Cucumber Green Mottle Mosaic Virus Infection Research Articles

Ethylene enhances resistance to cucumber green mottle mosaic virus via the ClWRKY70-ClACO5 module in watermelon plants.

Ethylene (ET) is involved in plant responses to viral infection. However, its molecular mechanisms and regulatory network remain largely unknown. In the present study, we report that cucumber green mottle mosaic virus (CGMMV) in watermelon (Citrullus lanatus) triggers ET production by inducing the expression of ClACO5, a key gene of the ET biosynthesis pathway through transcriptome data analysis and gene function validation. The knock-down of ClACO5 expression through virus-induced gene silencing in watermelon and overexpressing ClACO5 in transgenic Nicotiana benthamiana indicated that ClACO5 positively regulates CGMMV resistance and ET biosynthesis. The salicylic acid-responsive transcription factor gene ClWRKY70 shares a similar expression pattern with ClACO5. We demonstrate that ClWRKY70 directly binds to the W-box cis-element in the ClACO5 promoter and enhances its transcription. In addition, ClWRKY70 enhances plant responses to CGMMV infection by regulating ClACO5 expression in watermelon. Our results demonstrate that the ClWRKY70-ClACO5 module positively regulates resistance to CGMMV infection in watermelon, shedding new light on the molecular basis of ET accumulation in watermelon in response to CGMMV infection.

Transcriptome and Metabolome Analyses Reveal That Jasmonic Acids May Facilitate the Infection of Cucumber Green Mottle Mosaic Virus in Bottle Gourd

Cucumber green mottle mosaic virus (CGMMV) is a typical seed-borne tobamovirus that mainly infects cucurbit crops. Due to the rapid growth of international trade, CGMMV has spread worldwide and become a significant threat to cucurbit industry. Despite various studies focusing on the interaction between CGMMV and host plants, the molecular mechanism of CGMMV infection is still unclear. In this study, we utilized transcriptome and metabolome analyses to investigate the antiviral response of bottle gourd (Lagenaria siceraria) under CGMMV stress. The transcriptome analysis revealed that in comparison to mock-inoculated bottle gourd, 1929 differently expressed genes (DEGs) were identified in CGMMV-inoculated bottle gourd. Among them, 1397 genes were upregulated while 532 genes were downregulated. KEGG pathway enrichment indicated that the DEGs were mainly involved in pathways including the metabolic pathway, the biosynthesis of secondary metabolites, plant hormone signal transduction, plant–pathogen interaction, and starch and sucrose metabolism. The metabolome result showed that there were 76 differentially accumulated metabolites (DAMs), of which 69 metabolites were up-accumulated, and 7 metabolites were down-accumulated. These DAMs were clustered into several pathways, including biosynthesis of secondary metabolites, tyrosine metabolism, flavonoid biosynthesis, carbon metabolism, and plant hormone signal transduction. Combining the transcriptome and metabolome results, the genes and metabolites involved in the jasmonic acid and its derivatives (JAs) synthesis pathway were significantly induced upon CGMMV infection. The silencing of the allene oxide synthase (AOS) gene, which is the key gene involved in JAs synthesis, reduced CGMMV accumulation. These findings suggest that JAs may facilitate CGMMV infection in bottle gourd.

Rapid defense mechanism suppression during viral- oomycete disease complex formation.

Combined infection of the host plant with pathogens involving different parasitic lifestyles may result in synergistic effects that intensify disease symptoms. Understanding the molecular dynamics during concurrent infection provides essential insight into the host response. The transcriptomic pattern of cucumber plants infected with a necrotrophic pathogen, Pythium spinosum, and a biotrophic pathogen, Cucumber green mottle mosaic virus (CGMMV) was studied at different time points, under regimes of single and co-infection. Analysis of CGMMV infection alone revealed a mild influence on host gene expression at the stem base, while the infection by P. spinosum is associated with drastic changes in gene expression. Comparing P. spinosum as a single infecting pathogen with a later co-infection by CGMMV revealed a rapid host response as early as 24 hours post-CGMMV inoculation with a sharp downregulation of genes related to the host defense mechanism against the necrotrophic pathogen. Suppression of the defense mechanism of co-infected plants was followed by severe stress, including 30% plants mortality and an increase of the P. spinosum hyphae. The first evidence of defense recovery against the necrotrophic pathogen only occurred 13 days post-viral infection. These results support the hypothesis that the viral infection of the Pythium pre-infected plants subverted the host defense system and changed the equilibrium obtained with P. spinosum. It also implies a time window in which the plants are most susceptible to P. spinosum after CGMMV infection.

