Discoloration Patterns Research Articles

Wood discoloration patterns depending on the light source

The wood photodegradation, including discolouration caused by exposure to UV and solar radiation, has been intensively studied, while the effect of artificial lighting on wood has been little investigated. In the present study, the effect of three types of artificial light sources (LED, incandescent, and fluorescent lamps) on the colour changes of wood was evaluated. LEDs with high (6500 K) and low (3000 K) correlated colour temperature were employed in the experiments. Wood colour was assessed by spectrophotometric measurements of reflectance spectra, which were converted into colour parameters of the CIELAB colour system. The total discolouration as well as the changes in colour lightness, chroma (saturation), and hue were evaluated for two hardwood species (birch, oak) and two softwood species (spruce, pine - sapwood and heartwood) depending on the irradiation dose. Visually perceivable changes in colour of all woods were observed already at relatively low irradiation doses, indicating a high sensitivity of the wood to radiation emitted by artificial light sources. Comparing the softwoods and hardwoods included in the study, the latter proved to be more resistant to discolouration caused by the tested light sources. Overall, greater colour changes in long-term exposure were caused by incandescent and fluorescent lamps, although more rapid discolouration developed in the early stage irradiation with LEDs. A substantial difference between the effect of the tested LEDs was only observed in the initial phase, when the cool LED (6500 K) caused more discolouration. The changes in the colour parameters were complex and varying in directions, including a reversal with the accumulation of the irradiation dose, indicating that the exposure to artificial light sources resulted in continuous alteration in the shade of the wood colour.

Preparation and application of an olfactory visualization freshness sensor array based on microfluid paper‐based chip

This paper introduced a novel olfactory visualization freshness sensor array prepared by dropping pH indicators on UV lithography hydrophilic–hydrophobic paper under room temperature. The sensor array was applied in Grass carp spoilage classification. The sensor array can generate different discoloration patterns that respond to the pH change of the fish spoil; therefore, it can distinguish Grass carp freshness using pattern recognition. Classification models were built with linear discriminant analysis (LDA) and backpropagation artificial neural network (BP-ANN) after extracting the sensor array’s feature color information with principal component analysis (PCA). The performance of the BP-ANN model was superior to that of the LDA model, with an optimum recognition rate of 95.45% (training set) and 90.90% (testing set). In conclusion, with a suitable algorithm choice and rational pH indicator arrangement, this olfactory visualization freshness sensor array can potentially monitor food freshness. We prepared Grass carp freshness sensor array through dropping pH-indicators on hydrophilic–hydrophobic filter paper that fabricated by UV lithography under room temperature. The hydrophobic edges of the filter paper can maintain the sensor spots' shape and provide stable and consistent colorimetric change for Grass carp freshness recognition. Colorimetric classification models are built using LDA and BP-ANN based on pattern recognition, and the recognition rate of the BP-ANN model is above 90%. Novelty impact statement We prepared Grass carp freshness sensor array through dropping pH-indicators on hydrophilic-hydrophobic filter paper that fabricated by UV lithography under room temperature. The hydrophobic edges of the filter paper can maintain the sensor spots’ shape and provide stable and consistent colorimetric change for Grass carp freshness recognition. Colorimetric classification models are built using LDA and BP-ANN based on pattern recognition, and the recognition rate of the BP-ANN model is above 90 %.

Correlation of UV Fluorescence Images With Performance Loss of Field-Retrieved Photovoltaic Modules

The ultraviolet fluorescence (UVF) imaging method has been widely used as a rapid and economic field inspection tool for investigating encapsulant discoloration of field-aged photovoltaic (PV) modules. In field-aged PV modules, encapsulant discoloration can result in a pronounced decrease in the short-circuit current. The spatial distribution of environmental stressors and therefore discoloration pattern over each cell of a module depends on the climate. In this article, we investigated the discoloration patterns (and their correlation with electrical parameters of modules and the extracted-cells from the modules) of ten modules produced at the same manufacturing facility and retrieved respectively from two distinct climates of Arizona (hot-dry; seven modules; 18 years of exposure) and Florida (hot-humid; three modules; ten years of exposure). In the Arizona modules, three distinct spatial patterns were observed in the UVF images: cell center region (intense browning); cell edge region (no browning); region between cell center; and cell edge region (light browning). However, in the Florida modules, only two distinct spatial distributions were observed: nonedge cell region (medium browning) and cell edge region (no browning). Furthermore, we employed a high-contrast UVF imaging technique to correlate the interdependence between the encapsulant discoloration pattern and the metallization/contact degradation pattern. For this correlative study, various experimental characterizations were carried out on both field-aged (Arizona and Florida) and unexposed modules and the cells extracted from the modules of the same model and they include: processed UVF and EL images, and I-V, TLM, optical microscopy, and XPS measurements.

