Digoxigenin-labeled RNA Probes Research Articles

Fluorescent In Situ Hybridization in Embryos of the African Turquoise Killifish Nothobranchius furzeri.

Precisely where and when a given gene is expressed is crucial for our understanding of developmental and cell biology but determining this is often constrained by detection limits. Here, we describe a technique for visualization of low-copy mRNA in Nothobranchius furzeri embryos using tyramide signal amplification (TSA). In this protocol, an anti-sense digoxigenin-labeled RNA probe is hybridized to mRNA in situ. Anti-digoxigenin antibodies conjugated to horseradish peroxidase (POD) are then bound to the probe and reacted with fluorescently labeled tyramide. Combining this method with a counterstain, such as DAPI, allows for the detection of mRNA at a single-cell resolution.

Study of Circular RNA Expression by Nonradioactive Northern Blot Procedure.

Circular RNAs (circRNAs) are covalently closed transcripts generated by back-splicing reaction. The lack of free ends endows these RNA molecules with high stability thus allowing them to accumulate in tissues and body fluids. They are widely expressed in most organisms, are modulated during development and display tissue-specific expression, resulting particularly enriched in the nervous system. Deregulation of circRNA expression has also been associated with several pathological conditions including neurological diseases and cancer.Here we present a Northern blot procedure that allows the analysis of the expression of bona fide circRNAs through the use of a digoxigenin-labeled RNA probe and the immunodetection of the signals.

Whole Mount In Situ Hybridization and Morphometric Analysis in Rabbit Embryos.

Rabbits are valuable experimental animals used to evaluate the teratogenicity of chemical entities. If teratogenicity is recognized, it is very important to investigate the pathogenesis to assess the potential risk in humans. For this investigation, whole-mount in situ hybridization (WISH) is highly useful for visualizing spatial and temporal changes in the expression patterns of the targeted genes and or proteins. In this chapter, the WISH method in rabbit embryos, using a digoxigenin-labeled RNA probe, and the morphometric analysis of the expression pattern is described.

Biological implications of somatic DDX41 p.R525H mutation in acute myeloid leukemia.

The DDX41 gene, encoding a DEAD-box type ATP-dependent RNA helicase, is rarely but reproducibly mutated in myeloid diseases. The acquired mutation in DDX41 is highly concentrated at c.G1574A (p.R525H) in the conserved motif VI located at the C-terminus of the helicase core domain where ATP interacts and is hydrolyzed. Therefore, it is likely that the p.R525H mutation perturbs ATPase activity in a dominant-negative manner. In this study, we screened for the DDX41 mutation of CD34-positive tumor cells based on mRNA sequencing and identified the p.R525H mutation in three cases among 23 patients. Intriguingly, these patients commonly exhibited acute myeloid leukemia (AML) with peripheral blood cytopenias and low blast counts, suggesting that the mutation inhibits the growth and differentiation of hematopoietic cells. Data from cord blood cells and leukemia cell lines suggest a role for DDX41 in preribosomal RNA processing, in which the expression of the p.R525H mutant causes a certain ribosomopathy phenotype in hematopoietic cells by suppressing MDM2-mediated RB degradation, thus triggering the inhibition of E2F activity. This study uncovered a pathogenic role of p.R525H DDX41 in the slow growth rate of tumor cells. Age-dependent epigenetic alterations or other somatic changes might collaborate with the mutation to causeAML.

Mouse placental distribution of enzymes and transporter modulating PGE2 level

Mouse placental distribution of enzymes and transporter modulating PGE2 level

First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China.

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss.

Detection of Potato spindle tuber viroid and Other Related Viroids by a DIG Labelled RNA Probe.

Viroids can cause diseases of considerable economic importance; in Europe the main concern is with pospiviroids that may affect the tomato and potato industries. Methods for detection are required that are both sensitive and robust. The detection method described here is a probe hybridization method with a commercially available digoxigenin (DIG) labelled full-length Potato spindle tuber viroid (PSTVd) RNA probe. This method detects PSTVd and all other known pospiviroids.