Transcriptomic and metabolic profiling of watermelon uncovers the role of salicylic acid and flavonoids in the resistance to cucumber green mottle mosaic virus.

Understanding the mechanisms underlying plant resistance to virus infections is crucial for viral disease management in agriculture. However, the defense mechanism of watermelon (Citrullus lanatus) against cucumber green mottle mosaic virus (CGMMV) infection remains largely unknown. In this study, we performed transcriptomic, metabolomic, and phytohormone analyses of a CGMMV susceptible watermelon cultivar 'Zhengkang No.2' ('ZK') and a CGMMV resistant wild watermelon accession PI 220778 (PI) to identify the key regulatory genes, metabolites, and phytohormones responsible for CGMMV resistance. We then tested several phytohormones and metabolites for their roles in watermelon CGMMV resistance via foliar application, followed by CGMMV inoculation. Several phenylpropanoid metabolism-associated genes and metabolites, especially those involved in the flavonoid biosynthesis pathway, were found to be significantly enriched in the CGMMV-infected PI plants compared with the CGMMV-infected 'ZK' plants. We also identified a gene encoding UDP-glycosyltransferase (UGT) that is involved in kaempferol-3-O-sophoroside biosynthesis and controls disease resistance, as well as plant height. Additionally, salicylic acid (SA) biogenesis increased in the CGMMV-infected 'ZK' plants, resulting in the activation of a downstream signaling cascade. SA levels in the tested watermelon plants correlated with that of total flavonoids, and SA pre-treatment up-regulated the expression of flavonoid biosynthesis genes, thus increasing the total flavonoid content. Furthermore, application of exogenous SA or flavonoids extracted from watermelon leaves suppressed CGMMV infection. In summary, our study demonstrates the role of SA-induced flavonoid biosynthesis in plant development and CGMMV resistance, which could be used to breed for CGMMV resistance in watermelon.

Argonaute 1 and 5 proteins play crucial roles in the defence against cucumber green mottle mosaic virus in watermelon.

RNA silencing, a core part of plants' antiviral defence, requires the ARGONAUTE, DICER-like, and RNA-dependent RNA polymerase proteins. However, how these proteins contribute to watermelon's RNA interference (RNAi) pathway response to cucumber green mottle mosaic virus (CGMMV) has not been characterized. Here, we identifyseven ClAGO, four ClDCL, and 11 ClRDR genes in watermelon and analyse their expression profiles when infected with CGMMV. ClAGO1 and ClAGO5 expression levels were highly induced by CGMMV infection. The results of ClAGO1 and ClAGO5 overexpression and silencing experiments suggest that these genes play central roles in watermelon's antiviral defence. Furthermore, co-immunoprecipitation and bimolecular fluorescence complementation experiments showed that ClAGO1 interacts with ClAGO5 in vivo, suggesting that ClAGO1 and ClAGO5 co-regulate watermelon defence against CGMMV infection. We also identified the ethylene response factor (ERF) binding site in the promoters of the ClAGO1 and ClAGO5 genes, and ethylene (ETH) treatment significantly increased ClAGO5 expression. Two ERF genes (Cla97C08G147180 and Cla97C06G122830) closely related to ClAGO5 expression were identified using co-expression analysis. Subcellular localization revealed that two ERFs and ClAGO5 predominantly localize at the nucleus, suggesting that enhancement of resistance to CGMMV by ETH is probably achieved through ClAGO5 but not ClAGO1. Our findings reveal aspects of the mechanisms underlying RNA silencing in watermelon against CGMMV.

A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV

BackgroundMelatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown.ResultsIn this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 μM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection.ConclusionsTogether, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Reactive oxygen species-related genes participate in resistance to cucumber green mottle mosaic virus infection regulated by boron in Nicotiana benthamiana and watermelon.

