Cytochrome Oxidase Subunit I Gene Sequences Research Articles

Morphological and molecular characterisation of Cymothoa eremita (Brunnich, 1783) (Isopoda: Cymothoidae) from the South China Sea

A morphological description and molecular characterisation of the parasitic isopod Cymothoa eremita Brünnich, 1783, collected off the fish host Nemipterus furcosus (Valenciennes, 1830) from the South China Sea, is presented here. Since most cymothoid descriptions are primarily based on females, this paper highlights the morphological characteristics from 20 ovigerous female and 20 male C. eremita cymothoids, isolated from 300 fish individuals. Furthermore, our findings indicated significant variations in the morphological features of C. eremita, including: 1) average length and width dimensions, 2) the presence or absence of eyes, 3) the length of pleotelson, 4) the configuration of its posterior and lateral margins, and 5) the structure of the cephalon. These characteristics were compared among diverse fish host species reported in different geographical regions. Twenty one of 300 N. furcosus were infested with C. eremita, with a prevalence of 7%, and mean intensity of 1.9 (two cymothoids per individual fish) respectively. A total of 687 base pairs (bp) from the mitochondrial cytochrome oxidase subunit I (COI) gene were sequenced for C. eremita as a complementary measure to the morphological analysis undertaken in this study. These sequences were utilized to reconstruct a phylogenetic tree, incorporating our sequenced specimens and relevant sequences sourced from the GenBank database. The Maximum Likelihood (ML) phylogenetic tree comprised 45 cymothoid species, with partial COI gene sequences showing monophyletic clustering of most species within the same genus, which is in congruence with their morphological divergence. Continued efforts to conduct studies on the biology, taxonomy, ecology and genetics of both cymothoid and fish host are crucial to better understand the patterns of host-parasite specificity and co-evolutionary changes, which may indirectly contribute towards cymothoid speciation and diversification.

DNA barcoding delineates the identity of invasive South American sucker mouth armoured catfishes of genus Pterygoplichthys of East Kolkata Wetland, West Bengal, India as single species

Invasive suckermouth armoured sailfin catfishes of Pterygoplichthys genus is a threat to natural fish biodiversity. Weattempted to identify suckermouth armoured sailfin catfishes, Pterygoplichthys spp. which have successfully invadedand established in the East Kolkata Wetland, using morphological and molecular techniques. Based on the colourationpattern/spot on the belly region they were categorised into three groups viz., Pterygoplichthys pardalis, Pterygoplichthysdisjunctivus and an intermediate group. In total, fin clips from 32 individuals were collected from the above three groupsand a portion of mitochondrial cytochrome oxidase subunit-I (COI) gene was sequenced using Sanger’s method. Out of the32 individuals, good quality sequences were obtained for 30 individuals. Surprisingly, mtDNA COI gene sequence analysisrevealed that a sequence length of 581 bp was identical among all individuals. Species level barcode records from BOLDdatabase revealed the identity of specimens in all categories as P. pardalis. Results of the study suggest that Pterygoplichthysestablished in East Kolkata Wetland might have originated from a single reproducing entity. Keywords: Cytochrome oxidase subunit1, East Kolkata Wetland, Mitochondrial DNA, Pterygoplichthys, Suckermouthsailfin catfish

A genetic approach for authentication on morphological differences of cultivated pompano species in Indonesia