Histological Examination of Respiratory Tissues of Dolphins and Porpoises Subjected to Postmortem Blast Exposure

Exposure to explosions often causes morbidity as waves of over-pressure and under-pressure shear interstitial tissue and cause traumatic damage including severe hemorrhage. Respiratory tissues are most at risk due to their proximity to free gas volumes that rapidly and severely contract or expand during blast-induced pressure changes. Unfortunately, we have no medical interventions that can prevent or limit pressure-induced blast damage to tissues. Perhaps such protective technology can be modeled from the respiratory tissue of diving animals that are naturally adapted for pressure changes. Our goal is to characterize any respiratory injuries resulting from postmortem blast pressure exposures. 5 species of freshly dead dolphins (n= 8) and porpoises (n =6) were obtained from naturally occurring strandings were artificially exposed to blast pressures postmortem. Gross observations were made during a necropsy, and respiratory tract tissues were then harvested and processed for histological examination. Blast pressure exposure levels were not revealed to enable unbiased observations. Results indicate that many specimens show dark reddish discoloration of variable intensities that may be evidence of blast-induced trauma. Discoloration was found in the lungs (dark, striped pattern correlating with intercostal spaces between ribs), larynx (above and below palatopharyngeal sphincter), trachea (uniform throughout lumen), and nasal region (visualized only in areas of sloughed lining). Gas containing tissues may exhibit damage due to dramatic compression/expansion to accommodate changing gas volumes. Abrupt edges to discoloration patches indicate protection, possibly conferred by contact with adjacent tissues. Discoloration patterns are consistent in location but have variable intensity, perhaps reflecting different degrees of exposure. Specimens exhibited variable levels of damage to the same organs, perhaps indicating a correlation with received blast pressures. These differences may also indicate a level of resistance to blast damage of tissues that have mechanisms to compensate for pressure changes. Tissue compensation is likely limited to pressure exposures that correspond to naturally occurring diving pressures. Pressures that exceed these levels are presumed to overwhelm tissue compensatory mechanisms. This information may be useful in setting critical exposure limits to prevent harm to odontocetes in the vicinity of a blast event. Further, It is hoped that a discovery of pressure mitigating structures in dolphins can inspire the design of new protective devices for use by people exposed to blast forces.

10-Year Clinical Comparative Study of Ceramic and Composite Veneered Metal Crowns.

The rejection of composite veneerings in fixed partial dentures is primarily caused by the inadequacy of the bonds between the metal framework and the composite veneering. The development of improved veneering composites necessitates an investigation of their clinical suitability compared with ceramic materials. Nineteen patients with at least two suitable, adjacent natural teeth for crowning were treated with 64 high noble alloy crowns. The adjacent crowns were veneered with ceramic (IPS inline) and composite materials (SR Adoro). Seven follow-up examinations were carried out over a period of 10 years. The crowns were investigated for mechanical defects, periodontal parameters, and discolorations. The survival rates of the ceramic veneered metal crowns (CeMCs) and composite veneered metal crowns (CoMCs) at the 10-year follow-up were 87.1 and 87.9%, respectively. The success rates of the crowns after 10 years were 83.9% for CeMCs and 51.5% for CoMCs (log-rank test, p = 0.009). No significant differences between the groups were found in the periodontal parameters (Kruskal-Wallis one-way analysis of variance, ANOVA p ⟩ 0.05). After 10 years, discoloration patterns of the two materials differed significantly (Mann-Whitney-U-test, p = 0.017). Thus, despite the improvements associated with CoMCs, CeMCs remain the gold standard for veneered metal crowns.

