Cucurbit Chlorotic Yellows Virus Research Articles

Managing Super Pests: Interplay between Pathogens and Symbionts Informs Biocontrol of Whiteflies

Bemisia tabaci is distributed globally and incurs considerable economic and ecological costs as an agricultural pest and viral vector. The entomopathogenic fungus Metarhizium anisopliae has been known for its insecticidal activity, but its impacts on whiteflies are understudied. We investigated how infection with the semi-persistently transmitted Cucurbit chlorotic yellows virus (CCYV) affects whitefly susceptibility to M. anisopliae exposure. We discovered that viruliferous whiteflies exhibited increased mortality when fungus infection was present compared to non-viruliferous insects. High throughput 16S rRNA sequencing also revealed significant alterations of the whitefly bacterial microbiome diversity and structure due to both CCYV and fungal presence. Specifically, the obligate symbiont Portiera decreased in relative abundance in viruliferous whiteflies exposed to M. anisopliae. Facultative Hamiltonella and Rickettsia symbionts exhibited variability across groups but dominated in fungus-treated non-viruliferous whiteflies. Our results illuminate triangular interplay between pest insects, their pathogens, and symbionts—dynamics which can inform integrated management strategies leveraging biopesticides This work underscores the promise of M. anisopliae for sustainable whitefly control while laying the groundwork for elucidating mechanisms behind microbe-mediated shifts in vector competence.

Leucine 127 of Cucurbit Chlorotic Yellows Virus P22 Is Crucial for Its RNA Silencing Suppression Activity and Pathogenicity.

Plant viruses produce particular suppressors to antagonize the host defense response of RNA silencing to establish infection. Cucurbit chlorotic yellows virus (CCYV), a member of the genus Crinivirus of the family Closteroviridae, severely damages the production of economically essential cucurbits worldwide. Here, we used the attenuated zucchini yellow mosaic virus (ZYMV) vector ZAC to express individual coding sequences, including CP, CPm, P25, and P22, of a Taiwan CCYV isolate (CCYV-TW) to identify their possible roles as pathogenicity determinants. ZAC is an HC-Pro function mutant that lacks the ability of local lesion induction on Chenopodium quinoa leaves and induces mild mottling followed by recovery on its natural host zucchini squash plants. Only the recombinant expressing CCYV-TW P22 complemented the effect of ZAC HC-Pro dysfunction, causing more severe symptoms on zucchini squash plants and restoring lesion formation on C. quinoa leaves, with lesions forming faster than those generated by the wild-type ZYMV. This suggests that CCYV-TW P22 is a virulence enhancer. Sequence analysis of criniviral P22s revealed the presence of four conserved leucine residues (L10, L17, L84, and L127) and one conserved lysine residue (K185). The five P22 residues conserved among the CCYV isolates and the P22 orthologs of two other criniviruses were each substituted with alanine in CCYV-TW P22 to investigate its ability to suppress RNA silencing and pathogenicity. The results provide new insights into CCYV-P22, showing that the L127 residue of P22 is indispensable for maintaining its stability in RNA silencing suppression and essential for virulence enhancement.

Evaluation of Squash (Cucurbita pepo L.) Genotypes for Resistance to Cucurbit Chlorotic Yellows Virus

Cucurbit chlorotic yellows virus (CCYV), a Crinivirus transmitted by whiteflies, poses a significant threat to cucurbit crops globally. Summer squash (Cucurbita pepo L.), an important vegetable crop in the Southeastern United States, is particularly affected. The absence of commercially available resistant summer squash cultivars necessitates the exploration of resistant sources. Cucurbita germplasms with potential resistance to CCYV were previously identified through field screening. In this study, we describe the controlled greenhouse screening of these germplasm lines aimed at validating resistance to CCYV infection. The susceptible cultivar Gentry used as control exhibited early and severe symptoms in response to CCYV infection. In contrast, all the PI accessions tested, including PI 512749, PI 615141, PI 136448, PI 442312, PI 458731, and PI 420328, displayed delayed and less severe symptoms. Nevertheless, CCYV RNA accumulated in all the PI accessions. Lower symptom severity while harboring a considerable amount of CCYV indicates their inherent tolerance to the yellowing disease induced by CCYV. When comparing CCYV RNA accumulation in PI accessions with the commercial cultivar ‘Gentry’, lower virus titers were observed across all tested accessions. Specifically, PI 420328 and PI 458731 exhibited significantly reduced CCYV titers compared to the susceptible cultivar in both mass exposure and clip cage experiments. These accessions, displaying reduced symptoms and lower virus titers, hold promise as sources of resistance to CCYV in breeding programs. This study also highlights the importance of utilizing a reliable method to assay the resistance or tolerance of selected germplasm to infection by CCYV.

