Del Piero Research Articles

One-Dimensional Failure Modes for Bodies with Non-convex Plastic Energies

In this paper, a complete picture of the different plastic failure modes that can be predicted by the strain gradient plasticity model proposed in Del Piero et al. (J. Mech. Mater. Struct. 8:109–151, 2013) is drawn. The evolution problem of the elasto-plastic strain is formulated in Del Piero et al. (J. Mech. Mater. Struct. 8:109–151, 2013) as an incremental minimization problem acting on an energy functional which includes a local plastic term and a non-local gradient contribution. Here, an approximate analytical solution of the evolution problem is determined in the one-dimensional case of a tensile bar. Different solutions are found describing specific plastic strain processes, and correlations between the different evolution modes and the convexity/concavity properties of the plastic energy density are established.The variety of solutions demonstrates the large versatility of the model in describing many failure mechanisms, ranging from brittle to ductile. Indeed, for a convex plastic energy, the plastic strain diffuses in the body, while, for a concave plastic energy, it localizes in regions whose amplitude depends on the internal length parameter included into the non-local energy term, and, depending on the convexity properties of the first derivative of the plastic energy, the localization band expands or contracts. Complex failure processes combining different modes can be reproduced by assuming plastic energy functionals with specific convex and concave branches.The quasi-brittle failure of geomaterials in simple tension tests was reproduced by assuming a convex-concave plastic energy, and the accuracy of the analytical predictions was checked by comparing them with the numerical results of finite element simulations.

A generalized cohesive zone model and a grain boundary yield criterion for gradient plasticity derived from surface- and interface-related arguments

In this work, new generalized interface models for gradient plasticity based on the dislocation density tensor are presented. The first one is a new generalized cohesive zone model which can be used for interface damage and delamination in gradient plasticity applications. The second one is a new grain boundary yield criterion with isotropic and kinematic hardening and a related flow rule, being formulated based on results from discrete dislocation simulations. The derivation starts from surface-related considerations, like in the work of Del Piero (2009), who starts with the virtual power of the external forces and then derives the principle of virtual power (Povp) rather than postulating it. Here, however, the formulation is carried out without using the notion of ‘virtual power’, although the derivation may as well be based on the Povp. Moreover, the derivation does not involve new micro force balance equations. In addition, the dislocation density tensor occurs rather as an outcome of the approach than as an ingredient. The discussion is closed by an example.

Modeling the Response of Tensile Steel Bars by Means of Incremental Energy Minimization

A non-local variational model for the evolution of plastic deformation and fracture in tensile bars is proposed. The model is based on an energy functional, sum of an elastic bulk energy, a non-convex dissipative inelastic energy, and a quadratic non-local gradient term, as in (Del Piero et al. in J. Mech. Mater. Struct. 8(2–4):109–151, 2013). The non-local energy is enriched, by assuming a dependence on both the inelastic deformation and its gradient, in order to improve the description of fracture, and bars with varying cross-section are considered, to accurately reproduce the geometry of samples which are commonly used in tensile tests. The evolution of the deformation is described by a two-field incremental minimization problem, where the longitudinal displacement and the plastic part of the deformation are assumed as independent variables. The problem is discretized by finite elements, and the resulting sequence of constrained quadratic programming problems is solved numerically. Different simulations are proposed, reproducing the results of experiments on smooth and notched bone-shaped steel samples. The numerical tests provide accurate response curves, and they capture the distinct phases of the evolution observed in experiments: from the initial yielding phase, in which inelastic deformations form, and propagate as slow plastic waves, to the final rupture, which constitutes the ending stage of a strain-localization process.

Color atlas of equine pathology. Edited by CDBuergelt and FDel Piero. Wiley‐Blackwell, West Sussex, 2014. 552 pages. A$190.95. ISBN 9780470962848.

Australian Veterinary JournalVolume 92, Issue 10 p. 399-399 BOOK REVIEW Color atlas of equine pathology. Edited by CD Buergelt and F Del Piero. Wiley-Blackwell, West Sussex, 2014. 552 pages. A$190.95. ISBN 9780470962848. R Charman, R CharmanSearch for more papers by this author R Charman, R CharmanSearch for more papers by this author First published: 26 September 2014 https://doi.org/10.1111/avj.12244Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat No abstract is available for this article. Volume92, Issue10October 2014Pages 399-399 RelatedInformation