Molecular cloning, characterization and expression analysis of a Doublesex gene from Daphnia carinata (Crustacea: Cladocera) during different reproductive stages.

To better understand the reproductive transformation mechanism of Daphnia carinata, a Doublesex (Dsx) gene was cloned based on rapid amplification of cDNA ends (RACE), and was designated DapcaDsx2. Next, we compared similarities and assumed homology based on deduced amino acid sequences. It showed 97.52, 87.94, and 85.11% identity to orthologous genes in D. magna, D. pulex, and D. galeata respectively. Phylogenetic analysis revealed that DapcaDsx2 clustered in the same class, and was evolutionarily more distant to sequences from other species. qRT-PCR showed that DapcaDsx2 was most abundantly expressed during sexual reproduction (P < 0.05). Using digoxigenin-labeled RNA probes, we studied DapcaDsx2 expression in parthenogenetic and sexual females by whole-mount in situ hybridization. The results revealed that DapcaDsx2 was mainly expressed in the second antennae and several sites of the ventral carapace, whereas higher expression levels were found in sexual than in parthenogenetic females. This suggests that the DapcaDsx2 gene is involved in switching modes of reproduction and in sexual differentiation.

Specific detection of three Torradovirus species with digoxigen-labeled probes

Background Torradoviruses are an emerging group of picorna-like plant virus from the family Secoviridae that infect tomato and other Solanaceae species. The genus Torradovirus include four species: Tomato torrado virus (ToTV), first found in Europe, and afterward in Central America and Australia; Tomato apex necrosis virus (ToANV), present in Mexico; Tomato chocolate spot virus (ToChSV) and Tomato chocolate virus (ToChV), both found in Guatemala. The symptoms caused by these viruses include chlorotic regions on the leaves that may develop to necrotic spots and holes, while the fruits show necrotic lines and frequently cracks on the surface, reducing yield and quality [1]. Even though these viruses have not yet been found in Brazil, the sudden spread of ToTV from Europe to Australia and Central America emphasize the necessity of effective methods to detect them. For that reason, we have developed digoxigenin-labelled RNA probes for the detection of three torradoviruses, ToANV, ToChSV and ToTV, through hybridization.

Tobacco: A New Natural Host of Tomato chlorosis virus in Spain.

In March 2013, symptoms of mild leaf curling, mosaic, and interveinal yellowing were observed in tobacco (Nicotiana tabacum) plants grown in a row surrounding the exterior of a greenhouse containing a tomato crop in Guía de Isora, Tenerife (Canary Islands, Spain). The tobacco plants were found lightly infested by the whitefly (Hemiptera: Aleyrodidae) Bemisia tabaci. The greenhouses in this area are devoted to the commercial production of tomato. The farmers grow some tobacco plants inside and outside of them as a reservoir of parasitoids and depredators of B. tabaci. This insect is the natural vector of the main viruses severely affecting tomato in the Canary Islands, the begomovirus Tomato yellow leaf curl virus and the crinivirus Tomato chlorosis virus (ToCV). ToCV was detected in Spain in 1997 (2) and has become established in most of the coastal provinces of eastern and southern continental Spain and in the Canary Islands. Approximately 50% of the tomato plants grown inside the greenhouse close to the tobacco plants showed typical ToCV symptoms, and infection by this virus was confirmed in the seven plants tested by reverse transcription (RT)-PCR using specific coat protein gene (CP) primers (see below). Total RNA was extracted with TRIzol Reagent (Invitrogen) from leaves of five tobacco plants showing the symptoms mentioned above and analyzed by dot-blot hybridization using digoxigenin-labeled RNA probes to the CP gene of ToCV. Positive signal was obtained for all five plants. RT-PCR reactions were performed with specific primers for the detection of ToCV, MA380(+) (5'-GTGAGACCCCGATGACAGAT-3') and MA381(-) (5'-TACAGTTCCTTGCCCTCGTT-3'), specific to the CP gene (ToCV RNA 2) (3), and MA396(+) (5'-TGGTCGAACAGTTTGAGAGC-3') and MA397(-) (5'-TGAACTCGAATTGGGACAGA-3'), specific to the RNA-dependent RNA polymerase (RdRp) gene (ToCV RNA 1) (1). DNA fragments of the expected size (436 and 763 bp, respectively) were obtained, thus supporting the presence of ToCV in the symptomatic samples. The amplified product of the RdRp gene fragment from one sample was directly sequenced (Macrogen Inc., South Korea) and resulted closely related to ToCV isolates from Sudan (GenBank Accession No. JN411686, 99.6% nt identity) and Spain (DQ983480, 99.4% nt identity), thereby confirming the infection by this virus. Partial sequence of the ToCV isolate from tobacco was deposited in GenBank under accession no. KJ175084. In addition, all five plants resulted positive when analyzed by ELISA for Tomato spotted wilt virus and Potato virus Y and by PCR for Tomato yellow leaf curl virus (data not shown), all three viruses reported to infect naturally tobacco. Although tobacco has been reported as an experimental host of ToCV (4), to our knowledge, this is the first report of this species as a natural host of this virus. The finding of ToCV infecting tobacco raises the question of whether this virus could emerge as a pathogen of this crop and questions the use that farmers make of tobacco as reservoirs of natural enemies for whitefly control in tomato.