First report of cucurbit yellow stunting disorder virus infecting cucurbit crops in Jamaica.

The increasing prevalence of whitefly-transmitted viruses affecting cucurbit crops has emerged as a significant concern for global cucurbit production. Two of the most widely prevalent threats in the Americas are cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) (Crinivirus, Closteroviridae). These viruses induce similar foliar symptoms on cucurbit crops (Mondal et al., 2023) leading to loss of photosynthetic capability and decreased yields. Cantaloupe (Cucumis melo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) are major cucurbit crops in St. Elizabeth, Jamaica, which is the principal fruit and vegetable producing region of the country. In August 2018, foliar symptoms were observed on cantaloupe, watermelon, and cucumber plants in several commercial farms in St. Elizabeth. These symptoms, mainly on the older leaves, consisted of severe yellowing or interveinal mottle and they appeared more pronounced on cantaloupe and cucumber plants compared to watermelon. Growers noticed the production of smaller than normal fruit. Disease incidence ranged from 10 to 100% and whiteflies (Bemisia tabaci Gennadius) were observed in the fields. To identify virus(es) associated with the disease, six plants (cantaloupe [n = 3], cucumber [n = 1] and watermelon [n = 2) exhibiting symptoms were sampled from four fields for preliminary screening. Total RNA was extracted from leaf tissues as described in Tamang et al. (2021) and samples tested by a multiplex reverse transcription RT-PCR method that targeted the RNA-dependent RNA polymerase (RdRp) of the whitefly transmitted viruses, CYSDV, CCYV, squash vein yellowing virus (SqVYV), and the aphid- transmitted cucurbit aphid-borne yellows virus (CABYV) (Mondal et al. 2023). RT-PCR amplified the expected 494-bp fragment of the CYSDV RdRp gene (Mondal et al., 2023) from two symptomatic plants; one cantaloupe, one cucumber, as well as from CYSDV-infected control plants but not from healthy controls. Further testing was conducted during the June-August 2020 growing season after similar symptoms were observed on additional farms in St. Elizabeth and two regions, Manchester and Clarendon, located to the east of St. Elizabeth. Twenty-one cucurbit leaf samples (11 cantaloupe, seven watermelon and two cucumber from St. Elizabeth and one cantaloupe from Clarendon) exhibiting foliar yellowing progressing from the crown outward, and mottling were collected. Whiteflies (5) from these fields in St. Elizabeth and 20 asymptomatic weed samples were also collected and sent to the USDA-ARS laboratory at Salinas, CA. Total RNA from leaf samples was extracted as described above and tested for CYSDV, CCYV, and CABYV. Total leaf DNA was also extracted (Mondal et al. 2016) and assayed with PCR (Gilbertson 2001) to detect the presence of the whitefly-transmitted cucurbit leaf crumple virus (CuLCrV), a begomovirus, commonly found in the southeastern United States (Gadhave et al., 2018; Keinath et al., 2018). Nineteen of the 21 cucurbit samples tested positive for the presence of CYSDV by RT-PCR (Mondal et al. 2023). Of the 19 CYSDV-positive samples, 13 cantaloupe, one cucumber, and five watermelon samples were singly infected with CYSDV, and one cantaloupe sample was infected with both CYSDV and CABYV. Amplicons of the Jamaica isolate from cantaloupe were sequenced (OR399555) and a 494 nt section of the RdRp gene was found to share 100% sequence identity to the Arizona 1 isolate (EF547827.1). The presence of CYSDV, was further confirmed using a second set of primers that amplified a 394-nt portion of the CYSDV coat protein gene (Polston et al., 2008). Among the weed samples, CABYV was detected in one sample from a Leonotis nepetifolia plant (Lamiaceae) and two Cleome sp. (Capparaceae) collected from St. Elizabeth. None of the crop and weed samples tested positive for CCYV or CuLCrV. DNA from whiteflies was extracted and assayed with PCR using species specific primers (Chen et al. 2016). All whiteflies were identified as B. tabaci cryptic species MEAM1, which is widely known an efficient vector of CYSDV (Berdiales, et al. 1999). This is the first report of CYSDV in Jamaica and its first known occurrence in these hosts within the country. Further monitoring of cucurbit crops and the whitefly vector is warranted to better understand the epidemiology.