Nonlinear elasticity, viscosity and damage in open-cell polymeric foams

Of interest, in this work, is the behavior of open-cell polymer foams under compression. In a recent work by Del Piero and Pampolini (Continuum Mech Thermodyn 24:181–199, 2012), a model coupling nonlinear elasticity and viscosity was introduced to describe the response of a polyurethane foam subjected to uniaxial cyclic compression. Inelastic effects were attributed to the viscous properties of the foam, while strain localization and hysteresis were attributed to the nonconvexity of the strain energy density. But the model did not reproduce the response curves after the first loading–unloading cycle. Here, the model is extended by taking into account the damage of the foam. A simple phenomenological one parameter damage law is used to describe the damage occurring during the first loading cycle. An accurate identification procedure for the material constants is also developed, and the interaction of viscosity and damage in both monotonic and cyclic deformation processes is discussed. In spite of the one dimensional formulation, the model permits a precise analysis of the main phenomena which determine the complex behavior of the foam.

Energy-based Modeling of Localization and Necking in Plasticity

In this paper two different non-local plasticity models are presented and compared to describe the necking and fracture through a non-convex energy, where fracture is regarded as the extreme localization of the plastic strain. The difference between the models arises from the evolution of plastic deformation. The first (rate-dependent) approach, proposed in Yalcinkaya et al. (2011) follows the principle of virtual work to get balance equations and the dissipation inequality, in order to obtain the plastic evolution equation. The free-energy is given by the sum of a non-convex plastic term, and two quadratic terms with respect to the elastic deformation and the plastic deformation gradient. In the second (rate-independent) model, developed in Del Piero et al. (2013a), the plastic evolution is determined by incremental minimization of an energy functional which is equal to the free-energy of the previous model. The numerical example considers a convex-concave plastic energy to address the response of a tensile steel bar, where plastic strains localize intrinsically up to fracture. The numerical results exhibit good agreement between the two models. The solutions provided by the rate-dependent model approach those of the rate-independent model, as the imposed deformation rate reduces.

Bottom-up modeling of damage in heterogeneous quasi-brittle solids

The theoretical modeling of multisite cracking in quasi-brittle materials is a complex damage problem, hard to model with traditional methods of fracture mechanics due to its multiscale nature and to strain localization induced by microcracks interaction. Macroscale “effective” elastic models can be conveniently applied if a suitable Helmholtz free energy function is identified for a given material scenario. Del Piero and Truskinovsky (Continuum Mech Thermodyn 21:141–171, 2009), among other authors, investigated macroscale continuum solutions capable of matching—in a top-down view—the phenomenology of the damage process for quasi-brittle materials regardless of the microstructure. On the contrary, this paper features a physically based solution method that starts from the direct consideration of the microscale properties and, in a bottom-up view, recovers a continuum elastic description. This procedure is illustrated for a simple one-dimensional problem of this type, a bar modeled stretched by an axial displacement, where the bar is modeled as a 2D random lattice of decohesive spring elements of finite strength. The (microscale) data from simulations are used to identify the “exact” (macro-) damage parameter and to build up the (macro-) Helmholtz function for the equivalent elastic model, bridging the macroscale approach by Del Piero and Truskinovsky. The elastic approach, coupled with microstructural knowledge, becomes a more powerful tool to reproduce a broad class of macroscopic material responses by changing the convexity–concavity of the Helmholtz energy. The analysis points out that mean-field statistics are appropriate prior to damage localization but max-field statistics are better suited in the softening regime up to failure, where microstrain fluctuation needs to be incorporated in the continuum model. This observation is of consequence to revise mean-field damage models from literature and to calibrate Nth gradient continuum models.

The influence of viscosity on the response of open-cell polymeric foams in uniaxial compression: experiments and theoretical model

In a preceding paper (Pampolini and Del Piero in J Mech Mater Struct 3:969–981, 2008), the response of blocks made of a polymeric open-cell foam subject to uniaxial compression was analyzed. The hysteretic behavior exhibited in cyclic tests was interpreted within the context of nonlinear elasticity, as an effect of strain localization due to the non-convexity of the energy. Here we study some inelastic aspects of the response, such as rate dependence, strength decay after repeated loading, and memory effects. The analysis of some key experiments led us to the conclusion that viscous effects prevail over plasticity and damage. Consequently, we propose here a visco-elastic model, obtained by adding linear visco-elastic elements to our previous chain of nonlinear elastic springs. The paper is completed by the description of a series of experiments and of numerical simulations.

