Differentiation Of Dendritic Cells Research Articles

Mesenchymal Stem Cells from the Deciduous Tooth Pulp Lose their Ability to Suppress the Differentiation of Dendritic Cells during Long-Term Culturing.

A culture of cells expressing markers of mesenchymal stem cells (MSC) (CD73, CD90, CD44, CD29, and CD49b), but not hematopoietic cell markers, and capable of multilineage differentiation was isolated from the deciduous tooth pulp. Co-culturing with immature dendritic cells in the presence of LPS did not reveal an ability of the MSC to suppress the maturation of dendritic cells. On the contrary, co-culturing of MSC with monocytes in the presence of granulocyte-macrophage CSF and IL-4 led to complete suppression of monocyte differentiation into dendritic cells. However, long-term culturing of MSC from dental pulp showed that by the passage 11, they almost completely lose their suppressor ability. These results indicate that the immunological properties of MSC can change during culturing without changing their phenotypic markers. This should be taken into account when creating biomedical cell products.

Understanding Mechanisms and Key Factors Influencing Melanogenesis for the Management of Melasma: An Updated Review.

Melanocytes are highly specialized dendritic cells that deliver melanin to keratinocytes in melanosomes, which are subcellular organelles where melanin is produced and stored. Mammal's skin, hair, and eyes all contain the complex pigment melanin, which gives them color and ultraviolet protection. Melanins have the potential to be free radical sinks and are strong cation chelators. Amino acid tyrosine and its metabolite, dopa, are the precursors to complex metabolic processes that end with melanin production. Melanocytes generate different types and amounts of melanin, which is defined genetically and is impacted by several extrinsic and intrinsic factors such as hormone fluctuations, inflammation, age, and ultraviolet radiation exposure, leading to the stimulation of numerous melanogenesis pathways. Melasma, a common skin pigmentation condition, is associated with the overproduction of melanin and is characterized by brown to gray-brown and black spots that mostly affect the face. The present review addresses the regulatory mechanisms and signaling pathways involved in skin pigmentation with an emphasis on the altered melanogenesis that causes melasma and hyperpigmentation. The current study also illustrates the available treatment options with cellular and molecular mechanisms for the management of melasma. Understanding the mechanism of the pigmentation process may help researchers develop new therapeutic strategies and novel drugs for the management of melasma.

Abstract PO1-19-08: Phase I trial of pegylated liposomal doxorubicin chemotherapy in combination with CD40 agonist and Flt3 ligand in metastatic triple-negative breast cancer

Abstract Background: Only a subset of patients with metastatic triple-negative breast cancers (TNBC) demonstrate response to FDA approved PD-1 immune checkpoint blockade (ICB), and few have durable responses. Data suggests that breast cancers have defects in antigen presentation and that antigen presenting cells especially the cDC1 subtype of dendritic cells (DCs) are required for response to ICB. CD40 agonists activate antigen presenting cells including DCs and B cells and repolarize macrophages to an anti-tumor phenotype. Flt3 ligand is a growth factor that increases differentiation and expansion of DCs. We recently demonstrated in pre-clinical TNBC models that the combination of liposomal doxorubicin chemotherapy, a CD40 agonist, and a Flt3 ligand improves outcomes compared to alternate combinations. Methods: This is a single arm phase I pilot study of liposomal doxorubicin, CDX-1140 (CD40 agonist monoclonal antibody), and CDX-301 (recombinant Flt3 ligand) combination therapy in patients with metastatic or unresectable locally advanced metastatic TNBC. Patients will be randomized to 3 lead-in arms (triplet therapy, doublet immunotherapy only, or liposomal doxorubicin only) for one cycle prior to receiving triplet therapy with tissue biopsies done before and after the lead-in treatment. CDX-301 will be given for only two cycles; liposomal-doxorubicin and CDX-1140 will be continued until disease progression or clinically limiting toxicities. Primary endpoint is determination of a recommended phase II dose based on treatment-related adverse events and dose-limiting toxicities. Secondary endpoints include anti-tumor immune response after triplet therapy, after immunotherapy alone, and after liposomal doxorubicin alone; median progression-free survival, overall response rate, duration of response, and clinical benefit rate. Key eligibility criteria are unresectable stage III or stage IV TNBC (ER ≤10%, PR ≤10%, HER2/neu negative), 1st to 3rd line treatment for metastatic disease (1st line patients need to be PD-L1 negative by 22C3 assay), measurable disease by RECIST 1.1 criteria, consent for pre-treatment and on-treatment biopsies of amenable soft tissue tumor lesions, no prior treatment with an anti-CD40 antibody or a Flt3 ligand, no anthracycline treatment in the metastatic setting, no prior progression while on anthracycline-based therapy or within 6 months of completing neoadjuvant chemotherapy, and no history of non-infectious pneumonitis or current pneumonitis. This trial will enroll up to 45 patients across multiple sites (NCT05029999) and is currently open at University of Texas Southwestern Medical Center, Texas Oncology, University of Chicago, University of Texas San Antonio, Sarah Cannon Research Institute, and Johns Hopkins. Citation Format: Sangeetha Reddy, Joyce O'Shaughnessy, Navid Sadeghi, Samira Syed, Cesar Santa-Maria, Virginia Kaklamani, Nan Chen, Denise Yardley, Yisheng Fang, Isaac Chan, Nisha Unni, Sarah Kashanian, Namrata Peswani, Shahbano Shakeel, Meredith Carter, Kelly Kyle, Farjana Fattah, Chul Ahn, Ina Patel, Joshua Gruber, Dawn Klemow, Glenda Delgado, Nicole Sinclair, Michael Yellin, Heather McArthur, Rita Nanda, Suzanne Conzen, Carlos Arteaga. Phase I trial of pegylated liposomal doxorubicin chemotherapy in combination with CD40 agonist and Flt3 ligand in metastatic triple-negative breast cancer [abstract]. In: Proceedings of the 2023 San Antonio Breast Cancer Symposium; 2023 Dec 5-9; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2024;84(9 Suppl):Abstract nr PO1-19-08.