Abstract. Hakim AA, Dikrurahman, Muhlis S, Astuti RP, Sari DW, Kamal MM. 2022. A genetic approach for authentication on morphological differences of cultivated pompano species in Indonesia. Biodiversitas 23: 4561-4569. Due to the increasing demand for animal protein, the Batam Marine Cultivation Fisheries Center (BPBL Batam) developed pompano (Trachinotus spp.) for aquaculture. Because of the different external characteristics, local communities recognized three types of pompano, i.e., bintang, emas, andhibridpompano. The study aimed to prove the authenticity of cultivated pompano (Trachinotus spp.) with morphological differences based on a DNA barcoding approach with 16S ribosomal RNA and cytochrome oxidase subunit I (COI) partial genesequences. A total of 30 barcode sequences from COI and 16S rRNA genes were obtained from three types of pompano, and all samples were validated as Trachinotus blochii with percent identity of 99.85-100% by COI and 100% by 16S rRNA. Emas, bintang, and hibrid pompano also have the same or very similar GC content both based on COI and 16S rRNA sequences. The average genetic distances calculated between species in the genusTrachinotus were 0.09 and 0.02 among COI and 16S rRNA sequences, respectively. Phylogenetic analysis constructed from COI and 16S rRNA gene sequences of all types of pompano and related species segregated genus into one clade (T. blochii) and the outgroup (other species) as another clade. This study contributed essential genetic data to the NCBI database both COI and 16S rRNA gene sequences. Despite having morphological differences, all types of pompano were successfully authenticated into the same species because they have identical nucleotide base arrangements and can be presumed from the same ancestor.

Molecular Diversity of Far-Eastern Trematodes of the Genus Crepidsotomum (Allocreadiidae) by Means of Nuclear 28S rRNA and Mitochondrial COI Gene Sequences

The ribosomal 28S rRNA and mitochondrial cytochrome oxidase subunit I (COI) gene fragments variation of several Crepidostomum species, collected from different fish species in Japan and south of Russian Far East, was estimated. On the basis of these data, taxonomical and population genetic structure conclusions for these trematodes were studied. Results of the analysis of the COI gene-based median-joining network indicate the presence of at least five groups of haplotypes that can be distinguished on the basis of definitive host-specificity. Genetic differentiation between these groups has been estimated. Occurrence of C. metoecus and C. farionis and the presence of at least one new Crepidostomum species in Japanese parasite fauna have been confirmed. Ribosomal 28S rDNA-based median-joining analysis indicates low diversity of several Crepidostomum species, reported in latest studies. Critical comments about the evidence of validity of the genus Stephanophiala and species Crepidostomum nemachilus were provided.

Genetic diversity of Springtails (Collembola Subclass) Based on Cytochrome oxidase Subunit I (COI) Genes in Malang

The springtails belongs to the Collembola subclass of the insect class. Springtails is a mesofauna insect that acts as a detritivore and bio-indicator in ecosystem. Genetic diversity is influenced by the total amount of genetic variation present in the genes coding for a species or organism. COI gene is a gene that is useful as a genetic marker for mitochondrial DNA. The genetic diversity of springtails based on mtDNA COI gene sequences is not widely known in Indonesia. Based on this, this study aims to reveal the genetic diversity of springtails in Malang. This research was conducted by 3 locations in Malang (Cangar, Bedengan and Tambakasri). Measurements of the microclimate (humidity and air temperature) and altitude measurements were carried out at springtails sampling site, then carried out the DNA isolation process from the springtails samples obtained, the COI amplification process and sequencing were carried out. After obtaining the sequence data, genetic diversity analysis and polymorphism analysis were carried out. The results of this study were the target genes amplified from all samples of spring tails with DNA fragments along 677-683 bp. The sample of springtails had a genetic identity match with Homidia socia Denis and Homidia cingula Börner based on the BLAST analysis, results of genetic diversity analysis showed that the samples tested had high genetic diversity, composition of nucleotide bases A/T was 60,8%, genetic variation in the form of transition substitution (87 sites) and transversion (55 sites), and the results of polymorphism analysis showed the value of 0,18201 nucleotide diversity, number of segregation was 162 sites and sequences conservation was 0,744.