Interface models coupling adhesion and friction

Interface models coupling friction and adhesion, where adhesion is regarded as interface damage, are briefly reviewed. The most widely used cohesive zone models are presented and discussed. A general framework for these laws, recently developed by Del Piero and Raous in the form of a unified model, is outlined. As an example, it is here established that the RCCM (Raous–Cangémi–Cocou–Monerie) model is a specific case in this general framework. The variational formulation and some associated solvers are briefly recalled in the context of non-smooth mechanics in the cases of both quasi-static and dynamic problems. A few examples in various fields of application are given. Lastly, some open problems and ongoing researches in this field are presented and discussed.

Complex bodies with memory: Linearized setting

AbstractThe mechanics of complex bodies with memory effects is discussed in linearized setting. The attention is focused on the characterization of free energies in terms of minimum work and maximum recoverable work in the bulk and along a discontinuity surface endowed with its own surface energy, a surface within the body. To this aim, use is made of techniques proposed by Del Piero. Consequences of the Clausius–Duhem inequality are investigated for complex bodies with instantaneous linear elastic response. Copyright © 2008 John Wiley & Sons, Ltd.

Behavior of Cracked Materials

Due to their microstructure, quasi brittle materials present rough cracks. Under sliding of the crack lips, this roughness involves in one hand induced opening and in the other hand some apparent plasticity which is due to the interlocking of the crack lips combined with Coulomb’s friction. The proposed model is written under the irreversible thermodynamics framework. Micromechanics uses the Del Piero and Owen’s structured deformation theory. Opening of the crack depends upon the crack shape and the relative sliding of the crack lips. The thermodynamic force associated to the sliding has the mechanical meaning of the force acting in order to make the crack slide. Yield surface is defined as a limitation of this force with respect to the Coulomb’s friction and the Barenblatt cohesion. The crack orientation is defined as the one for which the criterion is reached for the lowest stress level. A decreasing cohesion, respect to sliding is supposed. Tension and compression reference cases are envisaged.

Initiation of cracks with cohesive force models: a variational approach

Abstract In the spirit of the variational approach of Fracture Mechanics initiated in [Del Piero, G., 1997. One-dimensional ductile-brittle transition, yielding and structured deformations. In: P. Argoul, M. Fremond (Eds.), Proceedings of IUTAM Symposium “Variations de domaines et frontieres libres en mecanique”, Paris, 1997, Kluwer Academic] and [Francfort, G.A., Marigo, J.-J., 1998. Revisiting brittle fracture as an energy minimization problem. J. Mech. Phys. Solids 46 (8), 1319–1342], we define the loss of stability of the elastic response of the body as the criterion of initiation of cracks. The result is very sensitive to the choice of the surface energy density. On one hand, if we adopt the Griffith assumption, then the elastic state is generally always stable. On the other hand, in the case of a surface energy of the Barenblatt type, i.e. a surface energy depending non-trivially on the jump of the displacement and inducing cohesive forces, the elastic response remains stable only if the stress field does not reach a critical value. In the full three-dimensional context of an isotropic material, we prove that this yield stress criterion is equivalent to a maximal traction criterion and a maximal shear criterion if the surface energy density is Frechet differentiable at the origin. When the surface energy density is only Gâteaux differentiable, we obtain a yield stress criterion based on an intrinsic curve in the Mohr diagram. In any case, the domain of the admissible stress tensors is convex, unbounded in the direction of the hydrostatic pressures and depends only on the extreme eigenvalues of the stress tensor.

Encephalomyelitis from West Nile Flavivirus in 3 Alpacas

Journal of Veterinary Internal MedicineVolume 18, Issue 3 p. 365-367 Open Access Encephalomyelitis from West Nile Flavivirus in 3 Alpacas B. Dunkel, Corresponding Author B. Dunkel Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/ Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. 382 West Street Road, Kennett Square, PA 19348;e-mail: bdunkel@vet.upenn.edu.Search for more papers by this authorF. Del Piero, F. Del Piero Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Departments of Pathobiology, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorK.L. Wotman, K.L. Wotman Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorI.C. Johns, I.C. Johns Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorJ. Beech, J. Beech Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorP.A. Wilkins, P.A. Wilkins Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/ Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this author B. Dunkel, Corresponding Author B. Dunkel Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/ Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. 382 West Street Road, Kennett Square, PA 19348;e-mail: bdunkel@vet.upenn.edu.Search for more papers by this authorF. Del Piero, F. Del Piero Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Departments of Pathobiology, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorK.L. Wotman, K.L. Wotman Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorI.C. Johns, I.C. Johns Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorJ. Beech, J. Beech Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorP.A. Wilkins, P.A. Wilkins Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/ Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this author First published: 28 June 2008 https://doi.org/10.1111/j.1939-1676.2004.tb02561.xCitations: 19AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat No abstract is available for this article.Citing Literature Volume18, Issue3May 2004Pages 365-367 ReferencesRelatedInformation

