Diagnosis Of Tissue Infections Research Articles

Pseudomonas species may appear strikingly filamentous in tissue sections: an important consideration for surgical pathologists and a reminder of the utility of modified silver impregnation methods.

Although tissue culture is the gold standard for diagnosing infection, histologic examination of surgically resected tissue can be a critical component in the diagnosis of tissue infection. The goal of this brief report is to alert surgical pathologists that Pseudomonas species can appear strikingly filamentous histologically and may somewhat mimic the appearance of filamentous bacteria, such Actinomyces or Nocardia, or thin fungal hyphae. A secondary aim is to raise awareness that Pseudomonas can sometimes only be identified histologically through the use of a modified silver impregnation method (Steiner stain). Five cases of filamentous Pseudomonas were encountered in three different surgical pathology subspecialities (ophthalmic pathology, cardiovascular pathology, and dermatopathology) over a 1-year period. All cases were of formalin-fixed, paraffin-embedded tissue, stained using hematoxylin & eosin (H&E) and multiple histochemical stains. Four cases grew Pseudomonas aeruginosa in culture and, in the fifth case, a nonaeruginosa species was detected using polymerase chain reaction-based methods. The markedly filamentous-appearing Pseudomonas organisms were identified in five different tissue sites: vascular graft, enucleation (whole eye) specimen, scleral biopsy, soft-tissue excision, and skin punch biopsy. In one of the five cases the organisms were seen on H&E, and in only two of the five were the organisms seen on Brown-Hopps stain. In all five cases, the organisms were identified on Steiner stain. It is therefore important to recognize that Pseudomonas can appear markedly filamentous, Pseudomonas or other bacterial infection is suspected, the surgical pathologist would be advised to employ the Steiner stain to most consistently detect the organisms.

Sensitive and Specific Detection of Toxoplasma DNA in an Experimental Murine Model: Use of Toxoplasma gondii-Specific cDNA and the Polymerase Chain Reaction

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5'CACACGGTTGTATGTCGGTTTCGCT3' and 5'TCAAGGAGCTCAATGTTACAGCCT3' followed by oligonucleotide hybridization using 5'GCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCA3' allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.