Phylogenetic Analysis of the Dominant Non-biting Midge Forcipomyia bikanni (Diptera: Ceratopogonidae) around West Lake, Hangzhou, China

Abstract The nonbiting midges are tiny insects with a wide distribution around West Lake, China. In this study, the seasonal dynamics of the local dominant midge species was investigated. Phylogenetic trees of this species also were analyzed to discover its evolutionary history. Ultraviolet (UV) light traps were used for surveillance around West Lake in the period from April 2017 to November 2018. External morphological identification was performed using a stereomicroscope. Two genes of adult female midges that encoded the cytochrome oxidase subunit I (COI) and internal transcribed spacer 1 (ITS-1) were sequenced and aligned online using GenBank nucleotide database and the Molecular Evolutionary Genetics Analysis (MEGA) software 10.1.7. According to the field surveillance in 2017–2018, Forcipomyia bikanni Chan and LeRoux (Diptera: Ceratopogonidae) is the representative dominant species of West Lake, with its activity peaking in August and October. The COI and ITS-1 gene sequences of F. bikanni (XH01-5) were 523 bp and 315 bp, respectively. The final phylogenetic tree of the COI implied that F. bikanni (XH01-5) has 97.9% significant similarity with conspecific F. bikanni (LC015045) from the adjacent Fujian Province, China (E-value ≤ 0.1%). Furthermore, the ITS-1 sequences with 98% likelihood showed the highest linkage between F. bikanni (XH01-5) and F. townsvillensis (Taylor) (HM775502-HM775504) with different branches. Thus, the final unrooted phylogenetic trees of COI and ITS-1 are essential tools for reconstructing the evolutionary histories of nonbiting midges.

Molecular Identification of Hawkmoths (Lepidoptera: Sphingidae) in Selected Areas of Mt. Kitanglad Based on Cytochrome Oxidase Subunit I (COI) Gene Sequence

The study was conducted for the identification of selected species of family sphingidae through DNA Barcoding in Mt. Kitanglad Lirongan, Lantapan, Bukidnon, Philippines. Thirteen species were collected namely: Acherontia lachesis, Agrius convolvuli, Ambulyx staudingeri, Amplypterus panopus mindanaoensis, Daphnis hypothous, Gnathothlibus erotus erotus, Hippotion brunneum, Hippotion echeclus, Psilogramma menephron, Theretra nessus, Theretra rhesus, Theretra manilae and Theretra sugii. Isolation of the genomic DNA was carried out using the QIAGEN Blood & Tissue Kit. Mitochondrial cytochrome oxidase (COI) gene amplification was carried out using LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers producing 656-666 base pairs were obtained from 30 samples of sphingid moth species. BLAST analyses were able to identify sphingid to the species level. BLAST hits of COI gene sequence of all 10 species ranged from 95%-99% similarity. Maximum likelihood (ML) and Bayesian inference (BI) was used to examine phylogenetic signals in COI with the highest bootstrap values. Sphingid moths formed a monophyletic group based on the clade.

DNA barcoding of lamp shells (Brachiopoda: Lingula anatina) from Probolinggo, East Java, Indonesia

Abstract. Ambarwati R, Rahayu DA, Rachmadiarti F, Khaleyla F. 2021. DNA barcoding of lamp shells (Brachiopoda: Lingula anatina) from Probolinggo, East Java, Indonesia. Biodiversitas 22: 1764-1774. Lingula anatina is one of brachiopods found in tropical regions, however, the reports on this species from South East Asia is currently limited. This study, therefore, aims to identify the Cytochrome Oxidase subunit I (COI) sequence and phylogenetic of lamp shells from Probolinggo, Indonesia. A total of five samples of lamp shells were collected from Probolinggo, Indonesia, then identified based on morphological characters, and the identification was confirmed using molecular data. Subsequently, molecular characterization and identification were conducted based on 657 bp of COI gene similarity, sequence variation, genetic distance, phylogenetic topology, and BOLD System. According to the results, the Lingula species found in Probolinggo Indonesia was Lingula anatina. The median-joining network and Automatic Barcode Gap Discovery (ABGD) analysis showed this Lingula anatina population from Probolinggo had relatives of 22 haplotypes and divided into six haplogroups. Furthermore, the population belonged to the same haplogroup but had different haplotypes. Thus, this study provides more information for Lingula anatina phylogenetic and haplotype studies.