Foliar fungal disease classification in banana plants using elliptical local binary pattern on multiresolution dual tree complex wavelet transform domain

The fungal diseases in banana cause major yield losses for millions of farmers around the globe. Early detection of these diseases helps the farmers to devise successful management strategies. The characteristic leaf blade discoloration pattern at the earlier stages of infection could be used to understand the onset of each disease. This paper demonstrates a methodology for classification of three important foliar diseases in banana, using local texture features. The disease affected regions are identified using image enhancement and color segmentation. Segmented images are converted to transform domain using three image transforms (DWT, DTCWT and Ranklet transform). Feature vector is extracted from transform domain images using LBP and its variants (ELBP, MeanELBP and MedianELBP). These texture based features are applied to five popular image classifiers and comparative performance analysis is done using ten-fold cross validation procedure. Experimental results showed best classification performance for ELBP features extracted from DTCWT domain (accuracy 95.4%, precision 93.2%, sensitivity 93.0%, Fscore 93.0% and specificity 96.4%). Compared with traditional methods of feature extraction, this novel method of fusing DTCWT with ELBP features has attained high degree of accuracy in precisely detecting and classifying fungal diseases in banana at an early stage.

Impacts of storage temperature and rice moisture content on color characteristics of rice from fields with different disease management practices

Rice downgrading due to discoloration in storage presents a significant loss to growers and processors. The objective of this study was to investigate impacts of storage temperature and rice moisture content (MC) on color characteristics of milled hybrid rice (cv. XL 745) from fields with differing production practices. Freshly-harvested rough rice from field plots treated with and without fungicide for rice disease control during production were procured and stored at four MC levels (12.5%, 16%, 19% and 21% wet basis), and at five temperatures (10 °C, 15 °C, 20 °C, 27 °C, 40 °C) for 16 weeks, with samples taken every 2 weeks. Kinetics of mold growth and rice color were determined. It was observed that at 12.5% MC, discoloration was abated across all studied temperatures and treatments until 6 weeks of storage and increased not in excess of 20% thereafter 16 weeks. As the storage MC increased to 16%, discoloration increased and became significantly notable at the highest temperature of 40 °C. By week 16, at 40 °C storage temperature, discoloration increased significantly to 87.9% and 73% for sample lots from fungicide and non-fungicide treated plots, respectively. At the highest MC (21%), increase in rice discoloration was notable as early as after 2 weeks, across all storage temperatures, and continued to increase, especially for the highest storage temperature of 40 °C, to as high as 99.1% and 96.47%, after 16 weeks, for sample lots from fungicide and non-fungicide treated plots, respectively. There was more expression of discoloration patterns on samples stored at the highest temperature of 40 °C compared to that at lower temperatures, for both categories of sample treatments and ranges of studied MCs. Although not yet widely used for rice, this study suggested that cooling technology for rice, may have potential to extend rice storability, especially by retarding discoloration in the first few weeks after harvest.

Impacts of Delayed Drying on Discoloration and Functionality of Rice

In‐bin, on‐farm drying systems for rough rice present challenges for maintaining kernel quality when drying fronts stall and the top layer of grain maintains its harvest moisture content (MC) for extended periods. This high MC, in addition to ambient temperatures in early autumn in the Mid‐South United States, creates ideal conditions for quality losses to occur. This study evaluated the effects of rough rice storage at MCs of 12.5, 16, 19, and 21% for up to 16 weeks at temperatures of 20, 27, and 40°C on milling yields, kernel color, and functionality of three long‐grain cultivars. Head rice yield was negatively impacted only after other reductions in quality had occurred. Temperature‐specific discoloration patterns were observed at 27 and 40°C in 2014; the uniquely discolored kernels seen in 2014 at 27°C were absent from samples in 2015 under identical conditions. Peak viscosity, breakdown, and final viscosity tended to increase over storage duration at 20 and 27°C and all storage MCs but plateaued after 8 weeks. Storage of rice at 40°C and all MCs greatly reduced peak viscosity after 6 weeks. To prevent quality losses, in‐bin dryers should be monitored closely to avoid exceeding the thresholds of storage MC, temperature, and duration identified here.

