Development Of Transgenic Crops Research Articles

Plant Synthetic Promoters

This article examines the structure and functions of the plant synthetic promoters frequently used to precisely regulate complex regulatory routes. It details the composition of native promoters and their interacting proteins to provide a better understanding of the tasks associated with synthetic promoter development. The production of synthetic promoters is performed by relatively small libraries produced generally by basic molecular or genetic engineering methods such as cis-element shuffling or domain swapping. The article also describes the preparation of large-scale libraries supported by synthetic DNA fragments, directed evolution, and machine or deep-learning methodologies. The broader application of novel, synthetic promoters reduces the prevalence of homology-based gene silencing or improves the stability of transgenes. A particularly interesting group of synthetic promoters are bidirectional forms, which can enable the expression of up to eight genes by one regulatory element. The introduction and controlled expression of several genes after one transgenic event strongly decreases the frequency of such problems as complex segregation patterns and the random integration of multiple transgenes. These complications are commonly observed during the transgenic crop development enabled by traditional, multistep transformation using genetic constructs containing a single gene. As previously tested DNA promoter fragments demonstrate low complexity and homology, their abundance can be increased by using orthogonal expression systems composed of synthetic promoters and trans-factors that do not occur in nature or arise from different species. Their structure, functions, and applications are rendered in the article. Among them are presented orthogonal systems based on transcription activator-like effectors (dTALEs), synthetic dTALE activated promoters (STAPs) and dCas9-dependent artificial trans-factors (ATFs). Synthetic plant promoters are valuable tools for providing precise spatiotemporal regulation and introducing logic gates into the complex genetic traits that are important for basic research studies and their application in crop plant development. Precisely regulated metabolic routes are less prone to undesirable feedback regulation and energy waste, thus improving the efficiency of transgenic crops.

A translation proofreader of archaeal origin imparts multi-aldehyde stress tolerance to land plants

Aldehydes, being an integral part of carbon metabolism, energy generation, and signalling pathways, are ingrained in plant physiology. Land plants have developed intricate metabolic pathways which involve production of reactive aldehydes and its detoxification to survive harsh terrestrial environments. Here, we show that physiologically produced aldehydes, i.e., formaldehyde and methylglyoxal in addition to acetaldehyde, generate adducts with aminoacyl-tRNAs, a substrate for protein synthesis. Plants are unique in possessing two distinct chiral proofreading systems, D-aminoacyl-tRNA deacylase1 (DTD1) and DTD2, of bacterial and archaeal origins, respectively. Extensive biochemical analysis revealed that only archaeal DTD2 can remove the stable D-aminoacyl adducts on tRNA thereby shielding archaea and plants from these system-generated aldehydes. Using Arabidopsis as a model system, we have shown that the loss of DTD2 gene renders plants susceptible to these toxic aldehydes as they generate stable alkyl modification on D-aminoacyl-tRNAs, which are recycled only by DTD2. Bioinformatic analysis identifies the expansion of aldehyde metabolising repertoire in land plant ancestors which strongly correlates with the recruitment of archaeal DTD2. Finally, we demonstrate that the overexpression of DTD2 offers better protection against aldehydes than in wild type Arabidopsis highlighting its role as a multi-aldehyde detoxifier that can be explored as a transgenic crop development strategy.

PROTAC for agriculture: learning from human medicine to generate new biotechnological weed control solutions.

Weed control has relied on the use of organic and inorganic molecules that interfere with druggable targets, especially enzymes, for almost a century. This approach, although effective, has resulted in multiple cases of herbicide resistance. Furthermore, the rate of discovery of new druggable targets that are selective and with favorable environmental profiles has slowed down, highlighting the need for innovative control tools. The arrival of the biotechnology and genomics era gave hope to many that all sorts of new control tools would be developed. However, the reality is that most efforts have been limited to the development of transgenic crops with resistance to a few existing herbicides, which in fact is just another form of selectivity. Proteolysis-targeting chimera (PROTAC) is a new technology developed to treat human diseases but that has potential for multiple applications in agriculture. This technology uses a small bait molecule linked to an E3 ligand. The 3-dimensional structure of the bait favors physical interaction with a binding site in the target protein in a manner that allows E3 recruitment, ubiquitination and then proteasome-mediated degradation. This system makes it possible to circumvent the need to find druggable targets because it can degrade structural proteins, transporters, transcription factors, and enzymes without the need to interact with the active site. PROTAC can help control herbicide-resistant weeds as well as expand the number of biochemical targets that can be used for weed control. In the present article, we provide an overview of how PROTAC works and describe the possible applications for weed control as well as the challenges that this technology might face during development and implementation for field uses. © 2023 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

