Crops In Florida Research Articles

Response of hibiscus mealybug (Hemiptera: Pseudococcidae) to citrus volatiles induced by mechanical injury.

Hibiscus mealybug, Nipaecoccus viridis (Newstead) (Hemiptera: Pseudococcidae), is a recent invasive pest of citrus and many other crops in Florida. Nipaecoccus viridis attacks all above ground parts of citrus trees and heavy infestation can cause leaf drop and premature abortion of developing fruits. We quantified greater captures of N. viridis in cardboard band traps on areas of citrus trees that were intentionally injured by mechanical rasping of epidermal tissues as compared with similar but uninjured citrus branches. Direct field collection of headspace volatiles from mechanically injured or intact citrus branches revealed both qualitative and quantitative differences. Certain volatiles (γ-terpinene, citronellal, citronellyl acetate, β-E-farnesene, α-humulene, and α-E-E-farnesene) were only present in samples from damaged citrus branches. Behavioral assays using a laboratory Y-tube olfactometer revealed attraction of N. viridis to volatiles associated with mechanical damage of citrus including synthetic β-ocimene, γ-terpinene, sabinene, isomers of farnesene, and citronellal when loaded into lures at either of 2 concentrations (0.01 or 0.1 µg/µl). Subsequent field trapping experiments confirmed increased captures of various life stages of N. viridis in cardboard band traps baited with a 10.0 µg/µl concentration of farnesene:ocimene:sabinene blend (in 7:13:17 ratio), as well as those releasing either farnesene or ocimene alone at this same concentration, as compared with the mineral oil (diluent) negative control. Our results indicate that common plant related terpenes released by citrus following mechanical damage may be useful for development of an effective monitoring trap for N. viridis.

Profitability and Cost Estimates for Producing Tropical Hibiscus in South Florida

Tropical hibiscus (Hibiscus rosa-sinensis) is a bushy evergreen shrub or small tree native to the temperate regions of Asia and an economically significant crop in Florida. According to the 2017 Census of Agriculture, the market value of the ornamental industry in Miami-Dade County was $697 million, and approximately 25% of the production was in hibiscus. Demand for the cultivation of plants with minimal pesticides is rising due to concerns about potential adverse environmental and health effects. Integrated pest management, or IPM, is an alternative to conventional pesticide application. A broad-based approach, it integrates both chemical and non-chemical practices for sustainable control of pests. To help growers and other stakeholders determine the best approach to changing demands for pesticide management, this publication estimates the costs and returns of producing tropical hibiscus on an established nursery in south Florida using both traditional and IPM methods.

Use of Cover Crops in Florida’s Citrus Industry: History and Resurgence, Current Practices, Challenges, and Opportunities

Cover crops have a long and significant history in Florida’s citrus industry. During the late 1800s and early 1900s, they were widely used to enhance soil quality, boost fertility, and manage pests; therefore, they served as a critical agricultural tool before the widespread adoption of synthetic fertilizers. However, during the middle of the 20th century, a decline in the use of cover crops occurred as synthetic fertilizers and chemical pest control methods became more prevalent. Despite this decline, a resurgence of interest in cover crops has occurred among Florida’s citrus growers. This renewed interest is driven by the urgent need to increase soil fertility while reducing inputs, particularly in the context of managing citrus groves affected by citrus greening [huanglongbing (HLB)], which is a devastating disease that threatens the viability of the citrus industry. Citrus greening has created a growing interest in the use of management practices that can help mitigate the increasing cost of inputs needed to manage the disease. This literature review delves into the historical use of cover crops in Florida’s citrus industry and highlights their early adoption and subsequent decline. Additionally, it examines current cover crop management practices and focuses on key components such as seed selection, planting techniques, and termination methods. Finally, this review discusses the challenges and limitations associated with integrating cover crops into modern citrus production systems.

How to Build a Blackberry Trellis System: A Complete Guide

Blackberry (Rubus spp.) is a deciduous fruit crop. The fruit are usually small, round, and dark purple to black. Blackberry fruit is comprised of multiple drupelets that cluster together to form a berry, which has a glossy appearance when matured. Blackberries have a complex flavor profile that blends sweetness and acidity, and taste may vary depending on the variety and maturity stage. They are rich in nutrients, vitamins, minerals, and antioxidants. Blackberries are best grown in sub-tropical to temperate climates. Blackberry is a new emerging fruit crop in Florida, where they are harvested in May-June. There are several varieties, some of which are native to Florida. This publication aims to provide a general overview of the importance of trellis, different types of trellis, and their installation in blackberry production for county and state Extension faculty, growers, homeowners, and students interested in growing blackberries in Florida.