Lactate Dehydrogenase-Elevating Virus Infection Inhibits MOG Peptide Presentation by CD11b+CD11c+ Dendritic Cells in a Mouse Model of Multiple Sclerosis.

Infections may affect the course of autoimmune inflammatory diseases of the central nervous system (CNS), such as multiple sclerosis (MS). Infections with lactate dehydrogenase-elevating virus (LDV) protected mice from developing experimental autoimmune encephalomyelitis (EAE), a mouse counterpart of MS. Uninfected C57BL/6 mice immunized with the myelin oligodendrocyte glycoprotein peptide (MOG35-55) experienced paralysis and lost weight at a greater rate than mice who had previously been infected with LDV. LDV infection decreased the presentation of the MOG peptide by CD11b+CD11c+ dendritic cells (DC) to pathogenic T lymphocytes. When comparing non-infected mice to infected mice, the histopathological examination of the CNS showed more areas of demyelination and CD45+ and CD3+, but not Iba1+ cell infiltration. These results suggest that the protective effect of LDV infection against EAE development is mediated by a suppression of myelin antigen presentation by a specific DC subset to autoreactive T lymphocytes. Such a mechanism might contribute to the general suppressive effect of infections on autoimmune diseases known as the hygiene hypothesis.

The mitochondria-targeted antioxidant MitoQ ameliorates inorganic arsenic-induced DCs/Th1/Th2/Th17/Treg differentiation partially by activating PINK1-mediated mitophagy in murine liver

Inorganic arsenic is a well-established environmental toxicant linked to acute liver injury, fibrosis, and cancer. While oxidative stress, pyroptosis, and ferroptosis are known contributors, the role of PTEN-induced kinase 1 (PINK1)-mediated mitophagy in arsenic-induced hepatic immunotoxicity remains underexplored. Our study revealed that acute arsenic exposure prompts differentiation of hepatic dendritic cells (DCs) and T helper (Th) 1, Th2, Th17, and regulatory T (Treg) cells, alongside increased transcription factors and cytokines. Inorganic arsenic triggered liver redox imbalance, leading to elevated alanine transaminase (ALT), hydrogen peroxide (H2O2), malondialdehyde (MDA), and activation of nuclear factor erythroid 2-related factor (Nrf2)/heme oxygenase-1 (HO-1) pathway. PINK1-mediated mitophagy was initiated, and its inhibition exacerbates H2O2 accumulation while promoting DCs/Th1/Th2/Treg differentiation in the liver of arsenic-exposed mice. Mitoquinone (MitoQ) pretreatment relieved arsenic-induced acute liver injury and immune imbalance by activating Nrf2/HO-1 and PINK1-mediated mitophagy. To our knowledge, this is the first report identifying PINK1-mediated mitophagy as a protective factor against inorganic arsenic-induced hepatic DCs/Th1/Th2 differentiation. This study has provided new insights on the immunotoxicity of inorganic arsenic and established a foundation for exploring preventive and therapeutic strategies targeting PINK1-mediated mitophagy in acute liver injury. Consequently, the application of mitochondrial antioxidant MitoQ may offer a promising treatment for the metalloid-induced acute liver injury.

