein

Little is known about the genes that regulate telomere length diversity between mammalian species. A candidate gene locus was previously mapped to a region on distal mouse Chr 2q. Within this region, we identified a gene similar to the dog-1 DNA helicase-like gene in C. elegans. We cloned this Regulator of telomere length ( Rtel) gene and inactivated its expression in mice. Rtel −/− mice died between days 10 and 11.5 of gestation with defects in the nervous system, heart, vasculature, and extraembryonic tissues. Rtel −/− embryonic stem cells showed telomere loss and displayed many chromosome breaks and fusions upon differentiation in vitro. Crosses of Rtel +/− mice with Mus spretus showed that Rtel from the Mus musculus parent is required for telomere elongation of M. spretus chromosomes in F1 cells. We conclude that Rtel is an essential gene that regulates telomere length and prevents genetic instability.

Structure and Localization of Mouse Pmscl1 and Pmscl2 Genes

Sera from some patients with polymyositis–scleoderma overlap syndrome (PM–SCL) recognize two antigenically unrelated proteins, PMSCL1 and PMSCL2. Complete mouse Pmscl1 and Pmscl2 cDNA sequences, chromosomal localizations, exon/intron structure, and promoter region sequences of the mouse Pmscl2 gene are presented. The PMSCL1 gene was found to overlap significantly with cyclin A2 in both human and mouse. As such, it may be deduced that PMSCL1 sequences map to human chromosome 4q27 and the proximal portion of mouse chromosome (Chr) 3 where human and mouse cyclin A2 genes reside. Analysis of human and mouse PMSCL1 cDNA sequences provides evidence that the PMSCL1 protein is 68 amino acids longer than previously thought. A BAC containing mouse Pmscl2 was localized to distal mouse Chr 4 by FISH. This BAC contains the microsatellite D4Mit310. D4Mit310 colocalizes with a number of genes that map to human 1p36. In fact, a STS (G25404) located 54.6 cR from the top of human chromosome 1 was found to contain PMSCL2 sequence upon BLAST search.

A novel pleckstrin homology-related gene family defined by Ipl/Tssc3, TDAG51, and Tih1: tissue-specific expression, chromosomal location, and parental imprinting.

We previously described a gene, Ipl (Tssc3), that is expressed selectively from the maternal allele in placenta, yolk sac, and fetal liver and that maps within the imprinted domain of mouse distal Chromosome (Chr) 7/human Chr 11p15.5 (Hum Mol Genet 6, 2021, 1997). Ipl is similar to TDAG51, a gene that is involved in FAS/CD95 expression. Here we describe another gene, Tih1 (TDAG/Ipl homologue 1), with equivalent sequence similarity to Ipl. Structural prediction indicates that the products of these three genes share a central motif resembling a pleckstrin-homology (PH) domain, and TIH1 protein has weak sequence similarity to the PH-domain protein SEC7/CYTOHESIN. Like Ipl, Tih1 is a small gene with a single small intron. Tih1 maps to distal mouse Chr 1 and human Chr 1q31, chromosomal regions that have not shown evidence for imprinting and, in contrast to Ipl, Tih1 is expressed equally from both parental alleles. Ipl, Tih1, and TDAG51 have overlapping but distinct patterns of expression. Tih1 and TDAG51 are expressed in multiple fetal and adult tissues. In contrast, during early mouse development Ipl mRNA and protein are highly specific for two tissues involved in maternal/fetal exchange: visceral endoderm of the yolk sac and labyrinthine trophoblast of the placenta. These findings highlight the dominance of chromosomal context over gene structure in some examples of parental imprinting and extend previous evidence for placenta-specific expression of imprinted genes. The data also define a new subfamily of PH domain genes.

Physical mapping of EMR1 and CD97 in human Chromosome 19 and assignment of Cd97 to mouse Chromosome 8 suggest an ancient genomic duplication.