Population genetic diversity of mud crab (Scylla paramamosain) from southeast coastal regions of China based on mitochondrial COI gene sequence.

Mud crab (Scylla paramamosain) is a native and economically important species in East Asia. In order to provide a comprehensive genetic background for the resource protection and management in this species, the genetic diversity and population structure of S. paramamosain were analyzed based on mitochondrial cytochrome oxidase subunit I (COI) gene sequence. Totally, 599 individuals were sampled from 20 populations, including 18 wild and two cultured populations from five provinces along southeastern coast of China. After the sequencing of a 638bp fragment of COI gene, 84 variable sites were found and no insertion or deletion was detected. The H2 (haplotype 2) was the dominant hapolotye shared by 301 individuals (50.3% of all individuals) and existed in all localities. In addition, a high percent of unique haplotypes (53 of 93 haplotyoes) was found. The average nucleotide diversity (π) of all populations was 0.00194, ranging from 0.00010 (NHF1) to 0.00305 (SHCM). The haplotype diversity (h) ranged from 0.067 (NHF1) to 0.876 (CM) with an average 0.738. All of the populations showed high h (>0.5) except NHF1. Genetic distance ranged from 0.00063 to 0.00337 between populations and from 0.00010 to 0.00374 within populations. The molecular variance analysis (AMOVA) showed that the total genetic variation mainly occurred within populations (99.68%) and only 0.32% was contributed by among populations variation. No significant genetic differentiation was observed among all wild populations except that between BA and SHCM (Fst=0.0.05707, P<0.05), indicating a low level of genetic differentiation among localities. It is worth to note that two progeny population (HNF1 and NHF1) showed significantly different genetic variation, which suggested that a large quantity of parents could help to improve the genetic diversity of progeny populations.

Population Genetic Diversity and Structure of Thrips tabaci (Thysanoptera: Thripidae) on Allium Hosts in China, Inferred From Mitochondrial COI Gene Sequences.

Thrips tabaci Lindeman is a widely distributed agricultural pest China, which causes damage to many vegetables and cash crops. However, the population genetic variation of this pest in China remains unknown. In this study, the genetic diversity and structure of T. tabaci on Allium hosts collected from 12 geographic locations were evaluated based on mitochondrial cytochrome oxidase subunit I (COI) sequences. Six haplotypes were identified in 247 T. tabaci individuals from 12 geographic locations. All the identified T. tabaci haplotypes were thelytokous populations. The strongest genetic differentiation and relatively low gene flow were found between QHXN and other locations, which might be due to geographic barriers, such as high altitude Qinghai-Tibet Plateau. The lowest genetic variation was found in eastern and southern regions, with only one haplotype identified. The Mantel test showed no correlation between genetic distance and geographical distances. High gene flow between locations with substantial geographical distances suggested that migration of T. tabaci across China might be facilitated through human activities. The results of demographic analysis suggested that T. tabaci in China have undergone a recent demographic expansion. The possible influences of T. tabaci invasion history and human activities on the current haplotype geographical distribution were interpreted and the implications of these findings for T. tabaci management were discussed.

The record of Alveonasus canestrinii and Hyalomma marginatum (Acari:Ixodoidea) parasitizing partridge, Alectoris chukar (Aves: Phasianidae) in Iran

ABSTRACTThe present study records two species of ticks on Alectoris chukar partridge in Iran. Totally, 40 immature tick specimens were collected from 15 birds in Fars province, Southern Iran. A fragment of the cytochrome oxidase subunit I (COI) was sequenced in both of the tick samples. The tick specimens were identified morphologically as Hyalomma sp. and Alveonasus sp. According to the BLAST identity of COI gene sequence, ticks were identified as Hyalomma marginatum Koch and Alveonasus canestrinii Birula. This study is the first and second record of A. canestrinii and H. marginatum on Chukar partridge, respectively.