First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China.

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss.

Seasonal variations in the incidence of pine wilt and infestation by its vector, Monochamus alternatus, near the northern limit of the disease in Japan

During the last few decades, pine wilt disease has spread to cool-climate regions in Japan and, more recently, the potential risk of it spreading into the European midwest has also become a concern. In a coastal pine stand (84.7 ha) in Akita, near the northern limit of pine wilt disease in Japan, we investigated seasonal variations in the incidence of damage caused by the disease to trees and oviposition by the disease's insect vector, Monochamus alternatus, during a two-year period. Foliage discoloration occurred throughout each year, and its seasonal variation showed a bimodal pattern in Pinus thunbergii (a higher peak in May–June and a smaller peak in October) and a clear peak in June in P. densiflora, which differed from the patterns in seasonal variation seen for warm-climate regions. Oviposition scars by M. alternatus were found in 40–45% of the trees damaged each year. The percentage of trees that had oviposition scars was higher in P. thunbergii than in P. densiflora. This appeared to reflect the difference in seasonal discoloration pattern between the two species. Analysis of the oviposition risk showed that trees that exhibited discoloration starting between July and October had a significantly higher risk or significantly higher oviposition scar densities, particularly for those that became discolored between August and September (2.5–14.6-fold higher risk than during other months). Oviposition scar densities per damaged tree were similar within the period of higher oviposition risk. Considering both oviposition risks and scar densities, we concluded that trees with discoloration that become apparent between July and October are important targets for preventing the spread of pine wilt disease in Akita.

Development of wood decay in wound-initiated discolored wood of eastern red cedar

Abstract Logs of eastern red cedar, Juniperus virginiana L., with well-developed bands of light-colored wood (“included sapwood”) within heartwood can be unsuitable for sawn wood products. This finding is in contrast to published information that the “included sapwood” is (1) a heartwood anomaly rather than sapwood and (2) its occurrence is not a reason to exclude this type of wood from commercial use. The alternative view presented here is that “included sapwood” is wound-initiated discolored wood which is the starting point for wood decay in living trees and which has adversely altered wood properties before the development of decay symptoms. Our study of the patterns of discoloration and decay, electrical resistance properties, elemental analysis, wood acidity, solubility in dilute NaOH, total phenol content, and tests of wood decay resistance indicated that the so-called included sapwood was discolored wood. This light-colored discolored wood had no greater decay resistance than sapwood, a common finding in other tree species in which “included sapwood” is found. Half the sample disks sent to our laboratory had symptomatic decay within the bands of light-colored discolored wood bounded by a phenol-enriched protective layer on the bark side and phenol-enriched heartwood on the pith side of the band. This ring-rot, even in its pre-symptomatic stage, can cause problems during processing for sawn wood products. Therefore, logs with well-developed bands of light-colored discolored wood should be considered high-risk material for some products, although they could be useful for others.

Response of Two Oak Species to Reduction Pruning Cuts

Reduction pruning cuts were used to prune Quercus virginiana (live oak) and Quercus Shumardii (shumard oak). One-half of the pruning wounds were harvested and dissected 3 years later to observe extent of discoloration in response to the pruning cut. Shumard oak did not limit discoloration as effectively as live oak. Discolored area in the wood increased with size of the pruning cut surface in shumard oak and less so in live oak. Dissections showed that the shape of the discolored area attenuated with depth. The branch connection morphology and response (branch–trunk aspect ratio, branch angle, release growth after pruning) appeared to influence discoloration pattern in reduction pruning. The angle of the reduction cut relative to the American National Standards Institute-recommended angle bisect method was not found to influence discoloration. Discoloration in the less efficient compartmentalizing species (Shumard oak) was related to cut surface area, but not to cut angle. There was no relationship between aspect ratio and discoloration in the 3 years after pruning. The data suggest that reduction cuts can be made back to lateral branches as small as one-third the diameter of the removed stem.