Lack of Decorin Expression by Human Bladder Cancer Cells Offers New Tools in the Therapy of Urothelial Malignancies

Decorin, a multifunctional small leucine-rich extracellular matrix proteoglycan, has been shown to possess potent antitumour activity. However, there is some uncertainty whether different cancer cells express decorin in addition to non-malignant stromal cells. In this study we clarified decorin expression by human bladder cancer cells both in vivo and in vitro. In addition, the effect of adenovirus-mediated decorin expression on human bladder cancer cells in vitro was examined. We first demonstrated using the publicly available GeneSapiens databank that decorin gene expression is present in both normal and malignant human bladder tissues. However, when we applied in situ hybridization with digoxigenin-labeled RNA probes for decorin on human bladder carcinoma tissue samples derived from a large radical cystectomy patient cohort (n = 199), we unambiguously demonstrated that invasive and non-invasive bladder carcinoma cells completely lack decorin mRNA. The cancer cells were also negative for decorin immunoreactivity. Instead, decorin expression was localized solely to original non-malignant stromal areas of bladder tissue. In accordance with the aforementioned results, human bladder cancer cells in vitro were also negative for decorin expression as shown by RT-qPCR analyses. The lack of decorin expression by bladder cancer cells was shown not to be due to the methylation of the proximal promoter region of the decorin gene. When bladder cancer cells were transfected with a decorin adenoviral vector, their proliferation was significantly decreased. In conclusion, we have shown that human bladder cancer cells are totally devoid of decorin expression. We have also shown that adenovirus-mediated decorin gene transduction of human bladder cancer cell lines markedly inhibits their proliferation. Thus, decorin gene delivery offers new potential therapeutic tools in urothelial malignancies.

Using modified whole-mount in situ hybridization to study mpo expression in zebrafish

In this study, we cloned the myeloperoxidase (mpo) gene of zebrafish and prepared a digoxigenin-labeled mpo RNA probe to investigate mpo gene expression in zebrafish during embryonic development by whole-mount in situ hybridization (WISH). The earliest mpo expression was detected in cells of the intermediate cell mass (ICM) at 18 h post-fertilization (hpf). It was detected 1 to 2 h later in cells in the rostral blood island (RBI) and strong signals were observed in the anterior ICM. Then, it spread over the yolk sac. By 72 hpf these mpo-expressing cells were in the circulation and distributed throughout the embryo. We identified that the level of mpo expression detected by WISH at an early stage was consistent with the data of cytological analyses of adult fish. The use of this method enabled us to track the gene changes that took place before morphological phenotypes were detected, as well to as investigate the hematopoietic cell fate in mutational or transgenic models in vivo. In this study, we modified several steps of WISH. The improved hybridization results demonstrated high specificity, distinct coloration and low background figures.