Distribution and Incidence of Watermelon Crinkle Leaf-Associated Virus 1, Watermelon Crinkle Leaf-Associated Virus 2, and Other Viruses in Cucurbits in South Florida

A survey of cucurbits grown in South Florida was conducted from 2020 to 2022 for viruses. A total of 481 plant samples (470 cucurbit and 11 noncucurbit) included watermelon, squash, cantaloupe, cucumber, zucchini, five weeds commonly found in cucurbit fields, and two vegetable volunteer plants growing in a watermelon field. Samples were tested for cucurbit chlorotic yellows virus, squash vein yellowing virus, papaya ringspot virus-W, watermelon crinkle leaf-associated virus 1 (WCLaV-1), watermelon crinkle leaf-associated virus 2 (WCLaV-2), cucurbit yellow stunting disorder virus (CYSDV), and cucurbit leaf crumple virus. All seven viruses were detected with WCLaV-1 as the predominant virus found in cucurbits, followed by CYSDV and WCLaV-2. The majority of samples were mixed infections containing two or more viruses. Host tissue testing found the peduncle was a good source for testing for all viruses. Host symptoms were variable on leaves for WCLaV-1 and WCLaV-2 and in mixed infections with the other five viruses. More studies are required to ascertain the role of WCLaV-1 and WCLaV-2 in mixed infections and their effects on plant health, fruit quality, and yield.

Evidence for the natural infection of cucurbit chlorotic yellows virus (CCYV) in lettuce plants from India.

In the years 2021 and 2022, lettuce plants showing blistering, chlorosis, mosaic, rosetting/ excess proliferation, and stunting symptoms were subjected to leaf-dip transmission electron microscopy, RT-PCR followed by sequence analysis and bio-assay to unfold the identity ofassociated virus(es). The association of longfilamentous virions (~ 850nm in length) as seen through leaf-dip transmission electron microscopy suggested the possible infection by a potyvirus or crinivirus, either singly or in combination. RT-PCR assays using generic primers targeting the RdRp region of criniviruses and the NIb region of potyviruses revealed the association of both a crinivirus as well as a potyvirus. The gel-purified RT-PCR products derived from the RdRp region of criniviruses upon cloning, sequencing, and NCBI BLAST analysis indicated the associated crinivirus as cucurbit chlorotic yellows virus (CCYV). Further, RT-PCR assays using specific primers targeting CP and CP minor genes of CCYV followed by cloning and sequencing confirmed its association with the diseased lettuce plants. Besides, the bioassay based on whitefly-mediated virus transmission followed by RT-PCR confirmed the infectivity of CCYV from diseased to healthy lettuce plants. The results of this study confirmed the natural infection of CCYV in lettuce host for the first time in the world indicating its distribution across the crop families.

Cucurbit chlorotic yellows virus, a crinivirus infecting Cannabis sativa plants

AbstractHigh cannabidiol‐containing plants of Cannabis sativa (high‐CBD) growing in farms in Israel displayed foliar symptoms of interveinal chlorosis and yellowing, brittleness and occasionally necrosis. These symptoms, which were more apparent in older leaves, resembled those caused by the crinivirus lettuce chlorosis virus (LCV). However, this virus was not detected by reverse transcription (RT)‐PCR using specific primer sets. High‐throughput sequencing of viral RNA extracted from symptomatic leaves revealed the presence of cucurbit chlorotic yellows virus (CCYV), a crinivirus in the Closteroviridae family. The complete viral genome sequence was obtained using RT‐PCR followed by Sanger sequencing. The two CCYV RNA genomic segments shared 99.5%–99.85% nucleotide sequence identity with CCYV isolates from the GenBank. The virus was transmitted from symptomatic cannabis leaves to healthy plants of cannabis and Cucumis sativus ‘King Star’ (cucumber) by the whitefly Bemisia tabaci Middle Eastern Asia Minor 1 (MEAM1) species, causing disease symptoms identical to those of the donor plants. Cannabis‐CCYV was also transmitted between infected cucumber plants and cannabis seedlings of unknown genotype. Severe disease symptoms of yellowing and leaf‐edge necrosis were observed on high‐CBD and high Δ9‐tetrahydrocannabinol‐containing (high‐THC) flowering cannabis plants and were associated with mixed infections of LCV and CCYV. To the best of our knowledge, this is the first report of CCYV infecting C. sativa plants.

