Different Species Of Trichoderma Research Articles

DETERMINATION OF ANTIBIOSIS OF Trichoderma species AGAINST FUNGI ASSOCIATED WITH CORN (Zea Mays L.) SPOILAGE

Biological control of food spoilage microorganisms is gaining more attention because it is a safe and cheap technique. This study evaluated the antagonistic potential of Trichoderma species against corn spoilage fungi by plate co-culture technique for seven days. Fungal isolates from corn spoilage were examined morphologically and microscopically. The percentage growth inhibition (PGI) of Trichoderma species against the corn spoilage fungi were A. flavus (15%), A. niger (14%), A. terreus (62.9%), Fusarium spp. (5.9%), Nigrospora spp. (61.4%) and Penicillium spp. (62.5%). The result obtained in this study revealed that Trichoderma spp. had significant inhibitory effects against the growth of fungal pathogens associated with corn spoilage. Therefore, it could be explored for control of post-harvest fungal spoilage of corn. It is recommended that in order to compare the antagonistic strength of the Trichoderma species, different species of Trichoderma should be tested against the same spoilage fungi.

In Vitro Study of the Compatibility of Four Species of Trichoderma with Three Fungicides and Their Antagonistic Activity against Fusarium solani

Strawberry wilt is a disease caused by Fusarium solani, which it provokes the death of the plant. Farmers mainly use chemical methods for its control, which has a negative impact on the environment and human health. Given the growing demand for organic agricultural products, compatible alternatives must be sought for disease management that can reduce the doses of fungicides. A combination of pesticides and biological control agents could be an alternative for the management of F. solani. Consequently, investigations on fungicide compatibility and synergistic effects are recommended in relation to the biological control of strawberry wilt. In this study, potential antagonism was calculated according to the class of mycoparasitism and the percentage inhibition of radial growth in order to later design a compatibility model of the different species of Trichoderma with three protective fungicides at different concentrations. The potential antagonism showed that Trichoderma asperellum presented high compatibility with the fungicides Captan and Mancozeb added in concentrations of 450, 900, and 1350 mg L−1. The use of antagonistic strains together with the fungicide Chlorothalonil in its three concentrations showed a negative effect on the growth of Trichoderma species, which caused low and null compatibility against the MA-FC120 strain of F. solani in vitro.

The effect of Trichoderma spp. isolates on some morphological traits of canola inoculated with Sclerotinia sclerotiorum and evaluation of their efficacy in biological control of pathogen

In this study, to evaluate the effect of isolates of different species of Trichoderma on some morphological traits of canola and to obtain suitable antagonist isolates for biological control of canola crown rot disease, the effect of 71 Trichoderma isolates on Sclerotinia sclerotiorum was investigated in the laboratory by volatile compound and non-volatile metabolite methods. In the volatile metabolite assay, the isolate ARCTr281 ( T. harzianum ) was more efficient than the other isolates with a 20% reduction in hyphae density and non-formation of S. sclerotiorum sclerotia. In the non-volatile metabolite assay, ARCTr272 ( T. harzianum ) with 73.7 and 62.22 at 25 and 15% concentrations and T. viride isolate ARCTr432 (20.37%) at 5% concentration were successful in inhibiting S. sclerotiorum mycelia growth. Six superior isolates were selected for greenhouse studies. Using two-stage Trichoderma isolates in the greenhouse, height, fresh and dry weight of shoots and roots, number of pods, pod length, pod diameter and number of seeds per pod in the presence of pathogen all increased. The results of principal component analysis showed that the first two components accounted for 86% of the total variation among the data. The results showed that for the first component, the traits of total grain weight, pod diameter, branch number, shoot dry weight and fresh weight of root were the most important traits in grouping the isolates. In the trait second component, plant height and number of seeds per pod were important traits. Mean comparisons were performed using an LSD test and showed significant differences between the fungi used in non-volatile metabolite and greenhouse studies. According to the results of this research, the fungal isolates of T. harzianum (ARCTr281, ARCTr272 and ARCTr418) were the most effective antagonists in improving plant traits and controlling canola rot disease in both the laboratory and the greenhouse.