Mitochondrial Gene Sequence (COI) Reveals the Genetic Structure and Demographic History of Lymantria dispar (Lepidoptera: Erebidae: Lymantriinae) in and around China.

The gypsy moth, Lymantria dispar, is among the most destructive quarantine pests of forests. Here, we reconstructed the genetic structure and determined the population differentiation of gypsy moths across its distribution range at different times. This information could be used to both improve the prevention and detection of gypsy moths in the field. Using 31 newly designed species-specific primers targeting fragments of 216–1102 bp, we identified 103 full-length cytochrome oxidase subunit I (COI) gene sequences from eight fresh samples and 95 L. dispar specimens collected between 1955 and 1996, mainly in China. Combining 103 full-length COI gene sequences with 146 COI gene sequences from Genbank or DNA barcode libraries, we analyzed the genetic differentiation, gene flow and haplotypes between gypsy moth populations in order to reflect the genetic structure and population dynamics of gypsy moths. We discovered 25 previously unknown haplotypes from old gypsy moth specimens. We found that the genetic diversity among gypsy moth populations (collected in the same region at different time points) was relatively high. Furthermore, the genetic structure of Chinese geographical populations (Heilongjiang, Liaoning, Beijing) in different years was distinct. Our results suggested that some gypsy moths in China showed the genetic affinity with European gypsy moths (a sub-species of gypsy moths found mainly in Europe).

Molecular differentiation of epigeic and anceic forms of Drawida ghilarovi Gates, 1969 (Moniligastridae, Clitellata) in the Russian Far East: Sequence data of two mitochondrial genes

Mitochondrial cytochrome oxidase subunit I (COI) and 16S rRNA gene sequence data were analysed for 43 specimens of Drawida ghilarovi – earthworms of a tropical genus on the northern boundary of their natural habitat, including two ecological forms and three colour morphs collected from different regions of the southern Russian Far East. Intraspecific genetic differentiation of these clitellata was analysed with different criteria that characterise different forms and morphs. A sample of anecic worms was shown to possess higher genetic variation than a sample of epigeic worms. Haplotype network reconstructions showed that the meadow-swamp epigeic black-coloured D. ghilarovi is more highly diverged from the anecic forest grey- and brown-coloured worms than the grey and brown colour morphs are from each other. Genetic differentiation between three colour morphs ranged from 9.89 ± 0.58 to 11 ± 0.59% using COI and 16S data. An AMOVA test and an exact test showed a high probability of non-differentiation between grey and brown earthworms. A multimodal mismatch distribution was revealed for the whole D. ghilarovi sample and for each colour morph. The minimum spanning tree showed that the differentiation of specimens is associated with ecological and geographical criteria. Molecular data for Drawida showed high genetic differentiation between epigeic and anecic using COI and 16S gene sequence data as well as the various phylogenetic relationships among the studied forms. The anecic earthworms possibly represent different genetic lineages of the D. ghilarovi species complex. The epigeic Drawida, based on the complex data, can be considered a new species of this genus.

Molecular identification of zoantharians from around Hormuz, Qeshm and Kish islands, the Persian Gulf

Zoantharians have an important ecological role in marine ecosystems. However, only a few studies have been conducted on the zoantharians of the Persian Gulf (PG). In the current study, mitochondrial 16S ribosomal DNA (16S rDNA) and cytochrome oxidase subunit I (COI) regions of zoantharian colonies from Hormuz, Qeshm and Kish islands were amplified by polymerase chain reaction (PCR) and directly sequenced. Based on obtained 16S rDNA and COI gene sequences, three species-level clades were identified including Zoanthus sansibaricus, Palythoa tuberculosa and Palythoa aff. mutuki, all of which have been previously reported from the PG. In spite of morphological similarity of Palythoa aff. mutuki to Palythoa mutuki, mitochondrial DNA sequences obtained from these specimens resolved in a highly supported species-level clade. Since zoantharian identification studies are scant in other parts of the PG, further studies using both nuclear and mitochondrial markers are required to investigate the origins of this putative new species and to further complete the knowledge of zoantharian diversity in the region.