Survey of Apple mosaic virus in apple-growing provinces of East Anatolia (Malatya and Van) by RNA probe hybridization assay and RT-PCR

Two main apple growing provinces (Van and Malatya) of East Anatolia were surveyed for the presence of the Apple mosaic virus (ApMV). Dot-blot hybridization and RT-PCR tests were implemented to investigate the incidence of ApMV, testing a total of 481 samples collected from commercial apple orchards. Digoxigenin-labeled RNA probes of the ApMV were synthesized from the cloned PCR products and applied in dot-blot hybridization to detect the virus in RNA extracts isolated from fresh leaf tissues. A validated RNA probe (dot-blot) hybridization method was adopted to investigate the presence of ApMV infections in the apple orchards of East Anatolia. In order to determine the most suitable mass extraction methods and to ascertain the presence of virus, 3 RNA preparation procedures (QIAGEN RNA extraction kit, silica capture, and citric buffer) were tested. Among the tested extraction methods, silica capture was determined as the most suitable extraction method for dot-blot hybridization assays. ApMV was found in the surveyed locations with an average incidence of 0.8%. The infected trees showed apparent disease symptoms on the leaves of apple trees. The coat protein (CP) genes of 2 viral isolates selected from Malatya (ApMV-G and ApMV-M) were cloned and their complete nucleotide sequences and deduced amino acids were determined (GenBank acc. nos. JX155668 and JX155669). The CP cistron of the ApMV-G and M isolates contained 224 amino acid residues. Phylogenetic trees based on nucleic acid sequences were constructed by the neighbor-joining and the unweighted pair-group mean arithmetic methods with 100 bootstrap replicates. The CP sequence of ApMV-G and ApMV-M varied among the 21 isolates, with overall identity ranging from 88% to 99% and ranging from 91% to 99% at the nucleotide level.

Localization of decorin gene expression in normal human breast tissue and in benign and malignant tumors of the human breast

The small extracellular matrix proteoglycan decorin which possesses a potent antitumor activity has been shown to be present in various amounts in the stroma of several tumors including those of the breast. Regarding decorin in breast malignancies the published data are conflicting, i.e., whether breast cancer cells express it or not. Here, we first compared decorin gene expression levels between healthy human breast tissue and selected types of human breast cancer using GeneSapiens databank. Next, we localized decorin mRNA in tissue specimen of normal human breast, intraductal breast papillomas and various histologic types of human breast cancer using in situ hybridization (ISH) with digoxigenin-labeled RNA probes for decorin. We also examined the effect of decorin transduction on the behavior of cultured human breast cancer MCF7 cells. Analysis of GeneSapiens databank revealed that in various human breast cancers decorin expression is significant. However, ISH results clearly demonstrated that human breast cancer cells independently of the type of the cancer do not express decorin mRNA. This was also true for papilloma-forming cells of the human breast. Indeed, decorin gene expression in healthy human breast tissue as well as in benign and malignant tumors of human breast was shown to take place solely in cells of the original stroma. Decorin transduction using decorin adenoviral vector in decorin-negative MCF7 cells resulted in a significant decrease in the proliferation of these cells and changed cell cohesion. Decorin-transduced MCF7 cells also exhibited increased apoptosis. In conclusion, our study shows that in human breast tissue only cells of the original stroma are capable of decorin gene expression. Our study also shows that transduction of decorin in decorin-negative human breast cancer cells markedly modulates the growth pattern of these cells.

Chondroitin Sulfate Is a Crucial Determinant for Skeletal Muscle Development/Regeneration and Improvement of Muscular Dystrophies

Skeletal muscle formation and regeneration require myoblast fusion to form multinucleated myotubes or myofibers, yet their molecular regulation remains incompletely understood. We show here that the levels of extra- and/or pericellular chondroitin sulfate (CS) chains in differentiating C2C12 myoblast culture are dramatically diminished at the stage of extensive syncytial myotube formation. Forced down-regulation of CS, but not of hyaluronan, levels enhanced myogenic differentiation in vitro. This characteristic CS reduction seems to occur through a cell-autonomous mechanism that involves HYAL1, a known catabolic enzyme for hyaluronan and CS. In vivo injection of a bacterial CS-degrading enzyme boosted myofiber regeneration in a mouse cardiotoxin-induced injury model and ameliorated dystrophic pathology in mdx muscles. Our data suggest that the control of CS abundance is a promising new therapeutic approach for the treatment of skeletal muscle injury and progressive muscular dystrophies.