Emergence of yellowing disease in cucurbitaceous vegetables caused by Crinivirus and Polerovirus in India

Totally 102 symptomatic samples of cucurbitaceous vegetables showing yellowing were collected from fields of Uttar Pradesh and screened by RT-PCR assay for the presence of Crinivirus and Polerovirus. Among them, Crinivirus (16%) and Polerovirus (23%) were tested positive with the universal primer pairs. Based on the sequence analysis of amplified product, two Crinivirus (Cucurbit chlorotic yellows virus - CCYV and Cucurbit yellow stunting disorder virus - CYSDV) and two Polerovirus (Cucurbit aphid-borne yellows virus - CABYV and Luffa aphid-borne yellows virus - LABYV) species were characterized. Phylogenetic analysis revealed less genetic distance among the Indian isolates of CCYV, CYSDV and LABYV whereas CABYV closely related to Chinese isolates. To the best of our knowledge, this study documents infection of CCYV on cucumber, round melon and muskmelon; CYSDV on satputia and sponge gourd; CABYV on ivy gourd; and LABYV on ridge gourd, satputia and muskmelon for the first time in India.

Differential seasonal prevalence of yellowing viruses infecting melon crops in southern California and Arizona determined by multiplex RT-PCR and RT-qPCR.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States as well as many other cucurbit production regions throughout the world. The crinivirus, cucurbit yellow stunting disorder virus (CYSDV), has severely impacted melon production in California and Arizona since its introduction to the region in 2006. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus, squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley as well. Both CYSDV and CCYV, as well as an aphid transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses both in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates these viruses from one another, and this was used to determine the prevalence and distribution these viruses in melon samples collected from fields in the Sonoran Desert melon production region of California and Arizona, USA during spring and fall melon seasons from 2019 through 2021. TaqMan probes were also developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall season, whereas CCYV was by far the most prevalent virus during spring seasons each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatio-temporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study also provides the first official report of SqVYV in Arizona, USA, and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Development of a multiplex RT-RPA assay for simultaneous detection of three viruses in cucurbits.

Begomoviruses and criniviruses, vectored by whiteflies (Bemisia tabaci), are important threats to crops worldwide. In recent years, the spread of cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) on cucurbit crops has been reported to cause devastating crop losses in many regions of the world. In this study, a multiplex recombinase polymerase amplification (RPA) assay, an isothermal technique for rapid and simultaneous detection of DNA and RNA viruses CuLCrV, CYSDV and CCYV was developed. Highly specific and sensitive multiplex RPA primers for the coat protein region of these viruses were created and evaluated. The sensitivity of the multiplex RPA assay was examined using serially diluted plasmid containing the target regions. The results demonstrated that multiplex RPA primers have high sensitivity with a detection limit of a single copy of the viruses. The multiplex RPA primers were specific to the target as indicated by testing against other begomoviruses, potyviruses and an ilarvirus, and no nonspecific amplifications were noted. The primers simultaneously detected mixed infection of CCYV, CYSDV and CuLCrV in watermelon and squash crude extracts. This study is the first report of a multiplex RPA assay for simultaneous detection of mixed infection of DNA and RNA plant viruses.

Virome Profiling, New Virus Identification and the Prevalence and Distribution of Viruses Infecting Chieh-Qua (Benincasa hispida Cogn. var. chieh-qua How) in China.