Congenital Cutaneous, Oral, and Periarticular Hemangiosarcoma in a 9‐Day‐Old Rocky Mountain Horse

Journal of Veterinary Internal MedicineVolume 18, Issue 2 p. 252-255 Open Access Congenital Cutaneous, Oral, and Periarticular Hemangiosarcoma in a 9-Day-Old Rocky Mountain Horse B.M. Dunkel, B.M. Dunkel Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorF. Del Piero, F. Del Piero Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Departments of Pathobiology, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorB.M. Kraus, B.M. Kraus Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Departments of Surgery, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorJ.E. Palmer, J.E. Palmer Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorP. Lin, P. Lin Departments of Pathobiology, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorP.A. Wilkins, Corresponding Author P.A. Wilkins Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. New Bolton Center, SVM, University of Pennsylvania, 382 West Street Road, Kennett Square, PA 19348;e-mail: pwilk-ins@vet.upenn.edu.Search for more papers by this author B.M. Dunkel, B.M. Dunkel Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorF. Del Piero, F. Del Piero Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Departments of Pathobiology, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorB.M. Kraus, B.M. Kraus Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Departments of Surgery, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorJ.E. Palmer, J.E. Palmer Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorP. Lin, P. Lin Departments of Pathobiology, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA.Search for more papers by this authorP.A. Wilkins, Corresponding Author P.A. Wilkins Departments of Clinical Studies, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Sections of Medicine, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. Emergency/Critical Care and Anesthesia, School of Veterinary Medicine, New Bolton Center, University of Pennsylvania, Kennett Square, PA. New Bolton Center, SVM, University of Pennsylvania, 382 West Street Road, Kennett Square, PA 19348;e-mail: pwilk-ins@vet.upenn.edu.Search for more papers by this author First published: 28 June 2008 https://doi.org/10.1111/j.1939-1676.2004.tb00171.xCitations: 21AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Citing Literature Volume18, Issue2March 2004Pages 252-255 ReferencesRelatedInformation

Recurrent Esophageal Obstruction and Dysphagia due to a Brainstem Melanoma in a Horse

Recurrent Esophageal Obstruction and Dysphagia due to a Brainstem Melanoma in a Horse

Recurrent Esophageal Obstruction and Dysphagia due to a Brainstem Melanoma in a Horse

Recurrent Esophageal Obstruction and Dysphagia due to a Brainstem Melanoma in a Horse

195REMOVAL OF EQUINE ARTERITIS VIRUS FROM STALLION SEMEN

Infection of breeding horses with equine arteritis virus (EAV) can result in abortion in up to 50% of mares (Del Piero F 2000 Vet. Pathol. 37, 287–296). Viral transmission occurs in body fluids, including semen (Golnik W et al. 1986 Zentralblatt für Veterinarmedizin 33, 413–417), with infected males potentially shedding virus indefinitely. Previously, the only means of preventing EAV transmission via semen was to remove identified shedders from the breeding pool. Recent medical studies have shown that viral infectivity can be removed from the semen of HIV or hepatitis C patients by a sequential method of sperm preparation: i.e. centrifugation on a discontinuous density gradient, followed by swim-up, (e.g. Bujan et al. 2002 Fertil. Steril. 78, 1321–1323; Levy et al. 2002 Hum. Rep. 17, 2650–2653). Human sperm prepared by this method have been used in over 1000 assisted reproduction attempts without sero-conversion of mothers or children (Lyerly A et al. 2001 Fertil. Steril. 75, 843–858). The current study investigates whether a sequential preparation technique of centrifugation on an EquiPure density gradient followed by a swim-up into a sperm maintenance medium can remove EAV from stallion ejaculates. Aliquots (1mL) of stallion semen, extended in Kenny’s medium, were spiked with known quantities of EAV at three levels corresponding to 1.0, 10 and 100 TCID50/mL−1. The latter was considered to be representative of levels seen in natural infection (Timoney PJ et al. 1987 J. Reprod. Fertil. (Suppl. 35), 95–102). Aliquots of spiked semen were prepared by centrifugation on EquiPure gradients. After centrifuging the resulting sperm pellets in EquiSperm Wash, the sperm were subjected to a swim-up treatment (all sperm preparation material from NidaCon, Gothenburg, Sweden). Aliquots of the sperm preparations, the unspiked extended semen, and spiked extended semen were stored at −70°C for viral assay by nested PCR (Belak S et al. 1994 Proc. 7th Int. Conf. Equine Inf. Dis. pp 33–38). The sensitivity of this assay is less than 1 PFU mL−1 of virus in seminal plasma, as validated by Belak et al. Using the PCR technique, a region from the nucleocapsid gene of EAV is amplified, resulting in a 170-base-pair product. Details of the primer sequences used are as follows: first TCGATGGCGTCAAGACGATCAC and GGTTCCTGGGTGGCTAATAACTACTTCAAC; second CGCAACCCACTCAGGCTATTATTG and GGTAGGAACCCAACTGACGGTG. The untreated spiked samples were all positive for EAV, whereas the sperm preparations from the spiked semen, after density gradient and swim-up, were negative for EAV. A negative control (water) and the unspiked extended ejaculate were also negative. These preliminary results indicate that the sequential technique of centrifugation on an EquiPure density gradient followed by a swim-up is potentially a useful and simple tool for the removal of EAV from the semen of shedding stallions. Further experiments will investigate whether the virus can be removed from naturally infected ejaculates. We are grateful to Prof. Twink Allen and Miss Clare Tiplady of the Equine Fertility Unit, Newmarket, UK, for providing samples of stallion semen. This study is partially funded by Eureka (E-2967).