Cucumber green mottle mosaic virus (CGMMV) infection causes acidification and rot of watermelon flesh, resulting in serious economic losses. It is widely reported the interaction relationship between boron and reactive oxygen species (ROS) in regulating normal growth and disease resistance in plants. Our previous results demonstrated that exogenous boron could improve watermelon resistance to CGMMV infection. However, the roles of ROS-related genes regulated by boron in resistance to CGMMV infection are unclear. Here, we demonstrated that CGMMV symptoms were alleviated, and viral accumulations were decreased by boron application in Nicotiana benthamiana, indicating that boron contributed to inhibiting CGMMV infection. Meanwhile, we found that a number of differentially expressed genes (DEGs) associated with inositol biosynthesis, ethylene synthesis, Ca2+ signaling transduction and ROS scavenging system were up-regulated, while many DEGs involved in ABA catabolism, GA signal transduction and ascorbic acid metabolism were down-regulated by boron application under CGMMV infection. Additionally, we individually silenced nine ROS-related genes to explore their anti-CGMMV roles using a tobacco rattle virus (TRV) vector. The results showed that NbCat1, NbGME1, NbGGP and NbPrx Q were required for CGMMV infection, while NbGST and NbIPS played roles in resistance to CGMMV infection. The similar results were obtained in watermelon by silencing of ClCat, ClPrx or ClGST expression using a pV190 vector. This study proposed a new strategy for improving plant resistance to CGMMV infection by boron-regulated ROS pathway and provided several target genes for watermelon disease resistance breeding.

Suppression of Cucumber Green Mottle Mosaic Virus Infection by Boron Application: From the Perspective of Nutrient Elements and Carbohydrates.

Cucumber green mottle mosaic virus (CGMMV) infection causes "blood flesh" symptoms in watermelon fruits, which severely reduces yield and edibleness. However, the growth of watermelon fruits is strongly associated with boron (B), a trace element for improving fruit quality. In this study, B-gradient hydroponic experiments (B concentration: 0, 2.86, and 5.72 mg·L-1 H3BO3) and foliar-spray experiments (B concentration: 30 and 300 mg·L-1 H3BO3) were performed. We found that the B-supplement could inhibit CGMMV infection and especially relieve "blood flesh" symptoms in watermelon fruits. The nutrient element, soluble sugar, and cell wall polysaccharide contents and their metabolism- and transport-related gene expressions were determined in leaves and fruits of the watermelons in B-gradient hydroponic and foliar-spray experiments. We found that the accumulation and metabolism of nutrients and carbohydrates in cells were disrupted by CGMMV infection; however, the B-supplement could restore and maintain their homeostasis. Additionally, we uncovered that NIP5;1 and SWEET4, induced by B-application with CGMMV infection, could majorly contribute to the resistance to CGMMV infection by regulating nutrient elements and carbohydrate homeostasis. These results provided a novel insight into the molecular mechanism of B-mediated CGMMV suppression and an efficient method of B-application for the improvement of watermelon quality after CGMMV infection.

Investigating the Longevity and Infectivity of Cucumber green mottle mosaic virus in Soils of the Northern Territory, Australia.

Cucumber green mottle mosaic virus (CGMMV) is a Tobamovirus of economic importance affecting cucurbit crops and Asian cucurbit vegetables. CGMMV was detected in the Northern Territory (NT) in September 2014, the first record for Australia, with 26 properties confirmed as of May 2016. Research was undertaken to determine virus longevity in soils in the NT and investigate the use of disinfectants to remove viable CGMMV from the soil. An in-field trial at 12 months post-quarantine at four properties, and bioassays from collected soils indicate that CGMMV remained viable in at least two of the properties 12 months after plant hosts were removed from the ground. The infectivity of CGMMV from soil was also investigated in two trials with 140 watermelon seeds and 70 watermelon plants sown into CGMMV infested soils with or without the application of the disinfectants VirkonTM (2%) and Bleach (1%). Watermelons grown in soil, not treated with the VirkonTM or Bleach, showed CGMMV infection rates of 4% and 2.5% respectively. When VirkonTM or Bleach was applied, no positive CGMMV detections were observed in the watermelons. This research highlights the importance of proper management of infested properties and the need for on-farm biosecurity to manage CGMMV.

