3-PBA Degradation Research Articles

Whole-genome sequencing of Sphingobium baderi SC-1 and identification of a crucial 3-phenoxybenzoic acid-degrading gene.

As an efficient degradation strain, Sphingobium baderi SC-1 can breakdown 3-phenoxybenzoic acid (3-PBA) with high proficiency. To investigate the internal factors that regulate this process, we conducted whole-genome sequencing and successfully identified the pivotal 3-PBA-degrading gene sca (1,230 bp). After sca was expressed in engineered bacteria, a remarkable degradation efficiency was observed, as 20 mg/L 3-PBA was almost completely decomposed within 24 h. The phenol was formed as one of the degradation products. Notably, in addition to their ability to degrade 3-PBA, the resting cells proficiently degraded 4'-HO-3-PBA and 3'-HO-4-PBA. In conclusion, we successfully identified and validated sca as the pivotal enzyme responsible for the efficient degradation of 3-PBA from Sphingomonas baderi, providing a crucial theoretical foundation for further explorations on the degradation potential of SC-1.

Synergistic effect of Ag/CuO composites on g-C3N4 nanosheets towards the visible-light active photocatalytic degradation of substituted benzoic acids in novel Ag/CuO@gCN heterojunction composites

Advanced oxidation processes (AOPs) with heterojunction-based composites have been shown to be effective for a variety of water and/or wastewater treatments. In this study, a highly efficient visible-light-driven photocatalytic composite composed of Ag/CuO@gCN ternary heterojunction based composites was successfully designed and fabricated via a facile calcination route. The uniformly assembled composites, Ag/CuO on gCN sheets were confirmed using UV–vis DRS, XRD, TEM, BET surface area, and FTIR analysis. A 15 mg/L Ag/CuO@gCN photocatalyst showed the highest photocatalytic degradation of 4-hydroxybenzoic acid (4-HBA, 95.2%) and 3-phenoxybenzoic acid (3-PBA, 81.62%) in 24 min of the reaction. The Ag/CuO@gCN composite for 4-HBA and 3-PBA degradation were obtained at a maximum degradation rate of 2.64 × 10−1 s−1 and 2.11 × 10−1 s−1, respectively and follows pseudo-first-order reactions. The photocatalytic activities for degradation of 4-HBA and 3-PBA over Ag/CuO@gCN composites are distinctly enhanced, which is higher than that of gCN and Ag/CuO composite due to lamellar configuration of gCN nanosheets and heterojunction between Ag and CuO. Furthermore, a trapping experiment was conducted to estimate the main reactive species in the degradation of 4-HBA and 3-PBA for Ag/CuO@gCN composite stability. The as-proposed Ag/CuO@gCN heterojunction composites may shed light on the design and application of materials in water purification.

Adsorption Behavior of 3-phenoxybenzoic Acid by Lactobacillus Plantarum and Its Potential Application in Simulated Digestive Juices.

3-PBA is a major degradation intermediate of pyrethroids. Its widespread existence in the environment poses a severe threat to the ecosystem and human health. This study evaluated the adsorption capacity of L. plantarum RS20 toward 3-PBA. Batch adsorption experiments indicated that the optimal adsorption conditions were a temperature of 37 °C and initial pH of 6.0–8.0, under which the removal rate was positively correlated with the cell concentration. In addition, there was no link between the incubation time and adsorption rate. The kinetic study showed that the adsorption process fitted well with the pseudo-second-order model, and the adsorption isotherms could be described by both Langmuir and Freundlich equations. Heat and acid treatments showed that the ability of strain RS20 in removing 3-PBA was independent of microbial vitality. Indeed, it was involved with chemisorption and physisorption via the cell walls. The cell walls made the highest contribution to 3-PBA removal, according to the adsorption experiments using different cellular components. This finding was further reconfirmed by SEM. FTIR spectroscopy analysis indicated that carboxyl, hydroxyl, amino groups, and –C–N were the functional sites for the binding of 3-PBA. The co-culture experiments showed that the adsorption of strain RS20 enhanced the degradation of 3-PBA by strain SC-1. Strain RS20 could also survive and effectively remove 3-PBA in simulated digestive juices. Collectively, strain RS20 could be employed as a biological detoxification agent for humans and animals by eliminating 3-PBA from foods, feeds, and the digestive tract in the future.