Agrobacterium-Mediated Transformation for the Development of Transgenic Crops; Present and Future Prospects.

Plant transformation based on Agrobacterium-mediated transformation is a technique that mimics the natural agrobacterium system for gene(s) introduction into crops. Through this technique, various crop species have been improved/modified for different trait/s, showing a successful genetic transformation so far. This technique has many advantages over other transformation methods such as stable integration of transgene, cost effective. However, there are many limitations of this technology such as mostly the crops are recalcitrant to agrobacterium, low transformation efficiency, transgene integration as well as off targets. So, it's very important to explore the major limitations and possible solutions for Agrobacterium-mediated transformation in order to increase its genetic transformation efficiency. Therefore, the present review article gives a comprehensive study how the transgenic crops are developed using Agrobacterium-mediated transformation, crops that have already been modified through this method, and risks associated with transgenic plants based on Agrobacterium-mediated transformation. Moreover, the challenges and problems associated with Agrobacterium-mediated transformation and how those problems can be solved in future for a successful genetic transformation of crops using modern biotechnology techniques such as CRISPR/Cas9 systems. The present review article will be really helpful for the audience those working on Genome editing of crops using Agrobacterium-mediated transformation and will opens many ways for future plant genetic transformation.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

A Genotype-Independent, Simple, Effective and Efficient in Planta Agrobacterium-Mediated Genetic Transformation Protocol.

Crop improvement under changing climatic conditions is required to feed the growing global population. The development of transgenic crops is an attractive and conceivably the most effective approach for crop improvement with desired traits in varying climatic situations. Here, we describe a simple, efficient and robust in planta Agrobacterium-mediated genetic transformation method that can be used in most crops, including rice, wheat and cotton, and particularly in tissue culture recalcitrant crops, such as chickpea and pigeon pea. The protocol was successfully used for the development of transgenic chickpea and pigeon pea lines for resistance against pod borer. Transgenic lines in chickpea, pigeon pea and wheat were also developed for salt stress tolerance. These lines exhibited improved salt tolerance in terms of various physio-biochemical parameters studied. Since the protocol is rapid, as no tissue culture step is involved, it will significantly contribute to the improvement of most crops and will be of interest for plant biologists working with genetic engineering or genome editing.

A Highly Glyphosate-Resistant EPSPS Mutant from Laboratory Evolution

EPSP synthase is the target enzyme of glyphosate herbicides. Due to the extensive use of glyphosate, it is very important to obtain EPSPS genes with high glyphosate resistance for the development of transgenic crops. GR79-EPSPS is a class I EPSP synthase with certain glyphosate resistance isolated from glyphosate-contaminated soil. After more than 1000 generations, a Y40I substitution was identified, and the enzyme had a nearly 1.8-fold decrease in Km [PEP] and a 1.7-fold increase in Ki[glyphosate] compared to the wild-type enzyme. Enzyme dynamics and molecular dynamics analysis showed that the substitution was near the hinge region of EPSPS, and the affinity of glyphosate binding to amino acid residues of the active site decreased due to Y40I substitution, resulting in an increase in glyphosate resistance. These results provide more evidence for the combination of directed evolution and rational design of protein engineering.

Transcriptome Analysis of Pennisetum glaucum (L.) R. Br. Provides Insight Into Heat Stress Responses.

