cydAB Expression Research Articles

Induction of the cydAB Operon Encoding the bd Quinol Oxidase Under Respiration-Inhibitory Conditions by the Major cAMP Receptor Protein MSMEG_6189 in Mycobacterium smegmatis.

The respiratory electron transport chain (ETC) of Mycobacterium smegmatis is terminated with two terminal oxidases, the aa3 cytochrome c oxidase and the cytochrome bd quinol oxidase. The bd quinol oxidase with a higher binding affinity for O2 than the aa3 oxidase is known to play an important role in aerobic respiration under oxygen-limiting conditions. Using relevant crp1 (MSMEG_6189) and crp2 (MSMEG_0539) mutant strains of M. smegmatis, we demonstrated that Crp1 plays a predominant role in induction of the cydAB operon under ETC-inhibitory conditions. Two Crp-binding sequences were identified upstream of the cydA gene, both of which are necessary for induction of cydAB expression under ETC-inhibitory conditions. The intracellular level of cAMP in M. smegmatis was found to be increased under ETC-inhibitory conditions. The crp2 gene was found to be negatively regulated by Crp1 and Crp2, which appears to lead to significantly low cellular abundance of Crp2 relative to Crp1 in M. smegmatis. Our RNA sequencing analyses suggest that in addition to the SigF partner switching system, Crp1 is involved in induction of gene expression in M. smegmatis exposed to ETC-inhibitory conditions.

Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.

A role for DNA supercoiling in the regulation of the cytochrome bd oxidase of Escherichia coli.

The cydAB operon of Escherichia coli encodes cytochrome bd, a terminal oxidase in the aerobic respiratory chain. The high oxygen affinity of this oxidase explains its increased synthesis under low-oxygen conditions. Expression of the cydAB operon is controlled by the ArcA/ArcB two-component system and the oxygen-sensing transcriptional regulator Fnr. However, cydAB expression is still induced upon entry into stationary phase or following a shift to anaerobic conditions in a mutant deleted for arcA and fnr [Cotter, P. A. & Gunsalus, R. P. (1992), FEMS Microbiol Lett 91, 31-36]. Indeed, such a mutant contains 60% of the wild-type levels of spectrally detectable cytochrome bd. A possible mechanism to account for this regulation is that changes in negative supercoiling, which occur during a shift to low-oxygen or anaerobic conditions, may contribute to the regulation of the cydAB operon. This paper reports several lines of evidence in support of this idea. Firstly, the expression of cydAB, and the final level of spectrally detectable cytochrome bd, is sensitive to inhibitors of DNA gyrase, the enzyme responsible for introducing negative supercoils into DNA. Both nalidixic acid and novobiocin reduce cydA-lacZ expression in a concentration-dependent manner. Secondly, in a gyrA mutant, defective in DNA gyrase activity, expression of cydAB is reduced to a basal level that is no longer sensitive to the oxygen status. Both gyrase inhibitors and the gyrA mutation reduce cydAB expression in a strain deleted for arcA and fnr, indicating that their effects are not mediated indirectly through ArcA or Fnr, but rather that they are likely to be direct effects on cydAB expression. In conclusion, the authors have shown that changes in DNA supercoiling play a role in the induction of cydAB expression and may provide a general way of increasing cytochrome bd levels in the cell in response to environmental stress.

Interplay between three global regulatory proteins mediates oxygen regulation of the Escherichia coli cytochrome d oxidase (cydAB) operon.

The Escherichia coli cydAB operon, encoding the subunits of the high-affinity cytochrome d oxidase, is maximally transcribed in microaerobiosis as a result of the combined action of the oxygen-responsive regulators Fnr and ArcA. Here, we report that the histone-like protein H-NS is an aerobic repressor of cydAB expression. ArcA is shown to antagonize H-NS action to render cydAB expression insensitive to H-NS repression in anaerobiosis. The targets for H-NS-mediated aerobic repression are the four oxygen-regulated promoters, designated P1, P2, P3 and P4. H-NS control is the result of H-NS binding to an extended region within the cydAB promoter element, including sequences upstream from and overlapping the four regulated promoters. We propose a regulatory model in which oxygen control of cydAB transcription is mediated by three alternative protein-DNA complexes that are assembled sequentially on the promoter region as the cells are shifted from aerobic to microaerobic and to anaerobic conditions. According to this model, ArcA-P plays a central role in cydAB regulation by antagonizing H-NS repression of cydAB transcription when oxygen becomes limiting. This allows peak gene expression and subsequent repression by Fnr under fully anaerobic conditions.

Oxygen regulation of the Escherichia coli cytochrome d oxidase (cydAB) operon: roles of multiple promoters and the Fnr-1 and Fnr-2 binding sites.