Sodium Chloride Injury on Buds of Acer platanoides, Tilia cordata, and Viburnum lantana

Dormant lateral buds of Norway maple (Acer platanoides L.), littleleaf linden (Tilia cordata Mill.), and wayfaringtree viburnum (Viburnum lantana L.) were collected and exposed to nine NaCl concentrations: 0, 500, 1,000, 2,000, 4,000, 8,000, 16,000, 32,000, and 64,000 mg/L (0, 500, 1,000, 2,000, 4,000, 8,000, 16,000, 32,000, and 64,000 ppm) in December 2001 and January and March 2002. Electrolyte leakage and visual observations of inner and outer tissue discoloration were used to assess injury. Bud injury generally increased as NaCl concentration increased. Bud morphologies of each species were related to tissue discoloration patterns; naked buds were more susceptible to NaCl than those with bud scales. Buds also exhibited seasonal NaCl resistance; the greatest resistance occurred in December. Norway maple, wayfaringtree viburnum, and littleleaf linden buds experienced 50% electrolyte leakage at calculated NaCl values of 12,941, 16,901, and 42,594 mg/L (12,941, 16,901, and 42,594 ppm) NaCl, respectively, but no severe inner tissue discoloration occurred at any level of NaCl treatment. In January, 50% electrolyte leakage occurred at lower NaCl concentrations in Norway maple [7,165 mg/L (7,165 ppm)] and littleleaf linden buds [27,118 mg/L (27,118 ppm)]. Moderate to severe inner tissue injury was detected for all species at 1,000 mg/L (1,000 ppm) NaCl. Buds were most susceptible to NaCl injury in March, with moderate to severe inner tissue discoloration occurring in wayfaringtree viburnum and littleleaf linden buds at 500 mg/L (500 ppm) NaCl.

Pre-maturity α-amylase and incipient sprouting in UK winter wheat, with special reference to the variety Rialto

In 1998 and 1999 the UK winter wheat variety Rialto produced unexpected low Hagberg falling numbers that could not be directly linked to sprouting. It was proposed that these reductions in quality could be due to pre-maturity α-amylase activity (PMAA). The problem was not identified during the selection and commercial development stages. Our study tested the hypothesis that the variety Rialto is PMAA-susceptible. Analysis was done on 13 year-location combinations of field grown Rialto. Together, visual and chemical assessments of sprouting and iso-electric focusing of α-amylase isozymes identified several samples with significant α-amylase activity in the apparent absence of sprouting. In addition, tests with α-amylase sensitive Phadebas gel revealed distinctive PMAA discoloration patterns in 10–44% of the grain from the 13 samples, leading to the conclusion that Rialto is PMAA-susceptible. Diurnal temperature range accumulated for an 11 day period during a warm spell in early simulated grain development displayed a significant but negative correlation with the number of grains showing clear PMAA discoloration patterns on Phadebas gel. The number of clear PMAA grains correlated positively with rainfall accumulated over 11 days. These results suggest that PMAA can increase under conditions similar to those conducive to pre-harvest sprouting. It is however also possible that in some instances both PMAA and incipient sprouting could have produced similar patterns of α-amylase activity. In addition to tests with Rialto, Phadebas gel tests were therefore also done with the known high Hagberg varieties Option and Malacca, sprouted in a controlled environment. Results from the additional gel tests suggest that visual and chemical assessments of sprouting in the grain combined with Phadebas gel analysis could identify PMAA more reliably in grain sub-samples than Phadebas gel analysis alone.

Erosion of limestone building surfaces caused by wind-driven rain: 1. Field measurements

Abstract Complex patterns of discoloration are often seen on the surfaces of stone buildings in urban areas. These patterns reflect interactions between atmospheric pollutants, the surface layers of stone, and wind-driven rain that can erode the surface. This first paper in a two-paper series presents field measurements of wind-driven rain on a tall limestone building. The volume of driving rain on the building wall was measured at 16 locations over a 21-month period, and meteorological data were recorded for the same period. Analysis of data from 94 rain events suggests that wind-driven rain is strongly affected by rainfall intensity, wind speed, wind direction and measurement location. The five locations with driving rain volumes 4 l over this period are characterized by heavily soiled walls, while the two locations with driving rain volumes > 8 l are characterized by white, eroded walls. The remaining nine locations have driving rain volumes in the range 4– 8 l and varying amounts of soiling, with no clear relationship between these two variables. It is hypothesized that variation in raindrop momentum, which was not measured, is partially responsible for surface erosion and thus removal of soiling in this last category.