Pennisetum glaucum (L.) R. Br., being widely grown in dry and hot weather, frequently encounters heat stress at various stages of growth. The crop, due to its inherent capacity, efficiently overcomes such stress during vegetative stages. However, the same is not always the case with the terminal (flowering through grain filling) stages of growth, where recovery from stress is more challenging. However, certain pearl millet genotypes such as 841-B are known to overcome heat stress even at the terminal growth stages. Therefore, we performed RNA sequencing of two contrasting genotypes of pearl millet (841-B and PPMI-69) subjected to heat stress (42°C for 6 h) at flowering stages. Over 274 million high quality reads with an average length of 150 nt were generated, which were assembled into 47,310 unigenes having an average length of 1,254 nucleotides, N50 length of 1853 nucleotides, and GC content of 53.11%. Blastx resulted in the annotation of 35,628 unigenes, and functional classification showed 15,950 unigenes designated to 51 Gene Ontology terms. A total of 13,786 unigenes were allocated to 23 Clusters of Orthologous Groups, and 4,255 unigenes were distributed to 132 functional Kyoto Encyclopedia of Genes and Genomes database pathways. A total of 12,976 simple sequence repeats and 305,759 SNPs were identified in the transcriptome data. Out of 2,301 differentially expressed genes, 10 potential candidate genes were selected based on log2 fold change and adjusted p value parameters for their differential gene expression by qRT-PCR. We were able to identify differentially expressed genes unique to either of the two genotypes, and also, some DEGs common to both the genotypes were enriched. The differential expression patterns suggested that 841-B 6 h has better ability to maintain homeostasis during heat stress as compared to PPMI-69 6 h. The sequencing data generated in this study, like the SSRs and SNPs, shall serve as an important resource for the development of genetic markers, and the differentially expressed heat responsive genes shall be used for the development of transgenic crops.

RISKS AND RISK ASSESSMENT OF GM CROPS WITH ADVANCED MODIFICATION TECHNOLOGIES

Genetically modified organisms (GMOs) are organisms whose genetic material (DNA) has been artificially modified by using genetic engineering techniques to enhance and altered their characteristics. Genetic engineering plays a significant role in the development of transgenic crops. The four crops canola, maize, cotton, and soybean are the most common ones to use GM crop technology, which has been used extensively for more than 20 years in a variety of nations. The two most significant GM crops in Pakistan are cotton and maize, both of which are resistant to weeds and insects. The impact studies of insect-resistant and herbicide-tolerant crops that are already available demonstrate the advantages of these techniques for both producers and consumers, as well as their favorable effects on both the environment and public health. Additionally, GM crops are a treatment for famine and malnutrition. Future uses may perhaps provide even greater benefits. Implementing an integrated strategy to pest management will be essential for food security, agricultural stability, and protection of the environment as the global population increases. Crops that have been genetically modified (GE) offer resistance to herbicides or protection from pests and diseases. Technology significantly decreases pest damage and improves crop production. As in the case of Bt cotton, pest-resistant genetically modified crops can support higher yields and agricultural development. We provide a thorough update on the status of the cultivated genetically modified (GM) crops in this paper. We address some vector based techniques for modification and some new approaches of transgene transfer without microbial vector insertion into recipient species In order to reduce the hazards associated with microbial vectors.

Papaya Ring Spot Virus: An Understanding of a Severe Positive-Sense Single Stranded RNA Viral Disease and Its Management

Viral diseases have been studied in-depth for reducing quality, yield, health and longevity of the fruit, to highlight the economic losses. Positive-sense single-stranded RNA viruses are more devastating among all viruses that infect fruit trees. One of the best examples is papaya ringspot virus (PRSV). It belongs to the genus Potyvirus and it is limited to cause diseases on the family Chenopodiaceae, Cucurbitaceae and Caricaceae. This virus has a serious threat to the production of papaya, which is famous for its high nutritional and pharmaceutical values. The plant parts such as leaves, latex, seeds, fruits, bark, peel and roots may contain the biological compound that can be isolated and used in pharmaceutical industries as a disease control. Viral disease symptoms consist of vein clearing and yellowing of young leaves. Distinctive ring spot patterns with concentric rings and spots on fruit reduce its quality and taste. The virus has two major strains P and W. The former cause disease in papaya while the later one in. Virion comprises 94.4% protein, including a 36 kDa coat protein which is a component responsible for a non-persistent transmission through aphids, and 5.5% nucleic acid. Cross protection, development of transgenic crops, exploring the resistant sources and induction of pathogen derived resistance have been recorded as effective management of PRSV. Along with these practices reduced aphid population through insecticides and plant extracts have been found ecofriendly approaches to minimize the disease incidence. Adoption of transgenic crops is a big challenge for the success of disease resistant papaya crops. The aim of this review is to understand the genomic nature of PRSV, detection methods and the different advanced control methods. This review article will be helpful in developing the best management strategies for controlling PRSV.