The Escherichia coli cydAB operon encodes the high-affinity terminal oxidase of the oxygen respiratory chain, cytochrome d oxidase. The sensor-regulator pair, ArcB-ArcA, is responsible for the microaerobic activation of the cydAB operon, whereas the anaerobic regulator Fnr represses its expression in the absence of oxygen. Fnr binds in vitro at two sites within the cydAB promoter element. To discern whether these two regions have an in vivo function in the anaerobic regulation of cydAB, the Fnr-binding motifs were mutagenized individually and in combination. The effects of these mutations on in vivo gene expression were determined by lac fusion and primer extension analysis. Our results show that the Fnr-2 site is critical for Fnr-mediated anaerobic repression of the two main cydAB promoters, P1 and P2. In contrast, the Fnr-1 site has an auxiliary role in the anaerobic repression of P1, but not of P2. Transcription from P1 did not affect ArcA-mediated activation or Fnr-mediated repression of P2, indicating that oxygen regulation is exerted on both promoters in an independent fashion. In addition, three new promoters were identified in the cydAB control region, and the 5' ends of the corresponding transcripts were mapped. Two of these promoters, designated P3 and P4, are co-ordinately regulated with P1 and P2 in response to oxygen, ArcA and Fnr. The P5 promoter is not Fnr regulated and is only weakly activated by ArcA. The contribution of these three additional promoters to the overall cydAB expression is most relevant under aerobic conditions. Our results suggest a unique repression model, in which one Fnr dimer bound to one single site (Fnr-2) is sufficient to downregulate transcription from four cydAB promoters. In conclusion, transcription of the cydAB operon is driven by a complex regulatory element containing at least five promoters that act in unison to provide adequate oxygen control of gene expression.

Regulation of Cytochrome bd Expression in the Obligate Aerobe Azotobacter vinelandii by CydR (Fnr): SENSITIVITY TO OXYGEN, REACTIVE OXYGEN SPECIES, AND NITRIC OXIDE

Azotobacter vinelandii is an obligately aerobic bacterium in which aerotolerant nitrogen fixation requires cytochrome bd. Regulation of cytochrome bd expression is achieved by CydR (an Fnr homologue), which represses transcription of the oxidase genes cydAB. cydAB mRNA was mapped by primer extension; the transcriptional start site was determined, and putative -10 and -35 regions were deduced. Two "CydR boxes," one at the +1 site and one upstream of the -35 region, were identified. Transcriptionally inactive, purified CydR was converted, by adding NifS, cysteine, and Fe(2+), into an active form possessing acid-labile sulfide and spectra suggesting a [4Fe-4S](2+) cluster. Reconstituted CydR specifically bound both CydR boxes cooperatively, with higher affinity for the nearer consensus +1 site. Low concentrations of O(2) or NO ([O(2)]/[[CydR] or [NO]/[CydR] = 0.1-0. 6) elicited loss of the 420 nm absorbance attributed to the [4Fe-4S](2+) cluster, formation of a 315 nm species, and loss of ability to retard DNA migration. Retardation by reconstituted CydR was enhanced by superoxide dismutase and/or catalase, suggesting a role for reactive oxygen species in CydR inactivation. The role of CydR in regulating cydAB expression in the supposedly anoxic cytoplasm of A. vinelandii and similarities to cydAB regulation by Fnr in Escherichia coli are discussed.

Aerobic regulation of cytochrome d oxidase (cydAB) operon expression in Escherichia coli: roles of Fnr and ArcA in repression and activation.

The cydAB operon of Escherichia coli encodes the cytochrome d oxidase complex, one of two aerobic terminal oxidases that catalyses the oxidation of ubiquinol-8 and the reduction of oxygen to water. This enzyme has a higher affinity for oxygen than the cytochrome o oxidase complex and accumulates as oxygen becomes limiting. Expression of the cydAB operon is microaerobically controlled by the ArcA/ArcB two-component regulatory system and by Fnr. To understand how ArcA and Fnr contribute to this control, a set of cyd-lacZ reporter fusions were constructed and analysed in vivo. Two cydAB promoters, designated P1 and P2, were identified by primer extension analysis and are located 288 and 173 bp upstream of the start of cydA translation respectively. Transcription from promoter P1 was shown to be regulated by both Fnr and ArcA in response to anaerobiosis. DNasel footprint experiments revealed the locations of two Fnr binding sites at the P1 promoter: one is centred at the start of cyd transcription, while the other is positioned 53.5 bp upstream. A single ArcA-phosphate binding site of 49 bp, centred 93 bp upstream of promoter P1, was identified to be sufficient for the activation of cydAB expression. Based on the results of the in vitro and in vivo studies, a working model for ArcA activation and Fnr repression of cydAB transcription is proposed.

The cydR gene product, required for regulation of cytochrome bd expression in the obligate aerobe Azotobacter vinelandii, is an Fnr-like protein.

The cytochrome bd complex in the obligately aerobic diazotroph Azotobacter vinelandii is an oxidase, which, in vivo, has a low affinity for oxygen and is required for respiratory protection of nitrogenase. Mutations caused by insertion of Tn5-B20 upstream of the structural genes (cydAB) for cytochrome bd result in over-expression of this oxidase and, for unexplained reasons, inability of the organism to grow microaerobically. Cloning and sequencing of this upstream region revealed a gene, cydR. The deduced amino acid sequence of CydR indicates that it is a new member of the Fnr Class of regulators and that it represses cydAB expression. Refined mapping data for three insertions in cydR are presented. The cloned cydR gene complemented anaerobic growth of Escherichia coli fnr mutants and strongly enhanced expression of a narG-lacZ fusion in an E. coli fnr mutant.