EMR1 and CD97 belong to the EGF-TM7 family of nonclassicalseven-span transmembrane receptors, members of which are ex-pressed primarily in the immune system. The membrane-spanningregions of CD97, EMR1, and other EGF-TM7 proteins show sig-nificant homology to the secretin receptor superfamily. However,unlike this group of peptide hormone receptors, EMR1 and CD97have extended extracellular portions that possess several EGF do-mains at the N-terminus (McKnight and Gordon 1998). The EGFdomain region can function as a ligand-binding site, as demon-strated by the interaction of CD97 with CD55 (Hamann et al.1996). EMR1 and CD97 show a high degree of structural similar-ity despite the fact that they share only about 31% amino acidsequence identity. The similarity between these two proteins sug-gests that CD97 and EMR1 coding sequences arose through an-cient duplication of a common ancestral gene. CD97 has beenassigned to human Chromosome (Chr) 19p13.12–p13.2 by fluo-rescence in situ hybridization (FISH; Hamann et al. 1995), andEMR1 has been mapped to Chr 19p13.3 through a combination ofFISH and somatic cell hybrid analysis (Baud et al. 1995). Thesedata indicate that the two related genes are linked but separated bya significant distance in the human genome.Emr1 has been mapped to distal mouse Chr 17 within a regionrelated to human 19p13.3, tightly linked to the gene encodingtranscription factor Rfx2 (Lin et al. 1997; McKnight et al. 1997).Interestingly, RFX1, which encodes a transcription factor proteinrelated to RFX2 in both structure and immune-system function,has been mapped to 19p13.1 (Doyle et al. 1996), suggesting thathuman RFX1 and CD97 might also be close neighbors. RFX1 andRFX2 encode site-specific DNA binding proteins that serve criti-cal immune-system functions (Reith et al. 1994) and are alsothought to have arisen from a common ancestral gene sequence indistant evolutionary time. These data suggested that the tight link-age of RFX2 to EMR1, and RFX1 to CD97, respectively, mightreflect an ancient duplication encompassing the predecessors ofboth sets of immunologically active genes.To investigate this possibility, we set out to define physicallocations of CD97 and EMR1 genes in the human and to determinethe location of Cd97 in mice. We localized the mouse Cd97 geneby following the segregation of variant M. musculus and M. spre-tus alleles of the gene in an interspecific backcross (Doyle et al.1996; Stubbs et al. 1996). The results confirmed the tight linkageof Cd97 and Rfx1 in central mouse Chr 8 (Fig. 1). To define thepositions of human CD97 and EMR1, we hybridized probes rep-resenting the two genes to a Chr 19 cosmid library (Olsen et al.1994), and positive cosmids were ordered within the Chr 19 metricphysical map (Ashworth et al. 1995). The human CD97 probeidentified several overlapping cosmids located in 19p13.1 betweenthe RFX1 and NOTCH3, approximately 700 kb and 400 kb awayfrom those two genes, respectively (Fig. 2). The EMR1 probedetected two cosmid clones, 31568 and 34349; positive hybridiza-

The major brain isoform of kif1b lacks the putative mitochondria-binding domain.

Kinesin and kinesin superfamily proteins are molecular motors involved in important intracellular functions such as organelle transport and cell division. They are microtubule-activated ATPases composed of a motor domain that binds to microtubules and a cargo-binding domain that binds to specific organelles. While searching for the slow Wallerian degeneration mutation (WldS) on distal mouse Chromosome (Chr) 4, we have identified a member of the kinesin superfamily whose predicted gene product has the N-terminal motor domain of Kif1b and a novel C-terminal cargo-binding domain homologous to Kif1a. Kif1b is responsible for the movement of mitochondria along the axon, but the novel isoform containing the alternative C-terminal domain is likely to have a different cargo-binding specificity. cDNA library screening and Northern blot analysis indicate that the alternatively spliced form of Kif1b containing the novel 3'end accounts for the most part of Kif1b expression. We also found more alternatively spliced exons that can give rise to heterogeneous transcripts. Therefore, alternative splicing, as well as multiple genes, may contribute to the selective movement of diverse organelles by anterograde axonal transport. Kif1b maps on distal mouse Chr 4, within the Wld genetic candidate interval, but outside the recently identified triplication. There is, however, no evidence that Kif1b is the Wld gene.

Comparative Mapping of Distal Murine Chromosome 11 and Human 17q21.3 in a Region Containing a Modifying Locus for Murine Plasma von Willebrand Factor Level