MOLECULAR PHYLOGENY OF SELATIUM BROCKII AND NANOSESARMA MINUTUM GRAPSID CRABS INFERRED FROM COI GENE

The phylogenetic relationship of the two grapsid crabs Selatium brockii and Nanosesarma minutum collected from mangrove creeks have been studied corresponding to the mitochondrial genome cytochrome oxidase subunit I (COI) gene. Genomic DNA was isolated from the claw muscle of the two crabs Selatium brockii and Nanosesarma minutum. The COI gene of the crabs was amplified and sequenced. The phylogenetic tree was constructed from the COI gene sequence. Present findings show that the genetic relationship between these two species to be 74% and both the species show 99% similarity to Parasesarma erythrodactyla strain MSCAS9 (KX018517), a red handed shore crab found in the mangrove creeks. COI gene could be a useful molecular marker to determine the monophyly of a crustacean family. No earlier reports were available on the molecular phylogeny of currently studied species. Increase in the taxon sampling of COI gene sequences from different groups could be a promising methodological resolution for determining the genetic divergence of the species.

First Record of Tylosurus crocodilus (Péron &amp; Lesueur, 1821) (Beloniformes: Belonidae) from Odisha Coast, Bay of Bengal, India: Exploration of a Biological Invasion Using DNA Barcoding

Adult hound needlefish Tylosurus crocodilus (Peron & Lesueur, 1821) were collected from the Buxipalli fish landing center (FLC) of Gopalpur-on-sea, Odisha coast. Using conventional morpho-taxonomy methods, the fish was morphologically identified as Tylosurus crocodilus (Peron & Lesueur, 1821) belonging to the family Belonidae. The capture of the hound needlefish of the Odisha coast is of particular interest in that it represents an early extension to the known range of this species in the north-eastern part of Bay of Bengal and the first record in Odisha coast. In order to ascertain the phylogenetic relationships with other allied species and to understand the genetic uniqueness of the fish, DNA barcoding approach was attempted, which is reportedly known as a promising tool to aid species identification over the traditional morpho-taxonomy or cyto-taxonomy methods. Cytochrome Oxidase subunit I (COI) gene sequence of the mitochondrial genome, which acts as a marker for discriminating a species from the other, was analyzed. No stop codons, insertions or deletions were found in the amplified sequences, showing that they constitute functional mitochondrial COI sequence. The amplified COI gene sequence exhibit unique barcode haplotype which permitted the discrimination of species. The phylogenetic trees revealed distinct clusters in concurrence with the taxonomic status of the species. Morphometric, meristic and molecular data confirmed the first record of Tylosurus crocodilus in Odisha coast of Bay of Bengal.

Population genetic diversity of Chinese sea bass (Lateolabrax maculatus) from southeast coastal regions of China based on mitochondrial COI gene sequences

Chinese sea bass (Lateolabrax maculatus), an important commercial and recreational fishery species in China, whose natural resources have decreased dramatically for decades due to overfishing and environmental changes. To provide guidelines for the source conservation and management, genetic diversity and population structure of L. maculatus were analyzed based on the mitochondrial cytochrome oxidase subunit I (COI) gene. Totally 192 individuals were sampled from five locations: Qingdao (QD), Chongming (CM), Dongtou (DT), Lieyu (LY) and Fangcheng (FC). After sequencing of a 586 bp fragment of COI gene, 20 haplotypes were defined. H4 (haplotype 4) and H8 were the dominant haplotypes and existed in all populations. Haplotype diversity (Hd) and nucleotide diversity (π) of each population ranged from 0.572 to 0.721 and from 0.00129 to 0.00271, respectively. The highest Hd and π were found in DT and LY populations, while the lowest value of Hd and π were in the QD population. Genetic distance ranged from 0.0031 to 0.0027 within populations and from 0.0018 to 0.0035 between populations. Analysis of molecular variance (AMOVA) revealed that significant genetic divergence was found in QD and FC populations. In addition, neutrality tests and mismatch distribution analysis indicated that this species experienced potential population expansion events.