The cucurbit vegetable chieh-qua (Benincasa hispida var. chieh-qua How) is an important crop in South China and southeast Asian countries. Viral diseases cause substantial loss of chieh-qua yield. To identify the viruses that affect chieh-qua in China, ribosomal RNA-depleted total RNA sequencing was performed using chieh-qua leaf samples with typical viral symptoms. The virome of chieh-qua comprises four known viruses (melon yellow spot virus (MYSV), cucurbit chlorotic yellows virus (CCYV), papaya ringspot virus (PRSV) and watermelon silver mottle virus (WSMoV) and two novel viruses: cucurbit chlorotic virus (CuCV) in the genus Crinivirus and chieh-qua endornavirus (CqEV) in the genus Alphaendornavirus. The complete genomes of the two novel viruses in chieh-qua and three other isolates of CuCV in pumpkin, watermelon and cucumber were determined and the recombination signals of pumpkin and watermelon isolates of CuCV were detected. A reverse transcriptase PCR indicated that the dominant viruses of chieh-qua in Hainan are MYSV (66.67%) and CCYV (55.56%), followed by CuCV (27.41%), WSMoV (7.41%), cucumber mosaic virus (8.15%), zucchini yellow mosaic virus (6.67%), PRSV (6.67%) and CqEV (35.56%). Our findings support diagnostic and prevalence studies of viruses infecting chieh-qua in China, enabling sustainable control strategies for cucurbit viruses worldwide.

First report of Watermelon crinkle leaf‐associated virus 1 (WCLaV‐1) on Cucurbita pepo in the United States

Zucchini (Cucurbita pepo) is widely grown in Florida and contributes to the US$35 million value production of all types of squash in the state (United States Department of Agriculture/ National Agricultural Statistics Service, 2021). In August 2022, zucchini (cv. Renegade) in a commercial field in North Florida, USA, showed pronounced chlorosis and mild crinkle on leaves in scattered areas (Fig. 1). The disease incidence was approximately 35%. One diseased leaf from each of six zucchini plants were collected randomly for diagnosis; three from 21-day-old plants (noted as Z272), and three from 28-day-old plants (noted as Z273). All samples tested negative for Cucumber mosaic virus, Squash mosaic virus and Zucchini yellow mosaic virus using ImmunoStrips (Agdia, USA). Subsequently, total plant RNA was extracted using a Quick-RNA MiniPrep kit (Zymo Research, USA). A conventional one-step RT-PCR (New England Biolabs, USA) was used to test the samples using primer pairs for Cucurbit chlorotic yellows virus (CCYV; Jailani et al., 2022), Watermelon crinkle leaf-associated virus 1 and 2 (WCLaV-1 and WCLaV-2; genus Coguvirus) (Hernandez et al., 2021) and Watermelon mosaic virus 2 (WMV-2; 5′-AAAGCTCCATACATAGCTGAGAC-3′/ 5′-CGGCCTTCATTTGTGCTATTG-3′). The samples were negative for CCYV, WMV-2 and WCLaV-2, but positive for WCLaV-1 using specific primers for the RNA-dependent RNA polymerase (RdRP) region on RNA-1 (Table 1). To confirm the detection of WCLaV-1, specific RNA-2 primers, targeting the coding regions of movement protein (MP) and nucleocapsid protein (NP), respectively, were used in an RT-PCR assay (Table 1, Hernandez et al., 2021). The sequences of the RdRP amplicon (881 bp) (GenBank Accession No. OP484885) had 99% nucleotide identity with WCLaV-1 isolates from China (KY781184) and the USA (OL469153 and OL469154). The sequences of the MP amplicon (538 bp) (OP484884) shared 99% nt identity with Australian WCLaV-1 isolate S6 (ON934517) and American isolates “Turner” and “Wilcox-02” (OM751929 and OM751928). The NP amplicon sequences (786 bp) (OP484883) shared 99% nt identity with Chinese isolate KF-1 (KY781186) and American isolate Wig-WM-D10 (MW559081). Both the samples (Z272 and Z273) had similar results, therefore only sequences from sample Z272 were submitted to GenBank. The results were further confirmed by SYBR®-based real-time RT-PCR using the WCLaV-1 MP gene-specific primer pairs (WCLaV-1FP/WCLaV-1RP) (Adeleke et al., 2022). WCLaV-1 and WCLaV-2 were first reported in watermelon in China (Xin et al., 2017), followed by America (Hernandez et al., 2021), Brazil (Maeda et al., 2022) and Australia (Mulholland et al., 2023). To our knowledge, this is the first report of WCLaV-1 on zucchini in America and globally. The mode of transmission of the virus in currently unknown. Studies to understand the potential of vector and seed transmission should be conducted to aid the development of best management practices. In the meantime, growers will have to rely on keeping pests of zucchini crop under control, practicing tillage of plant residues, and removing weeds routinely as general good practices.