The energetics of heterogeneous deformation in open-cell solid foams

Compressed open–cell solid foams frequently exhibit spatially heterogeneous distributions of local stretch. The theoretical aspects of this deformation habit have not been clearly elucidated. Here we propose a simple nonlinear model aimed at illustrating the most salient features of the micromechanics of uniaxially stretched solid foams. Then we study the energetics of the model to show that the stretch heterogeneity observed in experiments stems from the lack of convexity of the governing energy functional, which favours two characteristic values of local stretch. These characteristic values are independent of the applied overall stretch and define two configurational phases of the foam. The predicted stretch distributions correspond to stratified mixtures of the phases; stretching occurs in the form of a phase transformation, by growth of one of the phases at the expense of the other. We also compare the predicted mechanical response with experimental data for a series of foams of different densities and discuss the analogy between the stretching of foams and the liquefaction of van der Waals gases. Lastly, we perform displacement field measurements using the digital image correlation technique and find the results to be in agreement with our predictions.

Ionophore toxicity in horses

Equine Veterinary EducationVolume 11, Issue 3 p. 153-158 Ionophore toxicity in horses E. A. G. Blomme, E. A. G. Blomme The Ohio State University, College of Veterinary Medicine, Department of Veterinary Biosciences, Columbus, Ohio 43210Search for more papers by this authorKrista M. D. La Perle, Corresponding Author Krista M. D. La Perle The Ohio State University, College of Veterinary Medicine, Department of Veterinary Biosciences, Columbus, Ohio 43210The Ohio State University, College of Veterinary Medicine, Department of Veterinary Biosciences, Columbus, Ohio 43210Search for more papers by this authorPamela A. Wilkins, Pamela A. Wilkins University of Pennsylvania School of Veterinary Medicine, Department of Clinical SciencesSearch for more papers by this authorF. Del Piero, F. Del Piero Department of Pathobiology, Kennett Square, Pennsylvania 19348Search for more papers by this authorJ. Hayes, J. Hayes Ohio Department of Agriculture, Diagnostic Laboratory, Reynoldsburg, Ohio 43068, USA.Search for more papers by this author E. A. G. Blomme, E. A. G. Blomme The Ohio State University, College of Veterinary Medicine, Department of Veterinary Biosciences, Columbus, Ohio 43210Search for more papers by this authorKrista M. D. La Perle, Corresponding Author Krista M. D. La Perle The Ohio State University, College of Veterinary Medicine, Department of Veterinary Biosciences, Columbus, Ohio 43210The Ohio State University, College of Veterinary Medicine, Department of Veterinary Biosciences, Columbus, Ohio 43210Search for more papers by this authorPamela A. Wilkins, Pamela A. Wilkins University of Pennsylvania School of Veterinary Medicine, Department of Clinical SciencesSearch for more papers by this authorF. Del Piero, F. Del Piero Department of Pathobiology, Kennett Square, Pennsylvania 19348Search for more papers by this authorJ. Hayes, J. Hayes Ohio Department of Agriculture, Diagnostic Laboratory, Reynoldsburg, Ohio 43068, USA.Search for more papers by this author First published: 26 April 2010 https://doi.org/10.1111/j.2042-3292.1999.tb00937.xCitations: 10AboutPDF ToolsExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Citing Literature Volume11, Issue3June 1999Pages 153-158 RelatedInformation

Where Does the Body End?

Where Does the Body End?