Effect of water content on conidia of Trichoderma spp., indole acetic acid content, electrical conductivity, and pH

Abstract. Purwanto B, Sumadi, Nuraini A, Setiawati MR. 2022. Effect of water content on conidia of Trichoderma spp., indole acetic acid content, electrical conductivity, and pH. Biodiversitas 23: 2553-2560. Trichoderma sp. is a soil-borne saprophytic fungus that can increase plant resistance to combat drought stress. However, some species are unable to survive in a low water environment. Therefore, this research aimed to determine the effect of water content on different species of Trichoderma with respect to total conidial growth, IAA content, electrical conductivity (EC), and the media’s pH. A factorial Completely Randomized Design (CRD) with 2 factors, namely the water content of the media consisting of 3 levels (5%, 25%, and 50%) and the inoculation of Trichoderma spp. which includes Trichoderma harzianum, Trichoderma asperellum, and Trichoderma viride. Furthermore, an experimental method was adopted by analyzing the total conidial growth, indole acetic acid content (IAA), electrical conductivity (EC), and acidity (pH) of the media. Incubation was carried out for 14 days, data were analyzed using one way ANOVA, and Duncan's Multiple Distance Test was applied to determine the parameters that have a significant effect. The results showed that the total conidia of T. harzianum at the lowest water content (5% of the dry weight of the media) showed an increase from 7th to 14th days after inoculation (DAI), the highest was 23.6%, followed by T. asperellum (12.6%) and T. viride (10.7%). Similarly, the total conidia of Trichoderma spp. positively correlated with the levels of IAA, EC, and pH of the media. This indicates that an increase in total conidia is followed by an increase in the IAA content, EC, and pH. The highest total of T. harzianum conidial growth at the lowest water content indicated that it had better resistance to drought stress than T. asperellum and T. viride.

Trichoderma asperellum as a preventive and curative agent to control Fusarium wilt in Stevia rebaudiana

Stevia has been introduced in many countries for the production of sugar-free sweeteners. Concurrently, several emerging pathogens have been described in this plant host. One of the latest has been Fusarium oxysporum, a well-known soil-borne pathogen causing vascular wilt in many plants. Classical methods to control Fusarium wilt are being questioned, and biocontrol agents are gaining importance as part of integrated approaches to manage the disease. Different species of Trichoderma have been described as optimal candidates to control F. oxysporum. However, their effectiveness is generally reported in annual plants and efficacy depends on the application protocol. We conducted an experiment to assess the preventive or curative potential of the rhizospheric T. asperellum UDEAGIEM-H01 strain against F. oxysporum on rooted cuttings of S. rebaudiana. After 33 days, F. oxysporum-infected stevia seedlings were severely affected (90% of disease incidence). Contrastingly, only 10% of the T. asperellum pre-treated plants and 70% of the post-treated showed Fusarium wilt symptoms. Dual confrontation assays proved the potential antagonistic effect of T. asperellum against F. oxysporum and five additional soil-borne pathogens affecting S. rebaudiana. Further in vitro tests revealed that this new strain of T. asperellum produces phytohormones (salicylic and jasmonic acid), and the secretion of cell-wall degrading enzymes (chitinases and cellulases); this ability could be related to its antagonistic and mycoparasitic activity. The present work concluded that T. asperellum UDEAGIEM-H01 has a high ability, mainly as a preventive agent, to control F. oxysporum in stevia plants showing further antagonistic effects and mycoparasitism on other fungal pathogens.