First Report of China Rose (Hibiscus rosa-sinensis) as a Host of Alfalfa mosaic virus in Spain.

China rose (Hibiscus rosa-sinensis L.) is an ornamental plant grown throughout the tropics and subtropics. In June 2011, a China rose plant (sample CV-1) showing bright yellow "aucuba"-type mosaic, mainly at the center of the leaves, was found in a public garden in Caleta de Vélez (Málaga Province, southern Spain). Electron microscope examination of negatively stained preparations from the symptomatic plant revealed the presence of semispherical to bacilliform virus-like particles of 30 to 56 × 16 nm. Sap extracts also reacted positively in double-antibody sandwich (DAS)-ELISA to antiserum against Alfalfa mosaic virus (AMV) (Bioreba AG, Reinach, Switzerland). RNA of this sample was extracted with the RNeasy Kit (Qiagen, Valencia, CA) and tested by reverse-transcription (RT)-PCR with AMV specific primers (2), using AMV and GoTaq Master Mixes (Promega, Madison, WI) for cDNA synthesis and amplification, respectively. After cloning and sequencing, the ~750-bp DNA fragment was confirmed as the coat protein (CP) gene of AMV (GenBank Accession No. HE591387) with the highest nucleotide identity of 96% to AMV isolates belonging to subgroup IIA (e.g., GenBank Accession No. AJ130707). Sap from affected leaves of sample CV-1 was mechanically inoculated onto herbaceous indicator plants (Chenopodium amaranticolor, C. quinoa, and Ocimum basilicum). Both Chenopodium species developed chlorotic local lesions followed by mosaic within 3 days after inoculation, and O. basilicum showed bright yellow mosaic of calico type 2 weeks postinoculation. These symptoms are consistent with those reported for AMV in these hosts (1). Virus infection in the inoculated plants was confirmed by DAS-ELISA and RT-PCR. To gain insight on the prevalence and genetic variability of AMV in China rose, a survey was carried out in nearby locations in the provinces of Málaga (14 samples from Torre del Mar and 5 samples from Rincón de la Victoria) and Granada (12 samples from La Herradura). Leaf samples were analyzed by tissue blot hybridization with an AMV-specific digoxigenin-labeled RNA probe obtained from the RNA 1 of the Spanish isolate Tec1 (3), and only two samples from Torre del Mar tested positive. One of these samples (TM-2) was used to amplify by RT-PCR the AMV CP gene that was cloned and sequenced (GenBank Accession No. HE591386). The highest nucleotide identity of the TM-2 CP gene (98%) was with the subgroup IIB Spanish isolate Tec1, whereas identity with the CV-1 isolate was 95%. Nevertheless, phylogenetic analysis (neighbor-joining method) showed that both CV-1 and TM-2 isolates belong to the recently proposed AMV subgroup IIB (3), which includes the Tec1 isolate and two other isolates from ornamental plants, Phlox paniculata from the United States (GenBank Accession No. DQ124429) and Viburnum lucidum from Spain (GenBank Accession No. EF427449). These results show that AMV subgroup IIB is emerging as a complex cluster of virus isolates that currently are reported to infect only ornamentals. To our knowledge, this is the first report of AMV naturally occurring in China rose.