Transcriptomic Analysis of Genes Involved in Plant Defense Response to the Cucumber Green Mottle Mosaic Virus Infection.

Plants have evolved a complex multilayered defense system to counteract various invading pathogens during their life cycle. In addition to silencing, considered to be a major molecular defense response against viruses, different signaling pathways activated by phytohormones trigger the expression of secondary metabolites and proteins preventing virus entry and propagation. In this study, we explored the response of cucumber plants to one of the global pathogens, cucumber green mottle mosaic virus (CGMMV), which causes severe symptoms on leaves and fruits. The inbred line of Cucumis sativus L., which is highly susceptible to CGMMV, was chosen for inoculation. Transcriptomes of infected plants at the early and late stages of infection were analyzed in comparison with the corresponding transcriptomes of healthy plants using RNA-seq. The changes in the signaling pathways of ethylene and salicylic and jasmonic acids, as well as the differences in silencing response and expression of pathogenesis-related proteins and transcription factors, were revealed. The results show that silencing was strongly suppressed in infected plants, while the salicylic acid and ethylene signaling pathways were induced. The genes encoding pathogenesis-related proteins and the genes involved in the jasmonic acid pathway changed their expression insignificantly. It was also found that WRKY and NAC were the most sensitive to CGMMV infection among the transcription factors detected.

Resistance to Cucumber Green Mottle Mosaic Virus in Cucumis melo.

Cucumber green mottle mosaic virus (CGMMV) is a severe threat to melon production worldwide. At present, there are no cultivars available on the market which show an effective resistance or tolerance to CGMMV infection; only wild Cucumis species were reported as resistant. Germplasm accessions of Cucumis melo, as well as C. anguria, C. ficifolius, C. myriocarpus and C. metuliferus, were mechanically infected with isolates belonging to the European and Asian strain of CGMMV and screened for resistance by scoring symptom severity and comparing the accumulation of virus by qRT-PCR. The wild species C. anguria and C. ficifolius showed no symptoms and did not accumulate CGGMV following inoculation, while C. metuliferus was highly susceptible to the isolates of both strains of CGMMV. The virus accumulated also in C. myriocarpus and the European isolate produced symptoms, but the Asian isolate did not. Thirty C. melo accessions were susceptible to CGMMV. An isolate-dependent expression of symptoms was observed in 16 melon accessions: they showed mild and severe symptoms at 14 and 21 days after inoculation with the European and Asian isolate, respectively. Freeman’s Cucumber showed few or no symptoms following inoculation with the isolate of either CGMMV strain. This particular accession also showed reduced virus accumulation, whereas most other tested germplasm accessions showed significantly higher viral loads and, therefore, may well be a candidate for breeding programs aiming to reduce the losses produced by CGMMV with resistant commercial melon cultivars.

Preliminary Study on the Control of Cucumber Green Mottle Mosaic Virus in Commercial Greenhouses Using Agricultural Disinfectants and Resistant Cucumber Varieties

Cucumber green mottle mosaic virus (CGMMV) is a re-emerging threat to greenhouse cucumber and other Cucurbitaceae crop production worldwide. This seed-borne virus can easily spread from a contaminated seeds to seedlings and to adjacent plants through mechanical contact of the foliage of diseased and healthy plants causing extensive yield losses. Additionally, infection may not be limited to the current crop but may also affect subsequent crops due to the long-term persistence of the virus on contaminated crop residues, greenhouse hard surfaces and soil or soil-less greenhouse substrates. In the present work, three greenhouse experiments were conducted to develop an integrated pest management strategy towards controlling CGMMV in commercial cucumber greenhouses, by implementing an effective sanitization program and using resistant and grafted cucumber varieties. Results of sanitization highlighted that pressure washing and cleansing with an alkaline foam cleanser eliminated CGMMV on some of the most heavily infested areas. However, three successive applications of cleanser and disinfectants were essential to completely eliminate CGMMV on porous and uneven surfaces, such as cement alleyway, tray gutters and floor mats. The screening of 15 cucumber varieties revealed that one Mini (‘Khassib’) and three Long English (‘Sepire’, ‘Bomber’ and ‘LC13900′) had reduced or delayed CGMMV infection spread in the greenhouse but were intermediate in yield. The most resistant Mini variety was ‘Katrina’. This variety showed low CGMMV infection level and high fruit yield. The varieties ‘Jawell’, ‘RZ 22-551′, ‘Sunniwell’, ‘Bonbon’ and ‘Dee Lite’ were the most tolerant to CGMMV. They showed a high CGMMV infection level without compromising yield. These results proved the need for new productive cucumber varieties with CGMMV resistance. Grafting experiments showed a yield increase only in the case of grafted ‘Picowell’ over ‘Bonbon’ but no CGMMV resistance, which is a much more desirable result of grafting experiments in order to have economic potential. In all, the current study revealed unique methods of CGMMV management in commercial greenhouses that are recommended to growers for reducing crop losses and improving economic returns.