Trichoderma en la Argentina: Estado del arte

Las metodologias que se aplican para manejar los sistemas agricolas y agroforestales tienen efectos notables en la produccion de alimentos y en la conservacion de la biodiversidad. Las enfermedades que causan los hongos fitopatogenos son uno de los problemas criticos en la agricultura argentina. A partir de la necesidad de encontrar mecanismos que eleven la productividad del campo, en los ultimos anos se intensifico la busqueda de estrategias de control de enfermedades agricolas que sean alternativas al control quimico, buscando, ademas, disminuir los riesgos ambientales y sanitarios derivados de este. El hongo Trichoderma es uno de los agentes que mas se usan en los programas de control biologico como reguladores de hongos fitopatogenos. Esta revision tiene como objetivo realizar una compilacion de toda la informacion disponible respecto al estado del arte de Trichoderma como controlador biologico en la Argentina, con el fin de referenciar diferentes instituciones del pais que centralizan a este hongo en sus investigaciones. Cerca de 70 grupos de universidades e institutos de investigacion describieron aproximadamente diez especies diferentes de Trichoderma con capacidad antagonista, se estudiaron alrededor de 35 cultivos y 40 patogenos. La especie de Trichoderma mas utilizada como agente de control biologico es Trichoderma harzianum, seguida por Trichoderma koningii y Trichoderma viride. Actualmente, en el mercado argentino existen cerca de 14 bioproductos cuyo principio activo son cepas de Trichoderma. Las crecientes iniciativas de las instituciones nacionales sobre estos estudios son basicas para el desarrollo de tecnologias innovadoras y para lograr una agricultura mas productiva y ambientalmente sostenible en el pais.https://doi.org/10.25260/EA.20.30.1.0.945

Effect of Trichoderma spp. on Fusarium wilt disease of tomato.

Seven isolates of Trichoderma spp. (T1 to T7) from Egypt were evaluated in vitroby bioassay for their potential to antagonize Fusarium oxysporum f.sp. lycopersici (FOL, the causal pathogen of tomato wilt disease). The highest percentage of inhibition against the tested pathogenic isolate were obtained with Trichoderma isolate (T7) followed by Trichoderma isolate (T3). In greenhouse experiments, the application of the highly antagonistic isolates of Trichoderma spp. (T3 and T7) led to a significant decrease of disease severity compared to the untreated control treatment. The lowest severity was achieved with the T3 isolate (24.8%) followed by isolate T7 (34.6%) compared with the other tested isolates. To understand the ability of Trichoderma isolates to protect against wilt disease, itsinduced systemic resistancein tomato plants has been studied. The expression of a defense-related gene (β-1,3-glucanase gene) was assessed by real-time RT-PCR in tomato plants to test the accumulation kinetics of transcripts encoding PR proteins in the roots of tomato in control (only with the pathogen), T3&FOL, and T7&FOL treatments. The highest degree of gene expression was found in tomato plants which were treated with T3&FOL compared with control (pathogen only). Two species of antagonistic Trichoderma (T3& T7) were characterized based on molecular tools using internal transcribed spacers (ITS1 and ITS4). The results of genetic characterization identified two different species of Trichoderma (T. atroviride and T. longibrachiatum).

Combination of Trichoderma viride and Pseudomonas fluorescens for the enhanced control of Fusarium wilt disease caused by Fusarium oxysporum infecting Arachis hypogaea L.

Fusarium wilt caused by Fusarium oxysporum is a devastating disease of peanut. The fungus causes severe yield loss in groundnut. Combinations of biocontrol agents that are compatible with each other is a viable approach to control the plant disease. The study was conducted to determine the beneficiary aspects of combining different species of Trichoderma and Pseudomonasfluorescens i.e Trichoderma viride+Pseudomonas fluorescens (Tv+Pf), Trichoderma harzianum+Pseudomonas fluorescens (Th+Pf) and Trichoderma viride +Trichoderma harzianum (Tv+Th) to control the Fusarium wilt in biochemicalparameters such as DNA, RNA, Amino nitrogen, phenols, dihydroxy and proline contents of Arachis hypogaea.L. Among the three combinations tested, Trichoderma viride + Pseudomonas fluorescens (1+2%) sprayed leaves provided greater suppression of Fusariumoxysporum by increasing the levels of DNA,RNA,Amino nitrogen contents resulting in the suppression of Fusarium wilt disease of Arachis hypogaea L.Maximum reduction of DNA, RNA, Amino nitrogen was observed in the infected Fusariumoxysporumleaves Phenol, Dihydroxy phenols and proline contents increase sharply in the treated plants treated with (Tv+Pf) as compared to the control plants. At the same time the other two combinations resulted in enhanced control in comparison with individual ones. This present study indicates that specific combination of Trichoderma viride and Pseudomonas fluorescens could have the greater efficacy in the inhibition of pathogen in the biocontrol of Fusarium wilt disease as compared with individual strains.