Codon usage bias.

Codon usage bias is the preferential or non-random use of synonymous codons, a ubiquitous phenomenon observed in bacteria, plants and animals. Different species have consistent and characteristic codon biases. Codon bias varies not only with species, family or group within kingdom, but also between the genes within an organism. Codon usage bias has evolved through mutation, natural selection, and genetic drift in various organisms. Genome composition, GC content, expression level and length of genes, position and context of codons in the genes, recombination rates, mRNA folding, and tRNA abundance and interactions are some factors influencing codon bias. The factors shaping codon bias may also be involved in evolution of the universal genetic code. Codon-usage bias is critical factor determining gene expression and cellular function by influencing diverse processes such as RNA processing, protein translation and protein folding. Codon usage bias reflects the origin, mutation patterns and evolution of the species or genes. Investigations of codon bias patterns in genomes can reveal phylogenetic relationships between organisms, horizontal gene transfers, molecular evolution of genes and identify selective forces that drive their evolution. Most important application of codon bias analysis is in the design of transgenes, to increase gene expression levels through codon optimization, for development of transgenic crops. The review gives an overview of deviations of genetic code, factors influencing codon usage or bias, codon usage bias of nuclear and organellar genes, computational methods to determine codon usage and the significance as well as applications of codon usage analysis in biological research, with emphasis on plants.

Evaluating the pesticidal impact of plant protease inhibitors: lethal weaponry in the co-evolutionary battle.

In the arsenal of plant defense, protease inhibitors (PIs) are well-designed defensive products to counter field pests. PIs are produced in plant tissues by means of 'stable defense metabolite' and triggered on demand as the perception of the signal and well established as a part of plant active defense. PIs have been utilized for approximately four decades, initially as a gene-alone approach that was later replaced by multiple gene pyramiding/gene stacking due to insect adaptability towards the PI alone. By considering the adaptive responses of the pest to the single insecticidal gene, the concept of gene pyramiding gained continuous appreciation for the development of transgenic crops to deal with co-evolving pests. Gene pyramiding approaches are executed to bypass the insect's adaptive responses against PIs. Stacking PIs with additional insecticidal proteins, plastid engineering, recombinant proteinase inhibitors, RNAi-based methods and CRISPR/Cas9-mediated genome editing are the advanced tools and methods for next-generation pest management. Undoubtedly, the domain associated with the mechanism of PIs in the course of plant-pest interactions will occupy a central role for the advancement of more efficient and sustainable pest control strategies. © 2021 Society of Chemical Industry.

Adaptive Mechanisms of Halophytes and Their Potential in Improving Salinity Tolerance in Plants.

Soil salinization, which is aggravated by climate change and inappropriate anthropogenic activities, has emerged as a serious environmental problem, threatening sustainable agriculture and future food security. Although there has been considerable progress in developing crop varieties by introducing salt tolerance-associated traits, most crop cultivars grown in saline soils still exhibit a decline in yield, necessitating the search for alternatives. Halophytes, with their intrinsic salt tolerance characteristics, are known to have great potential in rehabilitating salt-contaminated soils to support plant growth in saline soils by employing various strategies, including phytoremediation. In addition, the recent identification and characterization of salt tolerance-related genes encoding signaling components from halophytes, which are naturally grown under high salinity, have paved the way for the development of transgenic crops with improved salt tolerance. In this review, we aim to provide a comprehensive update on salinity-induced negative effects on soils and plants, including alterations of physicochemical properties in soils, and changes in physiological and biochemical processes and ion disparities in plants. We also review the physiological and biochemical adaptation strategies that help halophytes grow and survive in salinity-affected areas. Furthermore, we illustrate the halophyte-mediated phytoremediation process in salinity-affected areas, as well as their potential impacts on soil properties. Importantly, based on the recent findings on salt tolerance mechanisms in halophytes, we also comprehensively discuss the potential of improving salt tolerance in crop plants by introducing candidate genes related to antiporters, ion transporters, antioxidants, and defense proteins from halophytes for conserving sustainable agriculture in salinity-prone areas.