Type 1 von Willebrand disease (VWD) is a common inherited disorder characterized by mild to moderate bleeding and reduced levels of von Willebrand factor (VWF). An animal model for human type 1 VWD, the RIIIS/J mouse strain, exhibits a prolonged bleeding time and reduced plasma VWF levels. We have previously mapped the defect in RIIIS/J to distal mouse Chr 11, distinct from theVwflocus on Chr 6. This locus,Mvwf,was localized to an ∼0.5-cM interval, tightly linked toGip,distal toNgfr,and proximal toHoxb.We have now used these genetic markers to construct a contig of yeast and bacterial artificial chromosomes and bacteriophage P1 clones spanning the ∼300-kbMvwfnonrecombinant interval. In a comparative mapping approach, mouse homologues of mapped human expressed sequence tags (ESTs) were localized relative to the candidate interval. Twenty-one sequence-tagged sites and ESTs from the corresponding human syntenic region 17q21.3 were ordered using the high-resolution Stanford TNG3 radiation hybrid panel. Based on the resulting radiation hybrid map and our mouse genetic and physical maps, the order of human and mouse genes in a >0.7-cM region appears to be conserved. Six genes localized to theMvwfnonrecombinant interval by comparative mapping included orthologs ofGNGT2, ATP6N1,and a nuclear domain protein. Seven other genes or ESTs were excluded from the candidate interval, including orthologs ofPHB, PDK2,a speckle-type protein, and a UDP-galactose transporter. Using exon trapping, 10 additional putative expressed sequences were identified within theMvwfnonrecombinant interval, including a previously cloned murine glycosyltransferase as well as exons showing sequence similarity to genes forCaenorhabditis elegansandSaccharomyces cerevisiaepredicted proteins, anArabidopsis thalianaubiquitin-conjugating enzyme, and aGallus gallusmRNA zipcode-binding protein. Further characterization of these putative genes could identify the dominant mutation responsible for low plasma VWF levels in RIIIS/J mice. These data may also aid in the localization of other disease loci mapped to this region, including the gene for tricho-dento-osseous syndrome and a murine locus for susceptibility to ozone-induced acute lung injury.

Murine Stim1 maps to distal chromosome 7 and is not imprinted.

STIM1 (GOK) maps to a region of human Chromosome (Chr) 11p15.5 that is implicated in several embryonal tumors, and some evidence indicates that STIM1 may have a growth suppressor role in rhabdomyosarcoma. In this study we have mapped the murine homolog, Stim1, to the same position as Hbb on distal mouse Chr 7. This region is separated by 20 cM from the region of distal Chr 7 that contains Igf2, H19, and other imprinted genes. Using strain-specific polymorphisms, we have shown that Stim1 is expressed from both parental alleles in fetal and neonatal mouse tissues. Similar analyses of human Wilms' tumor and normal kidney tissues demonstrated biallelic expression of STIM1 in the majority of samples. These data demonstrate that Stim1 expression is not regulated by genomic imprinting in either mouse or human tissues. Thus, if STIM1 is a tumor suppressor at 11p15.5, loss of expression is not due to imprinting effects.

Physical and Genetic Maps of the deafwaddlerRegion on Distal Mouse Chr 6

The deafwaddler( dfw) mutation, displaying motor ataxia and profound deafness, arose spontaneously in a C3H/HeJ colony and was mapped previously to distal mouse Chr 6. In this study, a high-resolution genetic map was generated by positioning 10 microsatellite markers and 5 known genes on a 968-meioses intersubspecific backcross segregating for dfw[(CAST/Ei–+/+ × C3HeB/FeJ– dfw/ dfw) × C3HeB/FeJ– dfw/ dfw], giving the following marker order and sex-averaged distances: D6Mit64–(0.10 + 0.10 cM)– Pang–(1.24 + 0.36 cM)– Itpr1–(0.62 + 0.25 cM)– D6Mit108–(0.52 + 0.23 cM)– D6Mit54–(0.21 + 0.15 cM)– D6Mit23, D6Mit107, D6Mit328–(0.72 + 0.27 cM)– D6Mit11–(0.21 + 0.15 cM)– dfw–(0.93 + 0.31 cM)– Gat4, D6Mit55–(0.10 + 0.10 cM)– D6Mit63–(0.31 + 0.18 cM)– Syn2–(0.62 + 0.25 cM)– D6Mit44( Rho). Female and male genetic maps are similar immediately surrounding the dfwlocus, but show marked differences in other areas. A yeast artificial chromosome-based physical map suggests that the closest markers flanking the dfwlocus, D6Mit11(proximal) and Gat4, D6Mit55(distal), are contained within 650–950 kb. The human homologues of the flanking loci Itpr1(proximal) and Syn2(distal) map to chromosome 3p25–p26, suggesting that the human homologue of the dfwgene is located within this same region.

Glomerular-Specific Imprinting of the Mouse Gsα Gene: How Does This Relate to Hormone Resistance in Albright Hereditary Osteodystrophy?