Differential Response of Human Dendritic Cells upon Stimulation with Encapsulated or Non-Encapsulated Isogenic Strains of Porphyromonas gingivalis.

During periodontitis, the extracellular capsule of Porphyromonas gingivalis favors alveolar bone loss by inducing Th1 and Th17 patterns of lymphocyte response in the infected periodontium. Dendritic cells recognize bacterial antigens and present them to T lymphocytes, defining their activation and polarization. Thus, dendritic cells could be involved in the Th1 and Th17 response induced against the P. gingivalis capsule. Herein, monocyte-derived dendritic cells were obtained from healthy individuals and then stimulated with different encapsulated strains of P. gingivalis or two non-encapsulated isogenic mutants. Dendritic cell differentiation and maturation were analyzed by flow cytometry. The mRNA expression levels for distinct Th1-, Th17-, or T-regulatory-related cytokines and transcription factors, as well as TLR2 and TLR4, were assessed by qPCR. In addition, the production of IL-1β, IL-6, IL-23, and TNF-α was analyzed by ELISA. The encapsulated strains and non-encapsulated mutants of P. gingivalis induced dendritic cell maturation to a similar extent; however, the pattern of dendritic cell response was different. In particular, the encapsulated strains of P. gingivalis induced higher expression of IRF4 and NOTCH2 and production of IL-1β, IL-6, IL-23, and TNF-α compared with the non-encapsulated mutants, and thus, they showed an increased capacity to trigger Th1 and Th17-type responses in human dendritic cells.

CD14+ Dendritic-Shaped Cells Functioning as Dendritic Cells in Rheumatoid Arthritis Synovial Tissues.

We previously reported that CD14+ dendritic-shaped cells exhibit a dendritic morphology, engage in pseudo-emperipolesis with lymphocytes, and express CD90 in the perivascular areas of rheumatoid arthritis (RA) synovial tissues. However, it remains unclear whether these CD14highCD90intermediate(int) cells function as dendritic cells. In this study, we investigated the dendritic cell-differentiation potential of CD14highCD90int cells. The localization and number of CD14highCD90int cells in RA synovial tissues and peripheral blood were examined. The dendritic cell-differentiation potential of CD14highCD90int cells was examined by measuring interleukin-6 and tumor necrosis factor-α levels in the supernatant and CD83 and human leukocyte antigen (HLA)-DR expression in the cells after induction of dendritic cell differentiation. Synovial cells were co-cultured with lymphocytes, and the activation of these cells was examined. CD14highCD90int cells were abundant in RA synovial tissues, including the sublining layer and the pannus areas. Patients with untreated and active RA had significantly higher percentages of CD14highCD90int cells in the peripheral blood and synovial tissues. In RA synovial cells, inflammatory cytokine levels increased with dendritic cell-differentiation culture, but CD83 and HLA-DR expression were significantly increased in the CD14highCD90int cell group. When co-cultured with lymphocytes, cell numbers and inflammatory cytokine levels significantly increased in both groups of synovial cells after dendritic cell induction. CD14+ cells migrate and spread from the circulating blood to RA synovial tissues while expressing CD90, and CD14highCD90int cells in contact with lymphocytes differentiate into HLA-DR+ dendritic cells, which contribute to chronic inflammation in RA.

Genome-wide screening identifies Trim33 as an essential regulator of dendritic cell differentiation.