A phenomenological model of the current filamentation instability driven by cathode processes in the Livermore spheromak

The current density on the open field lines of the Livermore spheromak (SSPX) typically exceeds the saturation current density of the bulk plasma. We assume that the mechanism that provides conditions for that is associated with the formation of a thin layer near the cathode surface, where both the plasma and the neutral density are higher than in the bulk plasma and where intense ionization occurs. The ions formed in this layer fall back onto the cathode, whereas electrons contribute to the high current density in the bulk plasma. The particle balance in the ionizing layer is determined by the recycling coefficient, which, in turn, depends on the cathode temperature and the sheath voltage. As it turns out, these dependences give rise to an instability that leads to the current filamentation and the formation of hot spots on the cathode surface. The instability can be characterized in a phenomenological manner without going into the details of the structure of the ionizing layer, whose effect on the instability shows up in the form of a couple of numerical coefficients of the order of one. We predict the characteristic size and the shape of the filaments (and the hot spots), which are in a general agreement with discoloration patterns on the surface of the cathode in the SSPX. If the magnetic field is tilted to the surface, the footpoints of the filaments move with a significant velocity, whose direction depends on the ratio of the ion gyroradius and the thickness of the ionizing layer. This instability, although primarily considered in conjunction with the SSPX experiment, may play a role in spherical tokamaks and other systems with coaxial helicity injection.

A staining procedure for the detection of oxidized sites in polyolefins

AbstractOxidized areas in polyolefin (PE, PP, EPDM) solids can be located by immersion in a warm isopropanolic solution of Sudan III and methylene blue, followed by observation of the solid discoloration pattern. Oxidized sites are stained blue, nonoxidized sites are stained pink. UV/Vis transmission and photoacoustic spectra can be obtained from the stained samples.

High zone-selectivity of cell permeabilization following digitonin-pulse perfusion of rat liver. A re-interpretation of the microcirculatory zones.

The plasma membrane permeabilization obtained by exposure of hepatocytes to digitonin is utilized in the so-called digitonin-pulse perfusion of rat liver (Quistorff and Grunnet 1987). Brief pulses of digitonin applied with antegrade and retrograde perfusion of the liver caused selective elution of cytosolic enzymes and metabolites from the periportal and the perivenous zone of the same liver. In the present study a light microscopical examination of the liver fixed immediately after the digitonin pulse confirmed the very high zonal selectivity of the method inferred from the marker enzyme pattern of the eluates: Only cells around the port of entry of digitonin were affected and the borderline between affected and non-affected cells was always sharp. The typical periportal lesion was triangular in shape, enclosing the portal space, while the perivenous lesion was roughly circular, concentric with the hepatic vein. Assuming that the digitonin lesion reflects the microcirculatory flow pattern these findings seem to be at variance with the acinar model of Rappaport (Rappaport et al. 1954). The lesion in the lobuli near the surface of the liver as reflected by the discoloration pattern observed on the surface was the same as the lesion of deeper lobuli. The conducting vessels of the liver were only insignificantly affected by digitonin. At the cellular level only the sinusoidal luminal surface of the hepatocytes was affected. The cytoplasmic matrix of the cells including glycogen appeared thinned. All cell types of the liver parenchyma seemed to be equally affected by the digitonin treatment.

Detection of Decay in Trees

New ideas and new tools give the arborist new opportunities to better assess the hazard potential of decayed trees. Before using electronics to help detect decay in trees, today's arborist must first train the "mind's eye" to "see" inside the living tree. A model system called CODIT has been developed to explain the patterns of discoloration and decay in wounded trees. With an understanding of the model, a batterypowered drill, and a pulsed-current resistance meter, the arborist can get a good picture of what the inside of a tree is like. With better detection comes the need for better professional judgment to determine how to treat decayed trees.

Successions of Microorganisms and Patterns of Discoloration and Decay after Wounding in Red Oak and White Oak

Successions of Microorganisms and Patterns of Discoloration and Decay after Wounding in Red Oak and White Oak