Molecular characterisation of Trichoderma species using SRAP markers

Trichoderma are commonly used as bio control agents in various agro ecosystems. They are known to produce a variety of compounds that induce resistance responses in plants. Among different species of Trichoderma, T. harzianum, T. viride, T. koningii and T. hamatum are commercially used as bio control agents. In the present study, four commercially important species of Trichoderma isolated from coffee ecosystem were screened with sequence related amplified polymorphism (SRAP) markers. Among 48 SRAP primer pairs tested, 29 primers were polymorphic and generated 316 distinct scorable fragments. Out of 347 amplified fragments, 177 fragments were found polymorphic with an average of 6.10 fragments per primer combination. The average polymorphism information content (PIC) and resolving power (Rp) of the 29 polymorphic SRAP primer pair were 0.42 and 14.62, respectively. The UPGMA dendrogram clearly divided Trichoderma species into two broad clusters. The highest homology (83.0%) was observed between T. viride and T. Harzianum and the lowest homology (74.0%) was observed between T. Harzianum and T. konangii. Further, among 29 polymorphic SRAP markers screened, four primer pairs (ME1-EM3, ME1-EM20, ME1-EM22 and ME2-EM4) produced unique fragments specific to each species. These markers can be useful in easy and rapid identification of the species.

Combinatorial efficacy of Trichoderma spp. and Pseudomonas fluorescens to enhance suppression of cell wall degrading enzymes produced by Fusarium wilt of Arachis hypogaea.L

Fusarium oxysporum, the soil borne pathogen causes vascular wilt, on majority of crop plants. It has been demonstrated that two different species of Trichoderma and Pseudomonas fluorescens suppress disease by different mechanisms. Therefore, application of a mixture of these biocontrol agents, and thus of several suppressive mechanisms, may represent a viable control strategy. A necessity for biocontrol by combinations of biocontrol agents can be the compatibility of the co-inoculated micro-organisms. Hence, compatibility between Trichoderma spp. and Pseudomonas fluorescens that have the ability to suppress Fusarium oxysporum in vitro on the activity of pectinolytic enzymes of Fusarium oxysporum. The activity of pectinolytic enzymes, i.e. pectin methyl esterase, endo and exo polymethylgalacturonases and exo and endo pectin trans eliminases produced by Fusarium oxysporum (Control) was higher. Maximum inhibition of pectin methylesterase, exo and endo polymethylgalacturonase and exo and endopectin trans eliminase was shown by culture filtrate of Trichoderma viride + Pseudomonas fluorescens (Tv+Pf) (1+2%), followed by Trichoderma harzianum + Pseudomonas fluorescens, (Th +Pf) (1.5+2%) and Trichoderma viride + Trichoderma harzianum (Tv+Th) (1+1.5%). However, pathogenecity suppression of Fusarium oxysporum, a causative of Arachis hypogaea. L by the compatible combination of Trichodema viride + Pseudomonas fluorescens (1+2%) was significantly better as compared to the single bio-agent. This indicates that specific interactions between biocontrol agents influence suppression of pathogenicity factors directly by combinations of these compatible bio-agents.Int. J. Agril. Res. Innov. & Tech. 7 (2): 36-42, December, 2017