ITRAQ-Based Proteomic Analysis of Watermelon Fruits in Response to Cucumber green mottle mosaic virus Infection.

Cucumber green mottle mosaic virus (CGMMV) is an important viral pathogen on cucurbit plants worldwide, which can cause severe fruit decay symptoms on infected watermelon (usually called “watermelon blood flesh”). However, the molecular mechanism of this disease has not been well understood. In this study, we employed the isobaric tags for relative and absolute quantitation (iTRAQ) technique to analyze the proteomic profiles of watermelon fruits in response to CGMMV infection. A total of 595 differentially accumulated proteins (DAPs) were identified, of which 404 were upregulated and 191 were downregulated. Functional annotation analysis showed that these DAPs were mainly involved in photosynthesis, carbohydrate metabolism, secondary metabolite biosynthesis, plant–pathogen interaction, and protein synthesis and turnover. The accumulation levels of several proteins related to chlorophyll metabolism, pyruvate metabolism, TCA cycle, heat shock proteins, thioredoxins, ribosomal proteins, translation initiation factors, and elongation factors were strongly affected by CGMMV infection. Furthermore, a correlation analysis was performed between CGMMV-responsive proteome and transcriptome data of watermelon fruits obtained in our previous study, which could contribute to comprehensively elucidating the molecular mechanism of “watermelon blood flesh”. To confirm the iTRAQ-based proteome data, the corresponding transcripts of ten DAPs were validated by determining their abundance via quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). These results could provide a scientific basis for in-depth understanding of the pathogenic mechanisms underlying CGMMV-induced “watermelon blood flesh”, and lay the foundation for further functional exploration and verification of related genes and proteins.

Genome-wide identification of long non-coding RNAs and circular RNAs reveal their ceRNA networks in response to cucumber green mottle mosaic virus infection in watermelon.

Long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) play vital roles in plant defense responses against viral infections. However, there is no systematic understanding of lncRNAs and circRNAs and their competing endogenous RNA (ceRNA) networks in watermelon under cucumber green mottle mosaic virus (CGMMV) stress. Here, we present the characterization and expression profiles of lncRNAs and circRNAs in watermelon leaves 48-h post-inoculation (48 hpi) with CGMMV, with mock inoculation as a control. Deep sequencing analysis revealed 2373 lncRNAs and 606 circRNAs in the two libraries. Among them, 67 lncRNAs (40 upregulated and 27 downregulated) and 548 circRNAs (277 upregulated and 271 downregulated) were differentially expressed (DE) in the 48 hpi library compared with the control library. Furthermore, 263 cis-acting matched lncRNA-mRNA pairs were detected for 49 of the DE-lncRNAs. KEGG pathway analysis of the cis target genes of the DE-lncRNAs revealed significant associations with phenylalanine metabolism, the citrate cycle (TCA cycle), and endocytosis. Additionally, 30 DE-lncRNAs were identified as putative target mimics of 33 microRNAs (miRNAs), and 153 DE-circRNAs were identified as putative target mimics of 88 miRNAs. Furthermore, ceRNA networks of lncRNA/circRNA-miRNA-mRNA in response to CGMMV infection are described, with 12 DE-lncRNAs and 65 DE-circRNAs combining with 22 miRNAs and competing for the miRNA binding sites on 29 mRNAs. The qRT-PCR validation of selected lncRNAs and circRNAs showed a general correlation with the high-throughput sequencing results. This study provides a valuable resource of lncRNAs and circRNAs involved in the response to CGMMV infection in watermelon.