Engineering cereal crops for enhanced abiotic stress tolerance

In the scenario of global climate change, abiotic stresses such as rising temperature, water deficit and stress combinations are posing serious threats to sustainable agricultural production, and these factors account for more yield losses than any other factor. Developing crop plants with enhanced abiotic stress tolerance has become a priority now-a-days. Agricultural biotechnology including genomics-assisted breeding and genetic engineering help in studying and understanding the complex nature of abiotic stress responses and provide measures for enhancing crop productivity under adverse environmental conditions. Plants respond and adapt to adverse environmental factors by activating molecular network cascades that are implicated in stress perception, signal transduction, genes expression and accumulation of certain metabolites. Various functional genomics approaches have helped to identify numerous genes involved in stress-associated molecular regulatory networks in both model plants and non-model crop species. Thus engineering genes that activate the transcription of other stress responsive genes or play important roles in protection and maintenance of cellular components and macromolecules might expedite crop improvement programs. Several of these candidate genes have been transformed in agriculturally important crops to improve their abiotic stress tolerance. Nonetheless, genetic engineering for stress tolerance not only encompasses attempts to engineer “single action genes” and “gene pyramiding” but also introgressions of regulatory machinery involving transcription factors. Further, development of transgenic crops not only depends upon the success rate of genetic transformation but also upon their proper integration and evaluation of stress tolerance. This review thus, summarizes the recent progress in the application of genetic engineering and/or transgenic technology for crop improvement in order to realize global food security by developing varieties superior in abiotic stress tolerance.

Insights Into Genetic and Molecular Elements for Transgenic Crop Development.

Climate change and the exploration of new areas of cultivation have impacted the yields of several economically important crops worldwide. Both conventional plant breeding based on planned crosses between parents with specific traits and genetic engineering to develop new biotechnological tools (NBTs) have allowed the development of elite cultivars with new features of agronomic interest. The use of these NBTs in the search for agricultural solutions has gained prominence in recent years due to their rapid generation of elite cultivars that meet the needs of crop producers, and the efficiency of these NBTs is closely related to the optimization or best use of their elements. Currently, several genetic engineering techniques are used in synthetic biotechnology to successfully improve desirable traits or remove undesirable traits in crops. However, the features, drawbacks, and advantages of each technique are still not well understood, and thus, these methods have not been fully exploited. Here, we provide a brief overview of the plant genetic engineering platforms that have been used for proof of concept and agronomic trait improvement, review the major elements and processes of synthetic biotechnology, and, finally, present the major NBTs used to improve agronomic traits in socioeconomically important crops.

Development of 2A-CHYSEL technology based multicistronic expression systems for imparting fungal tolerance

Multigene transfer is an approach for development of transgenic crops simultaneously expressing many genes.With an aim to impart necrotrophic fungal tolerance through transgenic approach, the present study describes thedevelopment of multigene construct bearing three antifungal genes as a single transcriptional unit capable of expressing at high levels and evading transgene silencing.