Development of Species Specific Markers for the identification of Trichoderma asperellum and Trichoderma harzianum

Many species of genus Trichoderma are bio-control fungi and commonly distributed in all the geographic regions of the world. Conventional methods are not always satisfactory to discriminate between differentTrichoderma species. Furthermore, culture techniques are labour intensive and require considerable taxonomic expertise. In contrast, molecular techniques such as PCR and DNA sequencing are very sensitive, reliable and rapid methods for species detection. Therefore, the conserved sequences from multiple alignments of target genes ie. Translation Elongation Factor (tef1) and ribosomal subunit (rpb2) were used to design the primers for detection of Trichoderma asperellum and Trichoderma harzianum, respectively. tef1 gene sequences from 13 isolates of Trichoderma asperellum and 14 sequences from 7 different species of Trichoderma were aligned and 688 base pairs conserved region of Trichoderma asperellum was taken for designing the species specific primer. The specific oligonucleotide primer (T2AF 5′- CTCTGCCGTTGACTGTGAACG - 3′ and T2AR 5′-CGATAGTGGGGTTGCCGTCAA - 3′) has been designed with 507 base pairs for the amplification of specific region of Trichoderma asperellum and validated against 50 isolates of seven different species of Trichoderma. The sequences of rpb2 gene from 11 isolates of Trichoderma harzianum and 12 sequences from 12 different species of Trichoderma were aligned and 857 base pairs conserved region of Trichoderma harzianum was taken for designing species specific primer. The speci f ic oligonucl e o t ide primer (Th1F 5′ - TTGCATGGGTTCGCTAAAGG - 3′ and Th1R 5′- TCTTGTCAGCATCATGGCCGT - 3′) has been designed with 824 base pairs for the amplification of specific region of Trichoderma harzianum and validated against 52 isolates of seven different species of Trichoderma. The above said newly designed molecular markers are able to identify Trichoderma asperellum and Trichoderma harzianum accurately with less time.

Biochemical Characterization ofTrichodermaSpecies Isolated from Different Agricultural Fields of Uttar Pradesh, India

Seven different species of Trichoderma (T. harzianum, T. viride, T. asperellum, T. longibrachiatum, T. atroviride, T. koningii and T. virens) isolated from different locations of Uttar Pradesh, India were used in this study. A comparative analysis on glucanase enzyme production and nitrogen content tested. Among these species, T. harzianum, showed the highest glucanase enzyme production as well as the highest nitrogen content. Physical parameters such as pH, temperature and agitation revealed that the optimal pH, temp and agitation for biomass production were 6.0–6.5, 25°C-30°C and 150 rpm, respectively. The effect of two different carbon sources on glucanase enzyme induction was also determined. Carboxyl methyl cellulose (CMC) was found to be the best carbon source for glucanase enzyme production.

Multiplex PCR for detection and differentiation of diverse Trichoderma species

Trichoderma species are among the most common fungi frequently isolated as saprotrophs from free soil, soil litter, dead wood, and the rhizosphere of different crops. Four sets of species-specific primers were designed from the tef1 and rpb2 genes, in order to identify Trichoderma asperellum (tef1 gene), T. longibrachiatum (tef1 gene), T. virens (tef1 gene), and T. harzianum (rpb2 gene). Here, we report the development of a multiplex PCR assay to detect and distinguish each of these four most common Trichoderma species—viz., T. asperellum, T. harzianum, T. longibrachiatum, and T. virens—simultaneously in a single reaction through their distinct amplicons of 507, 824, 452, and 330 bp, respectively. The developed multiplex PCR technique will provide a rapid, simple, and reliable alternative to conventional methods and a new site for identification of different species of Trichoderma in a single reaction.

Unraveling the efficient applications of secondary metabolites of various Trichoderma spp.