Characterization of deltamethrin degradation and metabolic pathway by co-culture of Acinetobacter junii LH-1-1 and Klebsiella pneumoniae BPBA052

Deltamethrin and its major metabolite 3‐phenoxybenzoic acid (3‐PBA) have caused serious threat to the environment as well as human health, yet little is known about their degradation pathways by bacterial co-cultures. In this study, the growth and degradation kinetics of Acinetobacter junii LH-1-1 and Klebsiella pneumoniae BPBA052 during deltamethrin and 3-PBA degradation were established, respectively. When the inoculum proportion of the strains LH-1-1 and BPBA052 was 7.5:2.5, and LH-1-1 was inoculated 24 h before inoculation of strain BPBA052, 94.25% deltamethrin was degraded and 9.16 mg/L of 3-PBA remained within 72 h, which was 20.36% higher and 10.25 mg/L lesser than that in monoculture of LH-1-1, respectively. And the half-life of deltamethrin was shortened from 38.40 h to 24.58 h. Based on gas chromatography–mass spectrometry, 3-phenoxybenzaldehyde, 1,2-benzenedicarboxylic butyl dacyl ester, and phenol were identified as metabolites during deltamethrin degradation in co-culture. This is the first time that a co-culture degradation pathway of deltamethrin has been proposed based on these identified metabolites. Bioremediation of deltamethrin-contaminated soils with co-culture of strains LH-1-1 and BPBA052 significantly enhanced deltamethrin degradation and 3-PBA removal. This study provides a platform for further studies on deltamethrin and 3-PBA biodegradation mechanism in co-culture, and it also proposes a promising approach for efficient bioremediation of environment contaminated by pyrethroid pesticides and their associated metabolites.

Identification of fungal enzymes involving 3-phenoxybenzoic acid degradation by using enzymes inhibitors and inducers

Pyrethroid residues in food and the environment can be bio-transformed into 3-phenoxybenzoic acid (3-PBA); It is more toxic than the parent compounds, and has been detected in milk, soil, and human urine. In this study, when incubated at 30 °C and 180 rpm for 48 h, mycelial pellets during logarithmic growth phase were obtained and washed 2 times by phosphate buffer. The cell debris solutions and filter liquor from inducible and non-inducible samples were cultured with 3-PBA and its intermediate metabolites at same condition, and the location and induction of enzymes were analyzed by the degradation. Then Cytochrome P450 (CYP450), lignin peroxidase (LiP), laccase, manganese peroxidase (MnP), and dioxygenase were selected as candidate enzymes due to these oxidases existing in the fungi and capable of degrading the contaminants with similar structures of these compounds, and CuSO4, NaN3, AgNO3, EDTA or piperonyl butoxide (PBO) were used as the enzymes inhibitors and inducers. The degradation of 3-PBA and its intermediate metabolites and the fungal biomass in presence of enzymes inhibitors and inducers was arranged to analyze the possible degrading-enzymes, and the co-metabolic enzymes and pathways can be reasoned. This study provided a promising method for studying the co-metabolic enzymes of 3-PBA degradation by fungi.•The presented MethodsX was conducted for co-metabolic enzymes and pathways of 3-PBA degradation.•The culturing condition for presenting enzyme properties were investigated.•The candidate enzymes were analyzing based on location, induction of enzymes, fungal enzyme systems and chemical structures of these compounds.

Co-metabolic enzymes and pathways of 3-phenoxybenzoic acid degradation by Aspergillus oryzae M-4.