The gene for alpha-stimulating guanine-nucleotide binding polypeptide,Gnas,has been considered as a candidate for the imprinting effects ascribed to distal mouse Chromosome (Chr) 2. Its human homologue (GNAS1) appears, from clinical and biochemical studies of patients with Albright hereditary osteodystrophy, to be paternally imprinted. GNAS1 maps to 20q13, a region that shows linkage conservation with distal mouse Chr 2. We have mappedGnaswithin the imprinting region on distal Chr 2 by linkage analysis. To establish ifGnasis imprinted, we have looked for expression differences in tissues taken from mice carrying maternal duplication/paternal deficiency for distal Chr 2 (MatDp2) and its reciprocal (PatDp2). RNAin situhybridization revealed high levels ofGnasmRNA in glomeruli of PatDp2 embryos at late gestation and lower levels in glomeruli of MatDp2 embryos. These results strongly suggest thatGnasis maternally imprinted and suggest that the mouse gene may be imprinted in a manner opposite that predicted in human.

Genetic mapping of the human and mouse phospholipase C genes

To determine chromosome positions for 10 mouse phospholipase C (PLC) genes, we typed the progeny of two sets of genetic crosses for inheritance of restriction enzyme polymorphisms of each PLC. Four mouse chromosomes, Chr 1, 11, 12, and 19, contained single PLC genes. Four PLC loci, Plcb1, Plcb2, Plcb4, and Plcg1, mapped to three sites on distal mouse Chr 2. Two PLC genes, Plcd1 and Plcg2, mapped to distinct sites on Chr 8. We mapped the human homologs of eight of these genes to six chromosomes by analysis of human x rodent somatic cell hybrids. The map locations of seven of these genes were consistent with previously defined regions of conserved synteny; Plcd1 defines a new region of homology between human Chr 3 and mouse Chr 8.

Positional Cloning of Skeletal Mouse Mutation, Tail Short(Ts).

Tail short (Ts) was initially found as a mutant which exhibits shortened kinked tail in heterozygotes. They also have numerous skeletal abnormalities throughout the entire body. Homozygous embryos die at around the time of implantation. This is probably due to a retardation in forming morulae because pale-staining embryos have been found at this stage in homozygotes. These various phenotypes indicates that the gene for Ts plays a crucial role throughout development including the early embryonic stage and skeletal formation. Ts gene was mapped to teromeric region of the chromosome 11. The Sry-related gene Sox9 has been proposed as the gene resposible for the mouse skeletal mutant Tail short (Ts) , on the basis of its expression in skeletogenic mesenchymal condensations in the mouse embryo, and its chromosomal location in the region of Ts on distal chromosome 11. Studies in humans have inforced the hypothesis that Sox9 may be the Ts gene. A link has been proposed between Ts in mice and a human skeletal dysmorphology known as campomelic dysplasia (CMPD1) . CMPDI has been mapped to human Chr17q23-25 and this region is homologous, syntenic, to distal mouse chr 11.We present here detailed mapping of Ts locus using an intersubspecific cross. Amongst 524 backcross progeny, 16 recombinants were detected between Sox9 and Ts, suggesting a separation of 3.5±0.01 cM, and excluding Sox9 as a candidate for Ts. Microsatellite markers were co-localized to the Ts locus, providing reagents for positional cloning of Ts. We screened the mouse YAC library and obtained YAC clones which carries microsatellite markers co-localized to the Ts. Further screening of the mouse genomic library is underway to make a contig between the two markers.We also explored the characterization of the morphological phenotype of Ts heterozygous mice in embryonic development and skeletal patterning. Detailed analysis of the skeleton of Ts/+ mice revealed that a number of homeotic transformations occur along the anteroposterior axis. In particular, transformation of the seventh cervical vertebrae to the first thoracic vertebrae was highly reproducible in Ts heterozygotes generated from the cross of (C57BL/6J-Ts/+ × MSM) F1 × C57BL/6J.It is of interest to note that this transformation was observed asymmetrically, namely, the left side of vertebrae was predominantly transformed. Besides the above skeletal anomalies, a neural tube defect in the rhombomere region was frequently observed. Thus it is possible that the Ts gene plays some roles providing segmental identity in mouse embryogenesis.