Molecular diversity of thrips on rabi/summer groundnut in North Karnataka

Molecular Diversity of Thrips on Rabi/Summer Groundnut in North Karnataka Thrips population was collected on Rabi/summer groundnut from six geographical regions viz., Kerur (Bagalkot; Badami), Korti (Bagalkot; Bilgi), Devapur (Vijayapur) and Handigona (Uttar Kannada; Kumta), Narendra (Dharwad) and Naregal (Gadag). Genomic DNA was isolated and subjected to molecular analysis of COI gene and the results of COI gene sequences of all the six geographical locations indicated as Scirtothrips dorsalis cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial. The sequence comparison revealed that there is more than 94 per cent similarity with NCBI published sequence of S. dorsalis COI gene (KM355471.1) between the thrips samples of all the six locations. The sequences of all the six population were compared using alignment editor ‘Bioedit’. There was no sequence variation among the six population(isolates) for the 190 bp region of cytochrome oxidase I (COI) gene, indicating that the populations were similar with respect to this region of cytochrome oxidase I (COI) gene.....

Molecular identification of ascidians from the Palk Bay Region, Southeast coast of India

Background: More than 50 ascidian species distributed in the Palk Bay, Southeast coat of India. Up to a very few molecular work has been performed to determine the evolutionary relationships of ascidians in the world. Objectives: Present study explored the value of mtDNA data in assessing phylogenetic relationships within the family Ascidiacea, Didemnidae, Styelidae, and molecular identification of ascidians from the Palk Bay, Southeast coast of India. Materials and methods: The phylogeny analysis was executed based on mitochondrial cytochrome oxidase subunit I (COI) sequences of ascidian species. A BLASTN search can be run to determine the similarity of an unknown DNA sequence (query) with the collection of all known DNA sequences in GenBank. Result: The BLASTN results showed that Didemnum candidum, Ascidia ahodori and Styela clava match the other listings for these species in GenBank. Mitochondrial COI gene sequences of collected ascidians were submitted to GenBank and obtained the accession numbers. Conclusion: This study is the first report of molecular identification of ascidian species of the Palk Bay, Southeast coast of India. This information about Palk Bay ascidian communities provides a baseline of general biodiversity of that ecosystem.

Diversity of shallow water zoantharians in Hengam and Larak Islands, in the Persian Gulf

Zoantharians are one of the least studied orders of benthic cnidarians of the Persian Gulf. A survey and molecular analysis was conducted to determine zoantharian species diversity in the Persian Gulf. For this purpose, 63 colonies of zoantharians were collected from Hengam and Larak Islands in the Strait of Hormuz and some morphological characteristics of each specimen were recorded, i.e. sand encrustation, polyp shape and colour, oral groove, oral zone and oral disc colours as well as tentacle number and colour. After DNA extraction, mitochondrial 16S ribosomal DNA (16S rDNA) and cytochrome oxidase subunit I (COI) were amplified by polymerase chain reaction (PCR). Based on obtained 16S rDNA and COI gene sequences, five putative species-level clades were identified:Zoanthus sansibaricus(N = 30),Palythoa tuberculosa(N = 12),Palythoa mutuki(N = 2),Palythoaaff.mutuki(N = 18) andNeozoanthussp. Iran (N = 1). While the first three are known species, the last two were potentially novel undescribed species.Palythoaaff.mutukihas an external appearance similar toPalythoa mutuki. However, mitochondrial DNA sequences obtained from these specimens placed them in a previously undescribed species group. TheNeozoanthusspecimen was morphologically and molecularly different from other describedNeozoanthusspecies. This is the first record of this genus from the Persian Gulf and neighbouring areas. Since there is not much work on zoantharians identification in the Persian Gulf, further sampling and investigation is needed to speculate on the accuracy of these potentially new species and to complete the knowledge of zoantharian diversity in this area.