First Report of Natural Infection of Siraitia grosvenorii by Cucumber Green Mottle Mosaic Virus in China

Fruit of Siraitia grosvenorii (family Cucurbitaceae) are used as a sweetener in beverage and traditional herbal medicine production in China. Some viruses have been known to infect S. grosvenorii, such as papaya ringspot virus (PRSV), watermelon mosaic virus (WMV), and zucchini yellow mosaic virus (ZYMV) (Cai et al. 2001; Liao et al. 2005; Qin et al. 2005). In August 2017, six S. grosvenorii samples (nos. LHG-1 to LHG-6) that showed mosaic, chlorosis, and mottling of leaves were collected from Yongfu, Guangxi province, China. All symptomatic samples were tested by enzyme-linked immunosorbent assay (ELISA) in double antibody sandwich format for 10 known cucurbit-infecting viruses, including cucumber green mottle mosaic virus (CGMMV), cucumber mosaic virus, kyuri green mottle mosaic virus, PRSV, squash mosaic virus, tobacco mosaic virus (TMV), watermelon silver mottle virus, WMV, zucchini green mottle mosaic virus, and ZYMV. The sample LHG-1 with chlorosis and mottle symptoms reacted positively against the antisera of CGMMV and TMV (Adgen, U.K.) but negatively against antisera of the other viruses. The other samples were negative in ELISA for all viruses tested. Total RNA was extracted from the LHG-1 sample using TRIzol reagent (Takara Dalian, China) following the manufacturer’s instructions. Reverse transcription polymerase chain reaction (RT-PCR) assays using CGMMV-specific primer pair CGM1/CGM2 (Huang et al. 2007) and TMV-specific primers (Li et al. 2000) showed a positive RT-PCR product of the expected size (650 bp) for CGMMV but not for TMV. The amplicon was further cloned into pMD-18-T vector (Takara Dalian) and sequenced (GenBank accession no. MK858182). Sequence analysis revealed that the RT-PCR product showed 99% nucleotide identity to the sequences of CGMMV isolates available in GenBank (accession nos. HM008919, KY753928, KX883833, KP868654, KM873786, and MH271443). The virus in LHG-1 was therefore identified as an isolate of CGMMV and named as CGMMV-LHG. Additionally, to confirm the infectivity of CGMMV-LHG, leaf sap extract in phosphate buffer (0.1 M, pH 7.0) of LHG-1 was mechanically inoculated on leaves of S. grosvenorii and Lagenaria siceraria seedlings. Ten days after inoculation, S. grosvenorii produced symptoms similar to the diseased plants in the field, and systemic mosaic and vein-banding were observed on L. siceraria. The control seedlings inoculated with phosphate buffer remained symptomless. Presence of CGMMV in inoculated plants was confirmed by RT-PCR. To the best of our knowledge, this is the first report of CGMMV infection on S. grosvenorii under natural conditions. The virus can be transmitted by seeds, infects various cucurbit species, and causes yield losses all over the world (Liu et al. 2014; Wu et al. 2011). Use of virus-free seeds and seedlings will be helpful to control CGMMV in S. grosvenorii production areas.