Molecular Genetic Analysis of Distal Mouse Chromosome 6 Defines Gene Order and Positions of the deafwaddler and opisthotonos Mutations

Two neurological mutants deafwaddler ( dfw) and opisthotonos ( opt) and a cluster of three Shaker-like potassium (K) channel genes Kcna1, Kcna5 , and Kcna6 were all independently mapped to distal mouse chromosome six (Chr 6). In this study, genetic and molecular techniques were employed to assess directly the linkage of the two mutants and to investigate the likelihood that a mutation in one of the three K channel genes may underlie dfw and/or opt. Genetic crosses testing for allelism showed that the dfw and opt mutations complement each other. Additional crosses demonstrated that the mutants are separated by a recombination distance of 3.1 ± 1.8 cM. Microsatellite marker analysis of the crossover chromosomes recovered from the opt, dfw recombination study indicated that opt maps centromeric to dfw. The location of the K channel genes relative to the dfw mutation was determined by mapping these genes and 15 microsatellite markers in an intersubspecific backcross (IB) segregating for dfw [(CAST/Ei-+/+ × C3HeB/FeJ- dfw/dfw) × C3HeB/FeJ- dfw/dfw]. Analysis of the backcross progeny positioned the dfw locus in the interval between the microsatellite markers D6Mit11 and D6Mit55, D6Mit63. The K channel cluster maps telomeric to dfw. This study establishes the gene order cen- opt-dfw-Rho (D6Mit44)-Kcna1, Kcna5, Kcna6 on distal mouse Chr 6 and suggests that the neurological mutants opt and dfw affect two different genes, neither of which is caused by a mutation in any one of the three clustered K channels.

Localization of mouse lumican (keratan sulfate proteoglycan) to distal chromosome 10.

Lumican, a member of the small interstitial proteoglycan gene (SIPG) family, is a keratan sulfate proteoglycan present in large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle (Hassell et al. 1993), skin (Chakravarti et al. submitted), and intervertebral discs (B. Johnstone, personal communication). Like decorin, another SIPG member, lumican also interacts with collagen and limits growth of fibrils in diameter (Rada et al. 1993; Scott 1988). In the cornea, lumican not only interacts with collagen molecules to limit fibril growth, but by virtue of its keratan sulfate-containing glycosaminoglycan side chains plays a crucial role in the regular spacing of fibrils and acquisition of corneal transparency (Scott 1991). The primary structure of lumican, derived from cDNA sequencing of chicken, bovine, and human clones, shows all the characteristic features of the SIPG family, namely, four and two cysteines in the Nand C-terminal globular domains, I and III, and a central, cysteine-free domain l_I, with 9 ~ sheet-forming leucine motifs (Blochberger et al. 1992; Funderburgh et al. 1993; Chakravarti et al. submitted). In the human, lumican localizes to Chromosome (Chr) 12q21.3-22 (Chakravarti et al. submitted). We report localization of the mouse lumican gene to distal Chr 10 by segregation analysis of restriction fragment length variants (RFLV) in recombinant inbred (RI) strains of mice. This study further extends the conservation of synteny between human Chr 12q21.3-22 and distal mouse Chr 10. We used a lumican coding sequence, PCR amplified from a mouse lumican genomic clone in Southern analyses for chromosome localization. Mouse genomic clones for lumican were obtained by screening a 129/Sv genomic DNA library (Stratagene) with a human lumican cDNA probe. The mouse lumican coding sequence was amplified from one of these genomic clones, with oligonucleotide primers that amplify nucleotides 263-681 from human lumican cDNA. PCR amplification yielded a product of expected size (primer pairs, upper 5'AGTGTACCAATGGTGCCTCCTG3' and lower 5 'CAGTCTGGCTATCTGATTGAAGCTC3'; PCR conditions: hold at 94~ 5 rain, cycle program 94~ 1 rain, 50~ anneal, extend at 72~ The nucleotide sequence of this PCR product (data not shown) yielded the derived amino acid sequence of 108 amino acids from the highly conserved central domain II of lumican sharing 96% identity with bovine, 93% identity with human, and 77% identity with chicken at the amino acid level (Funderburgh et al. 1993; Chakravarti et al. submitted; Blochberger et al. 1992). The mouse coding sequence was used to identify lumican

Protective Protein for β-Galactosidase, Ppgb, Maps to the Distal Imprinting Region of Mouse Chromosome 2 but Is Not Imprinted

Human chromosome 20 is conserved as a single segment on distal mouse chromosome (Chr) 2. PPGB, protective protein for β-galactosidase, maps to human chromosome 20q13.1, and from linkage analysis of two interspecific crosses incorporating the mouse reciprocal translocations, T(2;8)2Wa (T2Wa) and T(2;16)28H (T28H), we have mapped the mouse homologue, Ppgb, to the conserved region on distal mouse Chr 2. From the combined data, the order of markers is T2Wa-Ada-Ppgb-D2Mit25-T28H. Loci mapping between the T2Wa and T28H breakpoints lie in a region that is subject to parental imprinting, and so expression of Ppgb was tested in mice with maternal duplication/paternal deficiency and its reciprocal for the distal region of Chr 2. We have shown by reverse transcription-polymerase chain reaction (RT-PCR) that both parental alleles of Ppgb were expressed in the brain and kidney of 17.5-day-old embryos, 18.5-day-old embryos, and newborn mice. Thus, Ppgb does not appear to be subject to imprinting effects in the mouse.