As an intermediate metabolite of pyrethroids, 3-phenoxybenzoic acid (3-PBA) is more toxic than its parent compounds and has been detected in milk, soil, and human urine. 3-PBA can be metabolized through microbial degradation, but the microbial co-metabolic enzymes and pathways involved in 3-PBA degradation are unclear. This study investigated the enzymes types and possible pathways in the co-metabolic degradation of 3-PBA by Aspergillus oryzae M-4. The enzymes involved in co-metabolic degradation of 3-PBA and its intermediate metabolites were induced, and existed extracellularly and intracellularly except the catechol-degrading enzyme. Inhibitors and inducers of these oxidases were used to examine the enzymes required for co-metabolic degradation of 3-PBA and its intermediate metabolites. 3-PBA is hydroxylated to produce 3-hydroxy-5-phenoxy benzoic acid through the catalytic actions of lignin peroxidase (LiP). Phenol and gallic acid, the metabolites of 3-PBA, are produced via cleavage of an ether bond under the catalytic actions of cytochrome P450 (CYP450) and LiP. Phenol can be converted to catechol by LiP; catechol and gallic acid are cleaved to form long-chain olefin acid or olefin aldehyde by dioxygenase and LiP. In corn flour, some of these enzyme activators such as FeCl3, 4-cumaric acid, veratryl alcohol and sodium periodate appeared to improve 3-PBA degradation. The results provide a reliable pathway and characteristics for co-metabolic microbial degradation of 3-PBA in food and the environment.

Efficient biodegradation of 3-phenoxybenzoic acid and pyrethroid pesticides by the novel strain Klebsiella pneumoniae BPBA052.

A novel Klebsiella pneumoniae strain (BPBA052) capable of degrading 3-phenoxybenzoic acid (3-PBA) was isolated from soybean rhizosphere soil. The strain was obtained by screening after enrichment, isolation, and purification using 3-PBA as the sole carbon and energy source. It could degrade 96.37% of 3-PBA (100 mg/L) within 72 h, and its growth and 3-PBA degradation followed kinetics models of logistic growth (XBPBA052 = 0.0883 × e0.0947t / [1 - 0.0792 × (1 - 0.0883 × e0.0947t)]; μm = 0.0947 h-1, X0 = 0.0883, and Xm = 1.1145) and first-order degradation (CBPBA052 = 101.8194 × e-0.0403t, k = 0.0403, t1/2 = 17.22 h), respectively. Based on Box-Behnken response surface analysis, the optimal temperature, pH, and 3-PBA concentration for K. pneumoniae BPBA052 were 35.01 °C, 7.77, and 150 mg/L, respectively. Moreover, pyrethroid pesticides (PPs) (such as β-cypermethrin, permethrin, bifenthrin, deltamethrin, and fenvalerate) and 3-PBA metabolites (including phenol, catechol, and protocatechuate) were efficiently utilized by BPBA052. We propose a novel microbial metabolic pathway for 3-PBA, based on metabolite identification; enzyme-degrading activity; and cloning of the phenol hydroxylase, catechol 1,2-dioxygenase, and protocatechuate 3,4-dioxygenase genes. This study provides a fundamental platform for further studies to reveal the mechanism of biodegradation of 3-BPA and show K. pneumoniae BPBA052 as a potential microbial resource for bioremediation of environments polluted with 3-PBA or PPs.