First Report of Watermelon Green Mottle Mosaic Virus in North America

In 2013, cucumber green mottle mosaic virus (CGMMV), a seed-transmitted cucurbit-infecting member of the genus Tobamovirus, was detected in California (Tian et al. 2014). CGMMV is a quarantined pathogen for which the California Department of Food and Agriculture monitors. Diagnostic samples suspected of CGMMV infection led to the identification of a different virus, watermelon green mottle mosaic virus (WGMMV), of the genus Tobamovirus, in November 2017. WGMMV was recently described by Cheng et al. (2018) infecting watermelon in Taiwan. In November 2017, two opo gourd fruits exhibiting CGMMV-like symptoms collected from a Santa Clara County farmer’s market, and 25 leaf samples from a mixed cucurbit production block from a Fresno County farm were tested for CGMMV by ELISA (Agdia, Elkhart, IN) and transmission electron microscopy. Most samples were CGMMV positive. However, rigid rod-shaped particles (∼18 × 300 nm) were detected from several CGMMV-negative samples. These samples tested positive by ELISA against tobacco mosaic virus (Agdia), indicating the presence of a serologically related virus. Initial nucleic acid analysis of the 2017 isolate by reverse-transcription polymerase chain reaction (RT-PCR) from total plant RNA using tobamovirus primers, as previously described by Dovas et al. (2004), resulted in a 497-nucleotide (nt) amplicon whose sequence aligned with other tobamovirus RNA-dependent RNA-polymerase sequences in GenBank. Sanger sequencing of this amplicon and 5′ and 3′ rapid amplification of cDNA ends (RACE) of genomic RNA (FirstChoice RLM-RACE kit, Thermo Fisher Scientific, Waltham, MA) with primer walking resulted in assembling the full 6,482-nt genome, which was deposited in GenBank (accession MK070867). An NCBI BLAST search indicates the isolate shares 98% sequence identity with WGMMV (accession MH837097) and 82% with cucumber mottle virus (accession AB261167) (Altshul et al. 1990; Orita et al. 2007). WGMMV-positive samples came from opo gourd (Lagenaria siceraria), fuzzy gourd (Benincasa hispida), Asian pumpkin (Cucurbita pepo), Japanese cucumber (Cucumis sativus), and bitter melon (Momordica charantia). Many plants were coinfected with CGMMV and WGMMV, but single infections were identified by RT-PCR from bitter melon and used for mechanical transmission. Detection primers were CGMMV_CP_F, CTTACAATCCGATCACACCTAG; CGMMV_CP_R, CTAAGCTTTCGAGGTGGTAGC; WGMMV4F, CTGCTAAGAGGGTTTATG; and WGMMV4R, CTTGGAAATCCGGTAAG. Transmission studies using Nicotiana benthamiana, sugar pumpkin, cucumber, watermelon, and Chenopodium amaranticolor were carried out as previously described (Ciuffo et al. 2016). Control plants were mock inoculated with buffer. At 10 days postinoculation, plants inoculated with infected leaf tissue, except C. amaranticolor, had slightly distorted leaves, mild mottling, and a crinkled appearance on new growth. Distal leaves of inoculated plants, except C. amaranticolor, tested positive for WGMMV by RT-PCR, and mock-inoculated plants were negative. C. amaranticolor developed local lesions on inoculated leaves. All plants were CGMMV negative by RT-PCR. During this work a second WGMMV detection occurred in June 2018 in Fresno County, also from a mixed cucurbit field. Both detections represent the first time WGMMV has been identified in California and North America and the second detection of the virus in cucurbit crops. The economic impact, means of transmission, and spread of this virus are currently unknown and merit further study.

Insight Into Late Wilting Disease of Cucumber Demonstrates the Complexity of the Phenomenon in Fluctuating Environments.

Some diseases are caused by coinfection of several pathogens in the same plant. However, studies on the complexity of these coinfection events under different environmental conditions are scarce. Our ongoing research involves late wilting disease of cucumber caused by coinfection of Cucumber green mottle mosaic virus (CGMMV) and Pythium spp. We specifically investigated the role of various temperatures (18, 25, 32°C) on the coinfection by CGMMV and two predominant Pythium species occurring in cucumber greenhouses under Middle Eastern climatic conditions. During the summer months, Pythium aphanidermatum was most common, whereas P. spinosum predominated during the winter-spring period. P. aphanidermatum preferred higher temperatures while P. spinosum preferred low temperatures and caused very low levels of disease at 32°C when the 6-day-old seedlings were infected with P. spinosum alone. Nevertheless, after applying a later coinfection with CGMMV on the 14-day-old plants, a synergistic effect was detected for both Pythium species at optimal and suboptimal temperatures, with P. spinosum causing high mortality incidence even at 32°C. The symptoms caused by CGMMV infection appeared earlier as the temperature increased. However, within each temperature, no significant influence of the combined infection was detected. Our results demonstrate the complexity of coinfection in changing environmental conditions and indicate its involvement in disease development and severity as compared with infection by each of the pathogens alone.

Expression and Localization Patterns of a Small Heat Shock Protein that Interacts with the Helicase Domain of Cucumber Green Mottle Mosaic Virus.