Phylogenetic Analysis of Cucurbit Chlorotic Yellows Virus from Melon in 2020 in Chungbuk, Korea

Cucurbit chlorotic yellows virus (CCYV) is a plant virus that causes damage to cucurbit crops such as watermelon and cucumber, and is transmitted by an insect vector known as the whitefly. Since CCYV was first detected on cucumber in Chungbuk in 2018, it has been reported in other areas including Gyeongsang in Korea. In 2020, we performed field surveys of yellowing diseases in the greenhouses growing melon and watermelon in Chungbuk (Jincheon and Eumseong). Reverse transcription-polymerase chain reaction analysis of 79 collected samples including melon, watermelon, and weeds resulted in detection of CCYV in 4 samples: Three samples were singly infected with CCYV and one samples was mixed infected with CCYV, Cucurbit aphid borne yellows virus, and Watermelon mosaic virus. The complete genome sequences of the four collected CCYV melon isolates (ES 1–ES 4) were determined and genetically compared with those of previously reported CCYV isolates retrieved from GenBank. Phylogenetic analyses of RNA 1 and 2 sequences revealed that four ES isolates were clustered in one group and closely related to the CCYV isolates from China. The analysis also revealed very low genetic diversity among the CCYV ES isolates. In general, CCYV isolates showed little genetic diversity, regardless of host or geographic origins. CCYV has the potential to pose a serious threat to melon, watermelon, and cucumber production in Korea. Further studies are needed to examine the pathogenicity and transmissibility of CCYV in weeds and other cucurbits including watermelon.

Incidence of Virus Diseases in Major Cultivated Areas of Watermelon and Melon in Chungbuk Province

To investigate the incidence status of viruses in major cultivated areas of watermelon and melon in Chungbuk Province, samples were collected from 2020 to 2021 in vinyl greenhouse of Jincheon and Eumseong and examined for virus infection using reverse transcription polymerase chain reaction. Of the six viruses on watermelon that was analyzed in this study, watermelons were infected with cucumber mosaic virus (CMV), watermelon mosaic virus (WMV), cucumber green mottle mosaic virus (CGMMV), and cucurbit aphid-borne yellows virus (CABYV). The incidence rate of CMV was 20.9–35.0%, WMV 0.4–15.8%, CGMMV 1.6–38.5%, and CABYV was 3.5–3.7% from 2020 to 2021. But strangely, there were no incidence of zucchini yellow mosaic virus and cucurbit chlorotic yellows virus (CCYV) during investigation. From this result, we knew the major virus was CGMMV on watermelon in Chungbuk Province. Molecular diagnosis assays of the two melon viruses, showed that melons were infected with CABYV and CCYV from 2020 to 2021. The incidence rate of CABYV was 53.9–92.2% and CCYV was 2.7–20.8%. The incidence of CABYV was high in melon cultivation of Jincheon and Eumseong, Chungbuk. Afterwards, it is necessary to establish a control management strategy for reduce the incidence of CABYV. Furthermore, we must pay attention that of CCYV even if the incidence was low.

Research on Drawing Attention to Overlooked Viruses in Plant Viruses Causing Yellowing-Type Symptoms in Cucurbitaceae