Identification of programmed cell death related genes in bamboo

The event of bamboo flowering and subsequent death of bamboo cells, a rare phenomenon is an interesting model to study gene expression/function in the context of the programmed cell death (PCD) in plant. To identify genes involved in autolytic cell death in bamboo (Bambusa arundinacea/Bambusa bambos Voss), a suppressive subtractive cDNA hybridization (SSH) was performed between cDNA isolated from control (healthy), as driver and test internodal tissue (45days after setting of seeds), as tester. In-silico data revealed that 82% of total ESTs (231) were non-significant (unidentified proteins) while remaining ESTs were classified as protein with known/predicted function/s. Among these, net distribution and differential expression patterns of 11 important B. arundinacea PCD specific ESTs were studied using RNA slot-blot, qRT-PCR and semi-quantitative RT. In-situ localization of mRNA-transcripts for selected bamboo PCD-specific ESTs namely V2Ba48 (Aldehyde dehydrogenase 2) and V2Ba19 (Glycogen phosphorylase) were detected using digoxigenin-labeled corresponding anti-sense RNA probes employing Confocal Laser Scanning Microscope (CLSM). Differential expression-kinetics of the aforementioned genes were confirmed during the progress of PCD after setting of seeds. Global appearance of V2Ba48, V2Ba19, V2Ba95 (Ubiquitin thioesterase) and V2Ba89 (Nebulin isoform 2) genes were identified in monocot (Oryza sativa) and dicots (Arabidopsis thaliana and Nicotiana tabacum). This is the first report on systematic analysis of genes involved in death of bamboo cells that may provide critical information regarding key metabolic/regulatory genes involved in plant PCD.

Incidence and genetic stability of Potato spindle tuber pospiviroid in potato in Turkey

The prevalence of Potato spindle tuber pospiviroid (PSTVd) infection in randomly selected potato tubers was determined via nonisotopic dot blot hybridization and reverse transcriptase polymerase chain reaction (RT-PCR). In January and February of 2010, 168 seedling tubers of Solanum tuberosum, representing 27 cultivars, were received from different seedling potato producers in Turkey. Digoxigenin-labeled RNA probes of PSTVd were synthesized from the cloned PCR products and applied in dot blot hybridization to detect viroids in RNA extracts isolated from dormant potato tubers. PSTVd was found in 7 samples and 6 cultivars (Innovator, Lady Jo, Russet Burbank, Agria, Provento and Konsül). Some RNA samples, although positive by RT-PCR test, did not give a hybridization signal by dot blot assay. The complete genome of a selected isolate (PSTVd-TR) was cloned and sequenced. Primary and secondary structure analysis showed that the RNA genome of the PSTVd-TR isolate (GenBank Accession No. HQ456944) differed from other compared isolates by only a few nucleotides. The highest identity (99%) was in a PSTVd isolate that was identified in Solanum spp. in Italy (Accession No. EF459700). The infectivity of PSTVd-TR isolate was shown 2 weeks after the mechanical inoculation of sap extracts onto seedlings of tomato cultivar Joker. The PSTVd infections were proven by RT-PCR assay in symptomless tomato seedlings.

First Report of Tomato chlorosis virus Infecting Tomato in Sudan.

In March 2011, interveinal yellowing and necrosis symptoms on middle and lower leaves were observed in tomato (Solanum lycopersicum L., cv. Castle Rock) plants grown in three adjacent greenhouses of the Agricultural Research Corporation at Wad Medani (Gezira State, Sudan). These symptoms resembled those caused by Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) (4) (genus Crinivirus, family Closteroviridae). Whitefly (Bemisia tabaci) infestation was also observed in these greenhouses. Total RNA was extracted by TRIzol Reagent (Invitrogen, Carlsbad, CA) from symptomatic leaves and analyzed by dot-blot hybridization with digoxigenin-labelled RNA probes to the coat protein (CP) gene of ToCV and to the minor coat protein (CPm) gene of TICV. Positive signal was obtained only with the ToCV probe. Reverse transcription (RT)-PCR reactions were performed with two pairs of primers specific for the detection of ToCV, MA380(+) (5'-GTGAGACCCCGATGACAGAT-3') and MA381(-) (5'-TACAGTTCCTTGCCCTCGTT-3'), specific to the CP gene (ToCV RNA 2) (3), and MA396(+) (5'-TGGTCGAACAGTTTGAGAGC-3') and MA397(-) (5'-TGAACTCGAATTGGGACAGA-3'), specific to the RNA-dependent RNA polymerase (RdRp) gene (ToCV RNA 1) (1). DNA fragments of the expected sizes (436 and 763 bp, respectively) were obtained, thus supporting the presence of ToCV in the symptomatic samples. Amplified DNA fragments were cloned in pGEM-T Easy vector (Promega, Madison, WI) and one clone per amplicon was sequenced (Macrogen Inc., Seoul, South Korea). The highest nucleotide sequence identity of the CP gene fragment obtained (GenBank Accession No. JN411685) was 99.2% related with North American ToCV isolates from Florida (DQ234674), Colorado (DQ234675), and Georgia (HQ879842), while the RdRp gene fragment (JN411686) was more closely related (99.0%) to the Spanish AT80/99 isolate (DQ983480). Although yellowing symptoms similar to those reported here have been observed sporadically during the last few years in open-field tomato crops in the state of Gezira, additional studies are needed to determine the prevalence and economic impact of ToCV infections in tomato cultivation in Sudan. To our knowledge, ToCV has been found in continental Africa only in Morocco and South Africa, in the Mediterranean climate areas in the northern and southern edges of the continent, respectively (2). The finding of ToCV infecting tomato in Sudan raises the question of whether this virus is emerging also in other tropical areas of the continent and illustrates the need to monitor whitefly-infested areas within Africa for the presence of ToCV.