Recent shift in trends of agricultural practices from application of synthetic fertilizers and pesticides to organic farming has brought into focus the use of microorganisms that carryout analogous function. Trichoderma spp. is one of the most popular genera of fungi commercially available as a plant growth promoting fungus (PGPF) and biological control agent. Exploitation of the diverse nature of secondary metabolites produced by different species of Trichoderma augments their extensive utility in agriculture and related industries. As a result, Trichoderma has achieved significant success as a powerful biocontrol agent at global level. The endorsement of Trichoderma spp. by scientific community is based on the understanding of its mechanisms of action against a large set of fungal, bacterial and in certain cases viral infections. However, it is still an agnostic view that there could be any single major mode of operation, although it is argued that all mechanisms operate simultaneously in a synchronized fashion. The central idea behind this review article is to emphasize the potentiality of applications of target specific secondary metabolites of Trichoderma for controlling phytopathogens as a substitute of commercially available whole organism formulations. With the aim to this point, we have compiled an inclusive list of secondary metabolites produced by different species of Trichoderma and their applications in diverse areas with the major emphasis on agriculture. Outlining the importance and diverse activities of secondary metabolites of Trichoderma besides its relevance to agriculture would generate greater understanding of their other important and beneficial applications apart from target specific biopesticides.

Genetic diversity and species pattern of Trichoderma and Hypocrea in Manipur using in silico analysis.

We investigated the occurrence and genetic diversity of Trichoderma and Hypocrea in Manipur which lies in the Indo-Burma biodiversity hot spot region. 65 Trichoderma isolates were identified at species level by morphological as well as sequence based analysis of the internal transcribed spacer region 1 and 4. Altogether 22 different species of Trichoderma and Hypocrea were found, of which Trichoderma harzianum represent the dominant species. Phylogenetic analysis reveals a clear cut distinction of strains isolated from various collection sites which further hints the need for detail study of Trichoderma on molecular level.

Integrated management of Fusarium wilt by combined soil application and seed dressing formulations of Trichoderma species to increase grain yield of chickpea

Wilt caused by the fungus Fusarium oxysporum f. sp. ciceris adversely affects the productivity of cultivated chickpea. For the management of this disease, seed and soil application formulations developed from another fungus, Trichoderma species, were evaluated. In pot experiments, T. harzianum-based formulations Pusa 5SD for seed dressing and Pusa Biopellet (PBP) 10G and Pusa Biogranule (PBG) 5 for soil application, and T. viride-based formulations Pusa 5SD for seed dressing and PBP 4G and PBG 4 for soil application, were found to be highly effective against the disease. A combination of PBP 4G (T. viride) for soil application and Pusa 5SD (T. harzianum) for seed treatment together with a fungicide, carboxin, provided the highest seed germination, shoot and root lengths and grain yield with the lowest incidence of wilt in chickpea under field conditions. Individually, soil application of PBP 4G, and seed treatment with Pusa 5SD were effective in reducing the incidence of wilt and increasing the grain yield of chickpea, but their effectiveness was greater when applied as a combination. Thus, combined application of the formulations of two different species of Trichoderma in two modes of application is recommended for the management of chickpea wilt.

In vivo interaction in antagonistic potential of Trichoderma spp. and Pseudomonas fluorescens.

Studies were carried out to find out interaction between antagonism activity of Pseudomonas fluorescens on the different species of Trichoderma . The inhibition in growth of Trichoderma was 8.59% when Trichoderma was used first and 59.44% when P. fluorescens was used first in a dual culture test. Highest growth inhibition (59.44%) of Trichoderma (Th3) was recorded when P. fluorescens was first inoculated in King's medium B agar (KMB) 24h prior to inoculation of T. harzianum . The lowest inhibition (8.59%) was recorded in T. viride (Tv1) when the isolate was inoculated in KMB prior to inoculation of P. fluorescens . All other isolates of Trichoderma , irrespective of the species, exhibited intermediate growth inhibition ranging from 9.87% in potato dextrose agar (PDA) (Tv1) to 59.18% in KMB (Th3). When the cell-free culture filtrate (5%) of P. fluorescens was used against different species and isolates of Trichoderma , it also caused growth inhibition of fungal antagonist to different levels (5.55 for Tvs1 to 25.92% for Th3). In steamed soil, recoverable number of Trichoderma population gradually increased (90 x 10 5 CFU g −1 of soil for Th3 to 172 x 10 5 CFU g −1 of soil for Tvs1) irrespective of the species over a period of 14 days incubation.