Evaluation of Florida-grown Barley for Brewing Applications: Yield, Fermentability, and Volatile Compounds

The state of Florida ranks third in the United States in beer production by volume, yet does not boast a commercially viable barley crop. This presents a potential market for Florida-grown barley. Despite similarities between the USDA Plant Hardiness Zones of Florida and traditional barley-growing regions, there persists a lack of best management practices for the successful cultivation and establishment of a barley crop in Florida. The purpose of this study was to investigate the potential viability of eight spring-type barley varieties grown in Florida by comparing crop yields, extract, fermentability, and volatile compounds. Barley is not a typical crop grown in Florida, however, the inclusion would provide welcome diversification options for Florida farmers to grow over winter. This study is an initial investigation into the use of Florida barley as an ingredient in beer production. The average yields of the eight varieties ranged from 31.5 ± 6.8 to 42.9 ± 11.8 bushels per acre (1,695–2,308 kg/ha) for the optimal planting dates, which are comparable to similar growing regions. Fine Grind (f.g.) extract concentrations were highest in Copeland, Esma, Pinnacle, and Opera barley varieties, ranging from 68.4 to 73.6% dry basis (d.b.). Concerning fermentability, Copeland and Esma had the lowest final attenuation among the Florida-grown barleys (1.51 and 1.92°P, respectively). There were minor differences in volatile compounds between the control and experimental barleys. The results of this study support the possible viability of Florida-grown barley for brewing applications that prioritize using local ingredients.

RETRACTED: Biocontrol of Fusarium wilt in tomato by Trichoderma spp

Tomato is the most economically important vegetable crop in Florida where produces the most fresh-market tomatoes in the United States. Fusarium wilt, caused by Fusarium oxysporum f. sp. lycopersici (FOL), is an important disease in tomato production in Florida, particularly due to lacking effective chemicals for soil treatment. Biological control is an alternative approach in the management of plant diseases, including those caused by soilborne pathogens. In this study, we evaluated two Trichoderma strains (T. atroviride T11 and T. asperellum T25) on their effects against FOL in vitro and in planta. T. asperellum T25 and its cultural filtrate showed inhibitory effects against mycelial growth of FOL in vitro and significantly reduced disease severity of Fusarium wilt in tomato in the greenhouse when T25 was mixed into soil at seeding. Although the mechanisms for biocontrol are still under investigation, results from this study indicate that T25 has great potential in the management of Fusarium wilt in tomato production.

First Report of Leaf Blight Caused by Curvularia aeria and C. senegalensis on Tomato (Solanum lycopersicum L.) in Florida, USA.