A single-stranded, positive-sense plant RNA virus called the Cucurbit chlorotic yellows virus (CCYV, Crinivirus, Closteroviridae) is comprised of RNA1 and RNA2. It is semipersistently transmitted by the whitefly Bemisia tabaci biotypes MEAM1 and MED. In 2004, CCYV was discovered on melon plants in Japan. Several other cucurbit species, as well as a range of non-species, were subsequently reported from countries such as Saudi Arabia, California, Israel, Taiwan, Sudan, Lebanon, Iran, Greece, Türkiye, Egypt, Spain, and China. Whitefly populations are frequently encountered in cucurbit cultivating areas. Virus plant diseases attributed to whiteflies are common in squash cultivation in the open field and greenhouses in Türkiye, especially in cucumbers and squash. Cucumber vein yellowing virus (CVYV), Cucurbit yellow stunting disorder virus (CYSDV), Tomato leaf curl New Delhi virus (ToLCNDV), Squash vein-yellowing virus (SqVYV) are the leading virus diseases transmitted by Bemisia tabaci. Symptoms caused specifically by these viral diseases are of the yellowing type, although they differ as intervascular yellowing, yellowing of old or young leaves, and upward curling. Besides these viruses, CCYV, a problem in cucurbits, is carried by whitefly like others, causes yellowing type symptoms, and its first record in cucumber was reported in 2017 in Türkiye. However, this virus is ignored in the production of cucurbits, it is a problem in production areas. There are major viruses cause similar symptoms with the presence of the Cucumber chlorotic yellows virus is overlooked in the symptomatological observation. In this study, we tried to reveal the difference of CCYV, which is encountered in cucurbit growing areas in Antalya and whose presence was detected by RT-PCR, from other viruses and emphasized its importance as a virus that should be considered in classical breeding studies.

What Can Be Learned by a Synoptic Review of Plant Disease Epidemics and Outbreaks Published in 2021?

A synoptic review of plant disease epidemics and outbreaks was made using two complementary approaches. The first approach involved reviewing scientific literature published in 2021, in which quantitative data related to new plant disease epidemics or outbreaks were obtained via surveys or similar methodologies. The second approach involved retrieving new records added in 2021 to the CABI Distribution Database, which contains over a million global geographic records of organisms from over 50,000 species. The literature review retrieved 186 articles, describing studies in 62 categories (pathogen species/species complexes) across more than 40 host species on six continents. Pathogen species with more than five articles were Bursaphelenchus xylophilus, 'Candidatus Liberibacter asiaticus', cassava mosaic viruses, citrus tristeza virus, Erwinia amylovora, Fusarium spp. complexes, F. oxysporum f. sp. cubense, Magnaporthe oryzae, maize lethal necrosis co-infecting viruses, Meloidogyne spp. complexes, Pseudomonas syringae pvs., Puccinia striiformis f. sp. tritici, Xylella fastidiosa, and Zymoseptoria tritici. Automated searches of the CABI Distribution Database identified 617 distribution records new in 2021 of 283 plant pathogens. A further manual review of these records confirmed 15 pathogens reported in new locations: apple hammerhead viroid, apple rubbery wood viruses, Aphelenchoides besseyi, Biscogniauxia mediterranea, 'Ca. Liberibacter asiaticus', citrus tristeza virus, Colletotrichum siamense, cucurbit chlorotic yellows virus, Erwinia rhapontici, Erysiphe corylacearum, F. oxysporum f. sp. cubense Tropical race 4, Globodera rostochiensis, Nothophoma quercina, potato spindle tuber viroid, and tomato brown rugose fruit virus. Of these, four pathogens had at least 25% of all records reported in 2021. We assessed two of these pathogens-tomato brown rugose fruit virus and cucurbit chlorotic yellows virus-to be actively emerging in/spreading to new locations. Although three important pathogens-'Ca. Liberibacter asiaticus', citrus tristeza virus, and F. oxysporum f. sp. cubense-were represented in the results of both our literature review and our interrogation of the CABI Distribution Database, in general, our dual approaches revealed distinct sets of plant disease outbreaks and new records, with little overlap. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

First Report of Cucurbit Chlorotic Yellows Virus Affecting Squash and Pumpkin in Florida

A field survey was conducted in Florida during 2020-2021 in squash and pumpkin research fields to identify the viruses associated with leaf symptoms of yellowing, crumpling, and vein yellowing. The symptoms were similar to previously reported whitefly transmitted viruses such as cucurbit leaf crumple virus (CuLCrV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV). Another potential virus of interest was the cucurbit chlorotic yellows virus (CCYV) that was recently reported on watermelon in Florida. Symptomatic leaves were tested by RT-PCR with coat protein (CP) gene-specific (GS) primers for CuLCrV, CYSDV, CCYV, and SqVYV with nuclear inclusion protein (NIa) GS primers. Amplifications for CuLCrV, CYSDV, and CCYV were detected in squash and pumpkin samples. The CCYV amplicons were further sequenced and compared with available CCYV sequences. The NCBI BLAST analysis revealed similarities of the RdRP (100%), HSP70h (99.75%), and CP (99.75%) to the Shanghai CCYV isolates (RNA KY400636 and RNA2 KY400633). To our knowledge, this is the first report of CCYV on squash and pumpkin in Florida.