The development of dendritic cells (DCs), including antigen-presenting conventional DCs (cDCs) and cytokine-producing plasmacytoid DCs (pDCs), is controlled by the growth factor Flt3 ligand (Flt3L) and its receptor Flt3. We genetically dissected Flt3L-driven DC differentiation using CRISPR-Cas9-based screening. Genome-wide screening identified multiple regulators of DC differentiation including subunits of TSC and GATOR1 complexes, which restricted progenitor growth but enabled DC differentiation by inhibiting mTOR signaling. An orthogonal screen identified the transcriptional repressor Trim33 (TIF-1γ) as a regulator of DC differentiation. Conditional targeting in vivo revealed an essential role of Trim33 in the development of all DCs, but not of monocytes or granulocytes. In particular, deletion of Trim33 caused rapid loss of DC progenitors, pDCs, and the cross-presenting cDC1 subset. Trim33-deficient Flt3+ progenitors up-regulated pro-inflammatory and macrophage-specific genes but failed to induce the DC differentiation program. Collectively, these data elucidate mechanisms that control Flt3L-driven differentiation of the entire DC lineage and identify Trim33 as its essential regulator.

Small Spleen Peptides (SSPs) Shape Dendritic Cell Differentiation through Modulation of Extracellular ATP Synthesis Profile.

Restoring peripheral immune tolerance is crucial for addressing autoimmune diseases. An ancient mechanism in maintaining the balance between inflammation and tolerance is the ratio of extracellular ATP (exATP) and adenosine. Our previous research demonstrated the effectiveness of small spleen peptides (SSPs) in inhibiting psoriatic arthritis progression, even in the presence of the pro-inflammatory cytokine TNFα, by transforming dendritic cells (DCs) into tolerogenic cells and fostering regulatory Foxp3+ Treg cells. Here, we identified thymosins as the primary constituents of SSPs, but recombinant thymosin peptides were less efficient in inhibiting arthritis than SSPs. Since Tβ4 is an ecto-ATPase-binding protein, we hypothesized that SSPs regulate exATP profiles. Real-time investigation of exATP levels in DCs revealed that tolerogenic stimulation led to robust de novo exATP synthesis followed by significant degradation, while immunogenic stimulation resulted in a less pronounced increase in exATP and less effective degradation. These contrasting exATP profiles were crucial in determining whether DCs entered an inflammatory or tolerogenic state, highlighting the significance of SSPs as natural regulators of peripheral immunological tolerance, with potential therapeutic benefits for autoimmune diseases. Finally, we demonstrated that the tolerogenic phenotype of SSPs is mainly influenced by adenosine receptors, and in vivo administration of SSPs inhibits psoriatic skin inflammation.

FcRn regulates antigen presentation in dendritic cells downstream of DEC205-targeted vaccines

Dendritic cell (DC)-targeted vaccination is a new mode of antigen delivery that relies on the use of monoclonal antibodies (mAb) to target antigen to specific DC subsets. The neonatal Fc receptor (FcRn) is a non-classical Fc receptor that binds to immunoglobulin G (IgG) in acidified endosomes and controls its intracellular transport and recycling. FcRn is known to participate in the antigen presentation of immune complexes, however its contribution to DC-targeted vaccination has not previously been examined. Here we have investigated the role of FcRn in antigen presentation using antigen conjugated to IgG mAb which target specific DC receptors, including DEC205 and Clec9A expressed by the conventional DC 1 (cDC1) subset. We show that FcRn is expressed at high levels by cDC1, both at steady-state and following activation and plays a significant role in MHC I cross-presentation and MHC II presentation of antigens that are targeted to cDC1 via mAb specific for DEC205. This effect of FcRn is intrinsic to cDC1 and FcRn impacts the efficacy of anti-DEC205-mediated vaccination against B cell lymphoma. In contrast, FcRn does not impact presentation of antigens targeted to Clec9A and does not regulate presentation of cell-associated antigen. These data highlight a new and unique role of FcRn in controlling the immunogenicity of anti-DEC205-based vaccination, with consequences for exploiting this pathway to improve DC-targeted vaccine outcomes.

The functional role of L-fucose on dendritic cell function and polarization.

Despite significant advances in the development and refinement of immunotherapies administered to combat cancer over the past decades, a number of barriers continue to limit their efficacy. One significant clinical barrier is the inability to mount initial immune responses towards the tumor. As dendritic cells are central initiators of immune responses in the body, the elucidation of mechanisms that can be therapeutically leveraged to enhance their functions to drive anti-tumor immune responses is urgently needed. Here, we report that the dietary sugar L-fucose can be used to enhance the immunostimulatory activity of dendritic cells (DCs). L-fucose polarizes immature myeloid cells towards specific DC subsets, specifically cDC1 and moDC subsets. In vitro, L-fucose treatment enhances antigen uptake and processing of DCs. Furthermore, our data suggests that L-fucose-treated DCs increase stimulation of T cell populations. Consistent with our functional assays, single-cell RNA sequencing of intratumoral DCs from melanoma- and breast tumor-bearing mice confirmed transcriptional regulation and antigen processing as pathways that are significantly altered by dietary L-fucose. Together, this study provides the first evidence of the ability of L-fucose to bolster DC functionality and provides rational to further investigate how L-fucose can be used to leverage DC function in order to enhance current immunotherapy.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Abstract 2918: Potential for a novel therapeutic target: Effects of lactate & lactylation in expression of key regulatory cancer proteins