Cucumber green mottle mosaic virus (CGMMV), a member of the genus Tobamovirus (family Virgaviridae), is an economically important virus that has detrimental effects on cucurbit crops worldwide. Understanding the interaction between host factors and CGMMV viral proteins will facilitate the design of new strategies for disease control. In this study, a yeast two-hybrid assay revealed that the CGMMV helicase (HEL) domain interacts with a Citrullus lanatus small heat shock protein (sHSP), and we verified this observation by performing in vitro GST pull-down and in vivo coimmunoprecipitation assays. Measurement of the levels of accumulated sHSP transcript revealed that sHSP is upregulated on initial CGMMV infection in both Nicotiana benthamiana and C. lanatus plants, although not in the systemically infected leaves. We also found that the subcellular localization of the sHSP was altered after CGMMV infection. To further validate the role of sHSP in CGMMV infection, we produced and assayed N. benthamiana transgenic plants with up- and down-regulated sHSP expression. Overexpression of sHSP inhibited viral RNA accumulation and retarded disease development, whereas sHSP silencing had no marked effect on CGMMV infection. Therefore, we postulate that the identified sHSP may be one of the factors modulating host defense mechanisms in response to CGMMV infection and that the HEL domain interaction may inhibit this sHSP function to promote viral infection.

DNA Methylation Analysis of the Citrullus lanatus Response to Cucumber GreenMottle Mosaic Virus Infection by Whole-Genome Bisulfite Sequencing.

DNA methylation is an important epigenetic mark associated with plant immunity, but little is known about its roles in viral infection of watermelon. We carried out whole-genome bisulfite sequencing of watermelon leaves at 0 h (ck), 48 h, and 25 days post-inoculation with Cucumber green mottle mosaic virus (CGMMV). The number of differentially methylated regions (DMRs) increased during CGMMV infection and 2788 DMR-associated genes (DMGs) were screened out among three libraries. Most DMRs and DMGs were obtained under the CHH context. These DMGs were significantly enriched in the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of secondary biosynthesis and metabolism, plant–pathogen interactions, Toll-like receptor signaling, and ABC transporters. Additionally, DMGs encoding PR1a, CaMs, calcium-binding protein, RIN4, BAK1, WRKYs, RBOHs, STKs, and RLPs/RLKs were involved in the watermelon–CGMMV interaction and signaling. The association between DNA methylation and gene expression was analyzed by RNA-seq and no clear relationship was detected. Moreover, downregulation of genes in the RdDM pathway suggested the reduced RdDM-directed CHH methylation plays an important role in antiviral defense in watermelon. Our findings provide genome-wide DNA methylation profiles of watermelon and will aid in revealing the molecular mechanism in response to CGMMV infection at the methylation level.

Resistance to Cucumber green mottle mosaic virus in Cucumis sativus

Cucumber green mottle mosaic virus (CGMMV) is a severe threat for cucumber production worldwide. At present, there are no cultivars available in the market which show an effective resistance or tolerance to CGMMV infection, only wild Cucumis species were reported as resistant. Germplasm accessions of Cucumis sativus, as well as C. anguria and C. metuliferus, were mechanically infected with the European and Asian strains of CGMMV and screened for resistance, by scoring symptom severity, and conventional RT-PCR. The viral loads of both CGMMV strains were determined in a selected number of genotypes using quantitative RT-PCR. Severe symptoms were found following inoculation in C. metuliferus and in 44 C. sativus accessions, including C. sativus var. hardwickii. Ten C. sativus accessions, including C. sativus var. sikkimensis, showed intermediate symptoms and only 2 C. sativus accessions showed mild symptoms. C. anguria was resistant to both strains of CGMMV because no symptoms were expressed and the virus was not detected in systemic leaves. High amounts of virus were found in plants showing severe symptoms, whereas low viral amounts found in those with mild symptoms. In addition, the viral amounts detected in plants which showed intermediate symptoms at 23 and 33 dpi, were significantly higher in plants inoculated with the Asian CGMMV strain than those with the European strain. This difference was statistically significant. Also, the amounts of virus detected over time in plants did not change significantly. Finally, the two newly identified partially resistant C. sativus accessions may well be candidates for breeding programs and reduce the losses produced by CGMMV with resistant commercial cultivars.