Identification of an emerging cucumber virus in Taiwan using Oxford nanopore sequencing technology

BackgroundIn June 2020, severe symptoms of leaf mosaic and fruit malformation were observed on greenhouse-grown cucumber plants in Xizhou Township of Changhua County, Taiwan. An unknown virus, designated CX-2, was isolated from a diseased cucumber sample by single lesion isolation on Chenopodium quinoa leaves. Identification of CX-2 was performed. Moreover, the incidence of cucumber viruses in Taiwan was also investigated.MethodsTransmission electron microscopy was performed to examine virion morphology. The portable MinION sequencer released by Oxford Nanopore Technologies was used to detect viral sequences in dsRNA of CX-2-infected leaf tissue. The whole genome sequence of CX-2 was completed by Sanger sequencing and analyzed. Reverse transcription-polymerase chain reaction (RT-PCR) with species-specific primers and indirect enzyme-linked immunosorbent assay (ELISA) with anti-coat protein antisera were developed for virus detection in the field [see Additional file 1].ResultsIcosahedral particles about 30 nm in diameter were observed in the crud leaf sap of CX-2-infected C. quinoa plant. The complete genome sequence of CX-2 was determined as 4577 nt long and shared 97.0–97.2% of nucleotide identity with that of two cucumber Bulgarian latent virus (CBLV) isolates in Iran and Bulgaria. Therefore, CX-2 was renamed CBLV-TW. In 2020–2022 field surveys, melon yellow spot virus (MYSV) had the highest detection rate of 74.7%, followed by cucurbit chlorotic yellows virus (CCYV) (32.0%), papaya ringspot virus virus watermelon type (PRSV-W) (10.7%), squash leaf curl Philippines virus (SLCuPV) (9.3%), CBLV (8.0%) and watermelon silver mottle virus (WSMoV) (4.0%). Co-infection of CBLV and MYSV could be detected in field cucumbers.ConclusionThe emerging CBLV-TW was identified by nanopore sequencing. Whole genome sequence analysis revealed that CBLV-TW is closely related, but phylogenetically distinct, to two known CBLV isolates in Bulgaria and Iran. Detection methods including RT-PCR and indirect ELISA have been developed to detect CBLV and to investigate cucumber viruses in central Taiwan. The 2020–2022 field survey results showed that MYSV and CCYV were the main threats to cucumbers, with CBLV, SLCuPV and WSMoV were occasionally occurring.

A plant virus enhances odorant-binding protein 5 (OBP5) in the vector whitefly for more actively olfactory orientation to the host plant.

The whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) is a notorious agricultural pest and the effective vector of many plant viruses worldwide. Cucurbit chlorotic yellows virus (CCYV), exclusively transmitted by B. tabaci in a semipersistent manner, is a serious causal agent in cucurbit crops in many countries. Plant viruses can manipulate the behaviors of insect vectors to promote the spread of themselves, but underlying mechanisms are remaining unclear. In this study, our observations indicated that B. tabaci, when carrying CCYV, oriented more actively to the host plant cucumber. Transcriptome analysis and quantitative polymerase chain reaction with reverse transcription analysis showed that the odorant-binding protein 5 (OBP5) was upregulated with viral acquisition. Sequence and phylogenetic analysis showed that BtabOBP5 was highly homologous with nine OBPs from other hemipteran insects. In addition, OBP5-silenced whiteflies significantly altered their orientation behavior towards cucumber plants and towards some typical volatile organic compounds released from cucumbers. This study described a novel mechanism by which the olfactory system of vector insects could be regulated by a semipersistent plant virus, thereby affecting insect olfactory behavior and relationship with host plants. These results provided a basis for developing potential olfaction-based pest management strategies in the future. © 2022 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.