Abstract The purpose of our study is to investigate the immunologic, metastatic, and gene regulation effects of lactate in the context of cancer in normoxic and hypoxic conditions to identify novel biomarkers and potential therapeutic targets. We aim to modify the in-vitro cancer microenvironment to show how lactate and lactylation can be exploited using existing cancer treatments. While hyperlactatemia is defined as lactate levels between 2 mmol/L and 4 mmol/L (Foucher et al 2023), tumor biopsies have demonstrated extracellular concentrations as high as 40 mM (Pérez-Tomás et al 2020). Through CTG viability assays we identified lactate concentrations that PANC1 cells can survive, which are in agreement with the in-vivo findings of Brizel et al (2001). We observed pancreatic cancer cells achieving over 50% viability for 5 days at 50 mM lactate concentrations while at 30 mM on day 5 they proliferated past their initial plating numbers. Furthermore, Brizel et al (2001) found that patients with high tumor lactate concentrations had a significantly higher incidence of metastatic relapse. Through our scratch assay, we show qualitative evidence of increased mobility and inferred migration potential of PANC1 at 7.5mM [lactate] compared to the absence of lactate. We have also observed increased migration at higher lactate concentrations for which we are pursuing quantitative measurements to evaluate significance. Migration experiments will be followed by the investigation of gene regulation (eg. mRNA seq, lactylation profile) involved in the observed increased mobility. Lactate has been shown to affect immune regulation, namely suppression of iNKT (Fu et al, 2020), macrophages (Yang et al, 2020), dendritic cell differentiation and antigen recognition/presentation (Wang et al, 2022), however not much is known about its effect on NK cells and their cytokine expression. Through NK92MI/PANC1 cocultures we show the effects of lactate concentration on the killing ability of NK cells (in the works). And plan on investigating the cytokine profile leading to the phenotypic killing differences. Lastly, via lactate-titrated incubation of PANC1 cells in normoxia we have demonstrated a positive correlation of HIF1a expression, pan-lactyllysine lactylation, and microenvironment lactate concentration. We speculate HIF1a inhibition post-lactate-sensitization may induce cancer killing and we will investigate this theory in normoxia and hypoxia using existing treatment options. Citation Format: Christos P. Costeas, Connor Purcell, Wafik S. El-Deiry. Potential for a novel therapeutic target: Effects of lactate & lactylation in expression of key regulatory cancer proteins [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2918.

Abstract 1503: Melanoma-derived lymphatic extracellular vesicles suppress dendritic cell differentiation and maturation in the sentinel lymph node