Sustainable soybean production and abiotic stress management in saline environments: a critical review

Soybean ('Glycine max' L.) is an important oilseed crop around the world. Soybean growth, development and productivity are affected by changing environments that induce abiotic stresses. In soybean, salinity acts as a major abiotic stress that increases electrolyte leakage as well as Na+ and proline content in plants, and adversely affects plant physiology. This review offers an understanding of how the growth, yield attributes, and yield of soybean decrease under salinity stress. To appreciate how soybean can better adapt to a changing climate that induces salinity stress, an understanding of the mechanisms underlying this stress is needed. Improved performance and yield in response to salinity stress can emerge from the application of novel strategies, such as the development of transgenic crops that enhance salt tolerance in soybean. Effective management strategies, including the use of compatible antioxidants such as proline or glycinebetaine, coupled with a more effective balance of nutrients or the use of organic fertilizers, allow salinity to be mitigated, thereby improving yield and other growth-related quality parameters in soybean.

A survey of crop-derived transgenes in activated and digester sludges in wastewater treatment plants in the United States.

The use of transgenic crops has become increasingly common in the United States over the last several decades. Increasing evidence suggests that DNA may be protected from enzymatic digestion and acid hydrolysis in the digestive tract, suggesting that crop-derived transgenes may enter into wastewater treatment plants (WWTPs) intact. Given the historical use of antibiotic resistance genes as selection markers in transgenic crop development, it is important to consider the fate of these transgenes. Herein we detected and quantified crop-derived transgenes in WWTPs. All viable US WWTP samples were found to contain multiple gene targets (p35, nos, bla and nptII) at significantly higher levels than control samples. Control wastewater samples obtained from France, where transgenic crops are not cultivated, contained significantly fewer copies of the nptII gene than US activated and digester sludges. No significant differences were measured for the bla antibiotic resistance gene (ARG). In addition, a nested PCR (polymerase chain reaction) assay was developed that targeted the bla ARG located in regions flanked by the p35 promoter and nos terminator. Overall this work suggests that transgenic crops may have provided an environmental source of nptII; however, follow-up studies are needed to ascertain the viability of these genes as they exit WWTPs.

Development of transgenic crops based on photo-biotechnology.

The phenotypes associated with plant photomorphogenesis such as the suppressed shade avoidance response and de-etiolation offer the potential for significant enhancement of crop yields. Of many light signal transducers and transcription factors involved in the photomorphogenic responses of plants, this review focuses on the transgenic overexpression of the photoreceptor genes at the uppermost stream of the signalling events, particularly phytochromes, crytochromes and phototropins as the transgenes for the genetic engineering of crops with improved harvest yields. In promoting the harvest yields of crops, the photoreceptors mediate the light regulation of photosynthetically important genes, and the improved yields often come with the tolerance to abiotic stresses such as drought, salinity and heavy metal ions. As a genetic engineering approach, the term photo-biotechnology has been coined to convey the idea that the greater the photosynthetic efficiency that crop plants can be engineered to possess, the stronger the resistance to biotic and abiotic stresses. Development of GM crops based on photoreceptor transgenes (mainly phytochromes, crytochromes and phototropins) is reviewed with the proposal of photo-biotechnology that the photoreceptors mediate the light regulation of photosynthetically important genes, and the improved yields often come with the added benefits of crops' tolerance to environmental stresses.

Loop replacements with gut-binding peptides in Cry1Ab domain II enhanced toxicity against the brown planthopper, Nilaparvata lugens (Stål).

Bacillus thuringiensis (Bt) Cry toxins have been used widely in pest managements. However, Cry toxins are not effective against sap-sucking insects (Hemiptera), which limits the application of Bt for pest management. In order to extend the insecticidal spectrum of Bt toxins to the rice brown planthopper (BPH), Nilaparvata lugens, we modified Cry1Ab putative receptor binding domains with selected BPH gut-binding peptides (GBPs). Three surface exposed loops in the domain II of Cry1Ab were replaced with two GBPs (P2S and P1Z) respectively. Bioassay results showed that toxicity of modified toxin L2-P2S increased significantly (~9 folds) against BPH nymphs. In addition, damage of midgut cells was observed from the nymphs fed with L2-P2S. Our results indicate that modifying Cry toxins based on the toxin-gut interactions can broaden the insecticidal spectrum of Bt toxin. This method provides another approach for the development of transgenic crops with novel insecticidal activity against hemipteran insects and insect populations resistant to current Bt transgenic crops.