187 DIFFERENTIAL EXPRESSIONS OF GROWTH AND DIFFERENTIATION FACTOR 9 AND BONE MORPHOGENETIC PROTEIN 15 GENES IN OVARIES OF THE CALF AND COW

It has been reported that prepubertal calf oocytes are less developmentally competent than those obtained from cows. The bone morphogenetic protein (BMP) family of proteins regulate folliculogenesis and the ovulation rate in mammals. Of the members of the BMP family, growth and differentiation factor 9 (GDF9) and BMP15 are oocyte-derived proteins that play critical roles in granulosa cell proliferation and differentiation. In the present study, we characterised the gene expression of bovine GDF9 and BMP15 in calf and adult cow ovaries. The ovaries obtained from 4 calves at 9 to 11 months old and 4 cows at 4 to 6 years old. For quantitative real-time RT-PCR (qPCR), cumulus–oocyte complexes (COC) and mural granulosa cells were collected by aspiration of follicles 2 to 5 mm in diameter from an ovary from each animal. Ovaries from the other side were used for in situ hybridization. The COC and mural granulosa cells were separated and cultured for 22 h according to the protocol for oocyte maturation. Total RNA was isolated from denuded oocytes, cumulus cells, and mural granulosa cells. Bovine glyceraldehyde-3-phosphate dehydrogenase was used to normalise qPCR efficiency. For in situ hybridization, the collected ovaries were immediately fixed with 4% formaldehyde-PBS and embedded in a paraffin block. In situ hybridization was carried out with digoxigenin-labelled RNA probes. We confirmed there was no contamination of oocytes in the collected cumulus and mural granulosa cells by determining the mRNA expression of germ cell–oocyte markers (ZAR1 and VASA). Two, 16, 7, and 10 COC were collected from the ovary on one side of each calf, and 14, 22, 29, and 33 COC were collected from an ovary of each adult cow. Two COC from the calves could not be used for qPCR analysis. Both GDF9 and BMP15 mRNA were detected in oocytes and cumulus cells at the end of maturation culture, whereas only GDF9 mRNA was detected in mural granulosa cells. Quantitative PCR detection revealed that BMP15 and GDF9 mRNA expression of the cumulus cells from adult ovaries was significantly greater than that from calf ovaries. The expression of GDF9 mRNA was significantly greater in calf oocytes than in oocytes from cows. However, BMP15 mRNA expression in the oocytes of calf and adult ovaries was not significantly different. In mural granulosa cells, the intensities of GDF9 mRNA expression were not significantly different between calves and cows. These qPCR results were also ascertained by in situ hybridization. In conclusion, we clarified that the characteristics of bovine GDF9 and BMP15 mRNA expression in oocytes and cumulus cells were different between calves and cows. Our results indicate the possibility that the calf oocytes were less developmentally competent because of excess GDF9 on the oocytes, deficiencies of GDF9 and BMP15 on the cumulus cells, or both.