Abstract Spread to regional lymph nodes is the most common site of metastasis from melanoma and almost all solid tumors. Lymphatic metastases begin in the first lymph nodes draining from the primary tumor, i.e., the sentinel lymph nodes (SLN), preceded by the development of the premetastatic niche (PMN) initiated by primary cutaneous melanoma. Melanoma mediators are known to play a critical role in developing the PMN through the immune subversion in SLN. The DCs are a vital component of LN immunity that directly relates to eliciting T-cell functions. Our multiplex immunofluorescence (MxIF) analysis of SLNs indicates significantly decreased levels of DCs and cytotoxic-T cells in both core and interface areas of tumors in recurred patients treated with immunotherapy compared to non-recurred melanoma patients. The goal of this study is to determine whether the lymphatic extracellular vesicles (L-EVs) of melanoma patients regulate DC tolerization in SLN in order to stimulate the development of PMN. To identify whether L-EVs stimulate DC suppression, we extracted L-EVs from the lymphatic fluid of patients with melanoma downstream of primary cutaneous melanomas, compared it with controls (non-malignant post-operative fluid collected from the lymph node dissection field, and evaluated their effect on DC maturation by challenging these L-EVs in monocytic (CD14+) and hematopoietic stem cells (CD34+) cells. We found that L-EVs derived from melanoma patients suppress differentiation of CD11c+HLA-DR+ DCs and their maturation (defined by CD83 and CD86) compared to control L-EVs in CD14+ based DC maturation assay. We also found a reduction of conventional type 1 DC (cDC1) in CD34+-based DC maturation assay those challenged with patients’ L-EVs compared to control. To understand the mechanism of DC suppression in patients' L-EVs, we also conducted a total RNA sequencing analysis of subsets of DCs from maturation experiments to evaluate differently regulated transcriptomic profiles. The gene ontology analysis indicates that patient-derived L-EVs interfere with tRNA processing, oncostatin M & IL-10 signaling, and other immunoregulatory pathways to alter the hematopoietic cell lineage pathways in the DC maturation. Furthermore, the proteomic analysis of L-EVs also indicated several differentially regulated cargo-identified proteins in patient L-EVs, which are associated with immunomodulation, including regulation of DC function compared to control L-EVs. In conclusion, our study revealed that the patient's L-EVs carry differential proteomic cargoes secreted by cutaneous melanoma, which may be involved in regulating DC differentiation and maturation to diminish their functions and support the developing PMN in SLN. Citation Format: Shankar Suman, Wendy K. Nevala, James W. Jakub, Ray Guo, Alexey A. Leontovich, Raymond M. Moore, Chathu L. Atherton, Liyi Geng, Jeffrey E. Johnson, Sarah A. McLaughlin, Svetomir N. Markovic. Melanoma-derived lymphatic extracellular vesicles suppress dendritic cell differentiation and maturation in the sentinel lymph node [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1503.

Development of Cell Technologies Based on Dendritic Cells for Immunotherapy of Oncological Diseases.

Immunotherapy using dendritic cell-based vaccination is a natural approach using the capabilities and functions inherent in the patient's immune system to eliminate tumor cells. The development of dendritic cell-based cell technologies evolved as the disorders of dendritic cell differentiation and function in cancer were studied; some of these functions are antigen presentation, priming of cytotoxic T-lymphocytes and induction of antigen-specific immune responses. At the initial stage of technology development, it was necessary to develop protocols for the in vitro generation of functionally mature dendritic cells that were capable of capturing tumor antigens and processing and presenting them in complex with MHC to T-lymphocytes. To achieve this, various forms of tumor-associated antigen delivery systems were tested, including lysates, tumor cell proteins (peptides), and DNA and RNA constructs, and it was shown that the use of DNA and RNA constructs was the most effective method, as it made it possible not only to deliver the most immunogenic epitopes of tumor-associated antigens to dendritic cells, but also to enhance their ability to induce antigen-specific cytotoxic T-lymphocytes. Currently, cell therapy based on dendritic cells is a modern basis for antigen-specific immunotherapy of cancer due to the simplicity of creating DNA and RNA constructs encoding information about both target tumor antigens and regulatory molecules. The potential development of cell technologies based on dendritic cells aims to obtain antigen-specific cytotoxic T-lymphocytes induced by dendritic cells, study their functional activity and develop cell-based therapy.

Modern Methods of Obtaining Immune Dendritic Cells With Anti-Tumor Potential

Modern Methods of Obtaining Immune Dendritic Cells With Anti-Tumor Potential

Evaluation of different types of adjuvants in a malaria transmission-blocking vaccine

Adjuvants are critical components for vaccines, which enhance the strength and longevity of the antibody response and influence the types of immune response. Limited research has been conducted on the immunogenicity and protective efficacy of various adjuvants in malaria transmission-blocking vaccines (TBVs). In this study, we formulated a promising TBV candidate antigen, the P. berghei ookinete surface antigen PSOP25, with different types of adjuvants, including the TLR4 agonist monophosphoryl lipid A (MPLA), the TLR9 agonist cytosine phosphoguanosine oligodeoxynucleotides (CpG ODN 1826) (CpG), a saponin adjuvant QS-21, aluminum hydroxide (Alum), and two combination adjuvants MPLA + QS-21 and QS-21 + CpG. We demonstrated that adjuvanted vaccines results in elevated elicited antibody levels, increased proliferation of plasma cells, and efficient formation of germinal centers (GCs), leading to enhanced long-term protective immune responses. Furthermore, CpG group exhibited the most potent inhibition of ookinete formation and transmission-blocking activity. We found that the rPSOP25 with CpG adjuvant was more effective than MPLA, QS-21, MPLA + QS-21, QS-21 + CpG adjuvants in dendritic cells (DCs) activation and differentiation. Additionally, the CpG adjuvant elicited more rubust immune memory response than Alum adjuvant. CpG and QS-21 adjuvants could activate the Th1 response and promote the secretion of IFN-γ and TNF-α. PSOP25 induced a higher number of Tfh cells in splenocytes when combined with MPLA, CpG, and QS-21 + CpG; and there was no increase in these cell populations when PSOP25 was administered with Alum. In conclusion, CpG may confer enhanced efficacy for the rPSOP25 vaccine, as evidenced by the ability of the elicited antisera to induce protective immune responses and improved transmission-blocking activity.