Co-Metabolic Degradation of β-Cypermethrin and 3-Phenoxybenzoic Acid by Co-Culture of Bacillus licheniformis B-1 and Aspergillus oryzae M-4

The degradation efficiency of organic contaminants and their associated metabolites by co-culture of microbes is mainly limited by toxic intermediates from co-metabolic degradation. In this study, we investigated the degradation of β-cypermethrin (β-CY) and 3-phenoxybenzoic acid (3-PBA) by co-culture of Bacillus licheniformis B-1 and Aspergillus oryzae M-4, as well as the influences of β-CY and 3-PBA metabolites on their degradation and the growth of strains B-1 and M-4. Our results indicated that 100 mg/L β-CY was degraded by 78.85%, and 3-PBA concentration was 0.05 mg/L after 72 h. Compared with using only strain B-1, the half-life (t1/2) of β-CY by using the two strains together was shortened from 84.53 h to 38.54 h, and the yield coefficient of 3-PBA was decreased from 0.846 to 0.001. At 100 mg/L of 3-PBA and gallic acid, β-CY and 3-PBA degradation were only 17.68% and 40.45%, respectively. As the toxic intermediate derived from co-metabolic degradation of β-CY by strain B-1, 3-PBA was efficiently degraded by strain M-4, and gallic acid, as the toxic intermediate from co-metabolic degradation of 3-PBA by strain M-4, was efficiently degraded by strain B-1. These results provided a promising approach for efficient biodegradation of β-CY and 3-PBA.

Degradation of 3-phenoxybenzoic acid by a filamentous fungus Aspergillus oryzae M-4 strain with self-protection transformation.

A novel filamentous fungus M-4 strain was isolated from soy sauce koji and identified as Aspergillus oryzae (Collection number: CGMCC 11645) on the basis of morphological characteristics and internal transcribed spacer sequence. M-4 could degrade 80.62% of 3-phenoxybenzoic acid (3-PBA; 100mgL-1) within 5days. 3-PBA degradation occurred in accordance with first-order kinetics. The degradation metabolites of 3-PBA were identified through high-performance liquid chromatography-mass spectrometry (HPLC-MS). Relevant enzymatic activities and substrate utilization were also investigated, which indicated that M-4 could effectively degrade the intermediates of 3-PBA. Base on analysis of these metabolites, a novel biochemical pathway for the degradation of 3-PBA was proposed. There exists a mutual transformation between 3-phenoxy-benzyl alcohol and 3-PBA, which was firstly reported about the degradation of 3-PBA and may be attributed to self-protection transformation of M-4; subsequently, 3-PBA was gradually transformed into phenol, 3-hydroxy-5-phenoxy benzoic acid, protocatechuic acid and gallic acid. The safety of M-4 was evaluated via an acute toxicity test in vivo. The biodegradation ability of M-4 without toxic effects reveals that this fungus may be likely to be used for eliminating 3-PBA from contaminated environment or fermented foods.

PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1 T

The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

Degradation of 3-Phenoxybenzoic Acid by a Bacillus sp

3-Phenoxybenzoic acid (3-PBA) is of great environmental concern with regards to endocrine disrupting activity and widespread occurrence in water and soil, yet little is known about microbial degradation in contaminated regions. We report here that a new bacterial strain isolated from soil, designated DG-02, was shown to degrade 95.6% of 50 mg·L−1 3-PBA within 72 h in mineral salt medium (MSM). Strain DG-02 was identified as Bacillus sp. based on the morphology, physio-biochemical tests and 16S rRNA sequence. The optimum conditions for 3-PBA degradation were determined to be 30.9°C and pH 7.7 using response surface methodology (RSM). The isolate converted 3-PBA to produce 3-(2-methoxyphenoxy) benzoic acid, protocatechuate, phenol, and 3,4-dihydroxy phenol, and subsequently transformed these compounds with a q max, K s and K i of 0.8615 h−1, 626.7842 mg·L−1 and 6.7586 mg·L−1, respectively. A novel microbial metabolic pathway for 3-PBA was proposed on the basis of these metabolites. Inoculation of strain DG-02 resulted in a higher degradation rate on 3-PBA than that observed in the non-inoculated soil. Moreover, the degradation process followed the first-order kinetics, and the half-life (t 1/2) for 3-PBA was greatly reduced as compared to the non-inoculated control. This study highlights an important potential application of strain DG-02 for the in situ bioremediation of 3-PBA contaminated environments.