Chromosomal mapping in the mouse of eight K+-channel-genes representing the four Shaker-like subfamilies Shaker, Shab, Shaw, and Shal

The four Shaker-like subfamilies of Shaker-, Shab-,Shaw-, and Shal-related K+ channels in mammals have been defined on the basis of their sequence homologies to the corresponding Drosophila genes. Using interspecific backcrosses between Mus musculus and Mus spretus, we have chromosomally mapped in the mouse the Shaker-related K+-channel genes Kcna1, Kcna2, Kcna4, Kcna5, and Kcna6; the Shab-related gene Kcnb1; the Shaw-related gene Kcnc4; and the Shal-related gene Kcnd2. The following localizations were determined: Chr 2, cen-Acra-Kcna4-Pax-6-a-Pck-1-Kras-3-Kcnb1 (corresponding human Chrs 11p and 20q, respectively); Chr 3, cen-Hao-2-(Kcna2, Kcnc4)-Amy-1 (human Chr 1); and Chr 6, cen-Cola-2-Met-Kcnd2-Cpa-Tcrb-adr/Clc-1-Hox-1.1-Myk-103-Raf-1-(Tpi-1, Kcna1, Kcna5, Kcna6) (human Chrs 7q and 12p, respectively). Thus, there is a cluster of at least three Shaker-related K+-channel genes on distal mouse Chr 6 and a cluster on Chr 2 that at least consists of one Shaker-related and one Shaw-related gene. The three other K+-channel genes are not linked to each other. The map positions of the different types of K+-channel genes in the mouse are discussed in relation to those of their homologs in man and to hereditary diseases of mouse and man that might involve K+ channels.

Mapping of the structural gene for S-adenosyl homocysteine hydrolase to mouse chromosome 2, and related sequences to chromosomes 8 and X.

Comparative mapping studies in human and mouse have shown that, to date, human Chromosome (Chr) 20 is completely syntenic with distal mouse Chr 2. The structural locus for S-adenosyl-L-homocysteine hydrolase (EC 3.3.1.1) in human, AHCY, maps to 20 qter-->q13.1, and we report here that the homologous locus in the mouse, Ahcy, maps to distal mouse Chr 2 with gene order Pcna-Ahcy-Ada. Analysis of 123 progeny of an interspecific backcross between a laboratory stock, AN, and Mus spretus using a rat cDNA probe revealed the presence of at least two other Ahcy-related sequences segregating independently in the mouse genome. One, Ahcy-rs1, was mapped to Chr 8 in the BXH recombinant inbred strains, and the other, Ahcy-rs2, shows a pattern of inheritance consistent with X-linkage.

A linkage map of mouse chromosome 1 using an interspecific cross segregating for the gld autoimmunity mutation.

An interspecific backcross was used to define a high resolution linkage map of mouse Chromosome (Chr) 1 and to analyze the segregation of the generalized lymphoproliferative disease (gld) mutation. Mice homozygous for gld have multiple features of autoimmune disease. Analysis of up to 428 progeny from the backcross [(C3H/HeJ-gld x Mus spretus)F1 x C3H/HeJ-gld] established a map that spans 77.6 cM and includes 56 markers distributed over 34 ordered genetic loci. The gld mutation was mapped to a less than 1 cM segment on distal mouse Chr 1 using 357 gld phenotype-positive backcross mice. A second backcross, between the laboratory strains C57BL/6J and SWR/J, was examined to compare recombination frequency between selected markers on mouse Chr 1. Significant differences in crossover frequency were demonstrated between the interspecific backcross and the inbred laboratory cross for the entire interval studied. Sex difference in meiotic crossover frequency was also significant in the laboratory mouse cross. Two linkage groups known to be conserved between segments of mouse Chr 1 and the long arm of human Chrs 1 and 2 where further defined and a new conserved linkage group was identified that includes markers of distal mouse Chr 1 and human Chr 1, bands q32 to q42.