Expression and Content of Terminal Oxidases in Azotobacter Vinelandii Grown with Excess NH4+ are Modulated by O2 Supply.

The influence of the rate of O2 supply to batch cultures on the contents of cytochromes bd and 'o' in NH4 +-grown Azotobacter vinelandii has been investigated. Difference spectra at room temperature (reduced + CO minus reduced) were recorded for whole cells of a wild-type strain and mutants which either lacked or over-produced the cytochrome bd-type terminal oxidase encoded by cydAB. A Tn5-B20 insertion in cydB in the former mutant also provided a means of monitoring cydAB gene expression from measurements of β-galactosidase activity. The content of cytochrome d in the wild-type, and the expression of cydAB-lacZ, in the mutant, increased as the O2 supply was raised, suggesting that O2 regulates cydAB expression even in the absence of diazotrophy. In a strain carrying a mutation in cydR, a regulatory gene upstream of cydAB, and which over-produces cytochrome bd, the responses to O2 supply during growth at different O2 supply rates were reversed. Changes in the content of a haemoprotein detectable in low temperature photodissociation spectra, and attributed to cytochrome b 595 -the high-spin cytochrome b component of the cytochrome bd complex - followed the changes in cytochrome d levels. CO difference spectra of both the wild-type strain and the cytochrome bd-deficient mutant revealed a haemoprotein with spectral characteristics similar to cytochrome o, the levels of which increased as the O2 supply was raised. These results are discussed with reference to previous reports of cytochrome changes in cells grown under N2-fixing conditions.

Contribution of the fnr and arcA gene products in coordinate regulation of cytochrome [formula omitted] oxidase ( cyoABCDE and cydAB) genes in Escherichia coli

The individual and the combined effect of the fnr and arcA regulatory gene products on cytochrome o oxidase and cytochrome d oxidase gene expression in Escherichia coli were evaluated using lacZ reporter fusions to the cyoABCDE and cydAB operons. Fnr repressed cyolacZ and cyd-lacZ expression during anaerobic growth but not during aerobic growth conditions. ArcA functioned as an anaerobic repressor of cyo-lacZ expression while, in contrast, it activated cydAB expression during both aerobic and anaerobic growth. ArcA and Fnr appear to function independently of each other to control cyoABCDE operon expression. In contrast, FNR repression of cydAB expression was dependent on arcA +, as indicated by the inability of fnr + plasmids to repress cyd-lacZ expression in an arcA strain. Under no conditions tested did Fnr activate cydAB expression. Most, but not all, of the observed aerobic/anaerobic regulation of cyo and cyd was accounted for by the two transcriptional regulators. These data suggest the existence of additional levels of anaerobic gene control in E. coli. Additionally, the expression of the fnr regulatory gene, and regulation of the anaerobic respiratory genes, narGHJI, dmsABC and frdABCD, was found to be independent of ArcA.

Cytochrome o (cyoABCDE) and d (cydAB) oxidase gene expression in Escherichia coli is regulated by oxygen, pH, and the fnr gene product

The aerobic respiratory chain of Escherichia coli contains two terminal oxidases that catalyze the oxidation of ubiquinol-8 and the reduction of oxygen to water. They are the cytochrome o oxidase complex encoded by cyoABCDE and the cytochrome d oxidase complex encoded by cydAB. To determine how these genes are regulated in response to a variety of environmental stimuli, including oxygen, we examined their expression by using lacZ protein fusions in wild-type and fnr mutant strains of E. coli. Anaerobic growth resulted in a 140-fold repression of cyoA'-'lacZ expression relative to aerobic growth and a 3-fold increase in cydA'-'lacZ expression. Anaerobic repression of both fusions was mediated in part by the fnr gene product, as evidenced by a 30-fold derepression of cyoA'-'lacZ expression and a 4-fold derepression of cydA'-'lacZ expression in an fnr deletion strain. Supplying wild-type fnr in trans restored wild-type repression for both fusions. Fnr thus functions as an anaerobic repressor of both cyoABCDE and cydAB expression. Reduced-minus-oxidized difference spectrum analyses of cell membranes confirmed the effect of the fnr gene product on the production of cytochrome d oxidase in the cell. Based on the pattern of anaerobic cydAB expression observed, we propose the existence of a second, as yet unidentified, regulatory element that must function either to activate cydAB expression as oxygen becomes limiting or to repress cydAB expression aerobically. Whereas cytochrome o oxidase encoded by cyoABCDE appears to be produced only under oxygen-rich growth conditions, in keeping with its biochemical properties, cytochrome d oxidase is expressed moderately aerobically and is elevated yet further when oxygen becomes limiting so that the organism can cope better under oxygen starvation conditions. We also examined cyoABCDE and cydAB expression in response to growth on alternative carbon compounds and to changes in the culture medium pH and osmolarity.