Direct identification of hydrophobins and their processing in Trichoderma using intact‐cell MALDI‐TOF MS

Intact-cell MS (ICMS) was applied for the direct detection of hydrophobins in various species and strains of Hypocrea/Trichoderma. In both mycelia and spores, dominating peaks were identified as hydrophobins by detecting mass shifts of 8 Da of reduced and unreduced forms, the analysis of knockout mutants, and comparison with protein databases. Strain-specific processing was observed in the case of Hypocrea jecorina (anamorph Trichoderma reesei). An analysis of 32 strains comprising 29 different species of Trichoderma and Hypocrea showed hydrophobin patterns that were specific at both at the species and isolate (subspecies) levels. The method therefore permits rapid and direct detection of hydrophobin class II compositions and may also provide a means to identify Trichoderma (and other fungal) species and strains from microgram amounts of biomass without prior cultivation.

Synthesis of enzymes connected with mycoparasitism by ectomycorrhizal fungi

The production of enzymes involved in mycoparasitism by several strains of ectomycorrhizal fungi: Amanita muscaria (16-3), Laccaria laccata (9-12), L. laccata (9-1), Suillus bovinus (15-4), S. bovinus (15-3), S. luteus (14-7) on different substrates such as colloidal chitin, mycelia of Trichoderma harzianum, T. virens and Mucor hiemalis was examined. Chitinases and beta-1,3-glucanases were assayed spectrophotometrically by measuring the amount of reducing sugars releasing from suitable substrate by means of Miller's method. Beta-glucosidases were determined by measuring the amount of p-nitrophenol released from p-nitrophenyl-beta-D-glucopyranoside. It was observed that A. muscaria (16-3) and L. laccata (9-12) biosynthesized the highest activity of enzymes in contrast to the strains of S. bovinus and S. luteus. The mycelium of T. harzianum turned out to be the best substrate for the induction of beta-1,3-glucanases and beta-glucosidases for both strains of L. laccata, although the difference in the induction of chitinases in the presence of mycelia of different species of Trichoderma was not indicated.

Molecular and Morphological Characterization of Green Mold, Trichoderma spp. isolated from Oyster Mushrooms

Isolates of Trichoderma spp. collected from Pleurotus ostreatus and P. eryngii beds, which included loosened substrate compactness and development of green colour, were grouped into three species. The occurrence of different species of Trichoderma was as T. cf. virens (70.8%), T. longibrachiatum (16.7%) and T. harzianum (12.5%). The conidia of Trichoderma spp. were ellipsoidal, obovoid and phialides were bowling pins, lageniform and the length of phialides was 3.5~10.0 × 1.3~3.3 μm. Phialides of T. cf. virens and T. harzianum were tending clustered, but it was solitary disposition in T. longibrachiatum. T. cf. virens was characterized by predominantly effuse conidiation, sparingly branched, and fertile to the apex and it was penicillate type. RAPD analysis could detect variability amongst three different species of Trichoderma using two newly designed URP-primers. However, intra-specific variation could not be detected in all the isolates except for rDNA sequence data classified Trichoderma isolates into three distinct groups representing three species. The profiles of rDNA sequences of isolates representing a species showed high similarity in T. cf. virens and T. harzianum. However, there was a variation in rDNA sequences of isolates representing T. longibrachiatum. The results of present study reveals that molecular techniques of RAPD and rDNA sequencing can greatly aid in classification based on morphology and precise identification of fast evolving species of Trichoderma.