Retinoic acid-loaded liposomes induce human mucosal CD103+ dendritic cells that inhibit Th17 cells and drive regulatory T-cell development in vitro.

The active vitamin A metabolite, all-trans-retinoic acid (RA), primes precursor dendritic cells (DCs) into a mucosal phenotype with tolerogenic properties characterized by the expression of integrin CD103. CD103+ DCs can counteract pathogenic Th1 and Th17 in inflammatory bowel disease (IBD) or celiac disease (CD). Tolerogenic manipulation of DCs using nanoparticles carrying tolerogenic adjuvants and disease-specific antigens is a valuable treatment strategy to induce antigen-specific mucosal tolerance in vivo. Here, we investigated the effects of RA-loaded liposomes on human DC phenotype and function, including DC-driven T-cell development, both during the generation of monocyte-derived DCs (moDCs) as well as by priming immature moDCs. RA liposomes drove CD103+ DC differentiation as well as ALDH1A2 expression in DCs. Neutrophil-dependent Th17 cell development was reduced by RA-liposome-differentiated and RA-liposome-primed DCs. Moreover, RA liposome treatment shifted T-cell development toward a Th2 cell profile. Importantly, RA liposomes induced the development of IL-10-producing and FoxP3+ regulatory T cells (Tregs) of various Treg subsets, including ICOS+ Tregs, that were potent inhibitors of bystander memory T-cell proliferation. Taken together, RA-loaded liposomes could be a novel treatment avenue for IBD or CD patients.

Oncolytic bacteria VNP20009 expressing IFNβ inhibits melanoma progression by remodeling the tumor microenvironment

In the tumor microenvironment (TME), tumor-associated NEs (TANs) have the potential to be protumorigenic or antitumorigenic within the TME in response to environmental cues. The diversity and plasticity of NEs (NEs) underlie the dual potential of TANs in the TME. Here, we utilized the tumor-targeting bacterium VNP20009 (VNP) to carry a plasmid expressed IFNβ (VNP-IFNβ), which can deliver IFNβ and remodel TANs to an antitumorigenic phenotype, and performed preclinical evaluations in the B16F10 lung metastasis model and the B16F10 subcutaneous xenograft model. Compared with VNP, VNP-IFNβ recruited more NEs and macrophages (Mφs) with antitumor phenotypes in lung metastases and activated dendritic cells (DCs) differentiation, which activated antitumor immune responses of CD4+ Tcells, and ultimately inhibited melanoma progression. This study enriches the bacterial-mediated tumor therapy by using tumor-targeting bacteria to deliver IFNβ to the tumor site and inhibit melanoma growth and metastasis by remodeling the tumor immune microenvironment.

A Simple and Rapid Protocol for the Isolation of Murine Bone Marrow Suitable for the Differentiation of Dendritic Cells.

The generation of bone-marrow-derived dendritic cells is a widely used approach in immunological research to study antigen processing and presentation, as well as T-cell activation responses. However, the initial step of isolating the bone marrow can be time-consuming, especially when larger numbers of precursor cells are required. Here, we assessed whether an accelerated bone marrow isolation method using centrifugation is suitable for the differentiation of FMS-like tyrosine kinase 3 ligand-driven dendritic cells. Compared to the conventional flushing method, the centrifugation-based isolation method resulted in a similar bone marrow cell yield on Day 0, increased cell numbers by Day 8, similar proportions of dendritic cell subsets, and consequently a higher number of type 1 conventional dendritic cells (cDC1) from the culture. Although the primary purpose of this method of optimization was to improve experimental efficiency and increase the output of cDC1s, the protocol is also compatible with the differentiation of other dendritic cell subsets such as cDC2 and plasmacytoid dendritic cells, with an improved output cell count and a consistent phenotype.