Tomato (Solanum lycopersicum L.) is an important economic crop in Florida and worldwide. In November 2021, a leaf blight was reported on tomato plants (hybrid cherry and artisan tomatoes) from a small farm in Miami-Dade County, Florida. About 100 plants showed symptoms with disease severity of 15% and disease incidence of 80%. Symptoms on the leaves started as small dark spots and coalesced to form larger necrotic lesions over time. Symptomatic leaf tissues were cut into 5-mm pieces, surface disinfected with 70% ethanol for 30 s and 1% NaClO for 5 min, then cultured on PDA for 3 to 5 days at 25°C. Isolations were conducted in three rounds, with 15 samples in each round. Except for the saprophytes, fungal isolates of Curvularia were consistently recovered from tissues in each round. Single spore isolates grouped in two morphotypes (CT1 and CT3, CT2 and CT4) were examined for morphological and molecular identification. Colonies on PDA were dark yellow-green, with a fluffy surface, then both morphotypes turned black, although CT2 and CT4 were light yellow at the edges. CT1 and CT3 produced light-brown, straight to curved conidia with smooth walls and 1 to 3 septa, 18 to 28 ✕ 9 to 12 µm (n=60), and dark-brown stromatic synnemata (> 200 µm in length) in the center of the colony after ~30 days of incubation in PDA. CT2 and CT4 produced brown, mostly curved conidia, 14 to 23 ✕ 8 to 9 µm (n=60), with slightly rugose walls and 3-4 septa, without synnemata. A dehydrated culture of each isolate was deposited in the Plant Industry Gainesville Herbarium [(PIGH, accession numbers 17443 (CT1), 17444 (CT2), 17445 (CT3), 17446 (CT4)]. Total DNA was extracted using DNeasy Plant Pro Kit (Qiagen, Germantown, MD) followed by PCR amplification and Sanger sequencing of the internal transcribed spacers (ITS) and the Large Subunit (LSU) of the rRNA gene, together with the protein coding gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor 1- (TEF1) and -tubulin (TUB) (Marin-Felix et al. 2020; Himashi et al. 2021; Manamgoda et al. 2012; Myllys et al. 2002) (GenBank accession numbers ITS-LSU: OQ657944-OQ657947, GAPDH: OQ689438 to OQ689441, TEF1: OQ689442 to OQ689445, TUB: OQ689446 to OQ689449). Curvularia clavata as the molecular marker (96% identity) was used for identification. Sequence similarity of 100% in GAPDH, ITS and LSU was obtained in megaBLAST searches for both groups of morphotypes, CT1 and CT3 to Curvularia aeria (Bat., J.A. Lima & C.T. Vasconc.) Tsuda type culture CBS 294.61, and CT2 and CT4 to Curvularia senegalensis (Speg.) Subram. culture CBS 149.71. Pathogenicity tests were conducted with each isolate on six tomato plants that were 6- weeks-old. The seeds used in the tests were provided by the farm, and the variety 'Red Bounty' was also used. Inoculation was accomplished by spraying a spore suspension (1 x 106 spores/ml) of each of the four isolates (CT1 to CT4) and by placing 6-mm PDA plugs of the isolates on the leaves. Six tomato plants were used as the control. All plants were covered by plastic bags and placed in a greenhouse at 23-27°C. The inoculated plants developed small dark spots on leaves 2 weeks after inoculation, and the leaves inoculated by plugs of the fungal isolates had large necrotic lesions, which were similar to those observed on tomato plants from the field. The pathogenicity tests were repeated three times, Curvularia was consistently isolated from inoculated leaves after the symptoms developed, and they were confirmed morphologically in each test. No symptoms were observed from the control plants. Curvularia aeria and C. senegalensis are known foliar pathogens on several important crops, but not tomatoes. To our knowledge, this is the first report of C. aeria and C. senegalensis causing leaf blight in tomatoes worldwide. This finding is important because it will extend the host range of C. aeria and C. senegalensis to tomato, it also implied the essentiality of crop rotation in disease management.

Perennial Peanut as a Potential Living Mulch and Nitrogen Source for Citrus and Other Orchard Crops in Florida

The concept of using a perennial peanut as a living mulch and source of biological nitrogen in fruit and nut crop orchards is not a new idea. In Central and South America, perennial peanuts have long been incorporated as a living groundcover into palm, coffee, cacao, plantain, and citrus, as well as into other fruit and nut production orchards. This cover crop may pose as a viable, environmentally-friendly option for production in Florida, too.

Grazing Reduces Nitrate Leaching in North Florida Crop Systems

Grazing Reduces Nitrate Leaching in North Florida Crop Systems

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Fertilization of Strawberries in Florida

Strawberry is an important crop in Florida, produced as an annual crop on plastic-mulched beds with drip irrigation. The main production area is in west-central Florida, including Hillsborough, Polk, and Manatee counties. Fertilizer is becoming a more significant portion of strawberry production costs, hence, proper fertilizer management is important for minimizing production costs and maximizing yield and fruit quality, while minimizing potential negative impacts on the environment caused by leaching or runoff of excess fertilizer nutrients. This guide summarizes the recent history of strawberry fertilization research and presents the updated research-based fertilizer management recommendations for strawberry production in Florida.

First report of Bipolaris sorokiniana leaf spot disease on watermelon (Citrullus lanatus) in Florida.

Watermelon is an important crop in Florida, representing $88.2 million in cash receipts in 2015 (USDA/NASS 2017). In April and May 2021, the UF/IFAS Plant Diagnostic Center in Gainesville, Florida received eight diseased watermelon leaf samples from Alachua, Gilcrest, Levy, and Suwannee counties in Florida. Lesions were round to oblong, light gray to tan with reddish brown margins and white to light gray center, and some were coalescing resulting in about 15% disease severity. Symptomatic leaf tissue (0.5 cm2) was surface sterilized in 0.6% sodium hypochlorite for one minute, rinsed with sterile tap water, plated onto water agar media plates, and incubated at 27°C under 12-h light/dark cycle for 7 days. Characteristic Bipolaris conidia with gray to black brownish cottony mycelial growth were consistently found growing from plated lesions. The pathogen was isolated from two of the eight samples using a 0.5 mm diameter sterile metal needle to transfer a single conidium onto DifcoTM Potato Dextrose Agar (PDA) plates. Three isolates were designated G21-562 from Levy and G21-599a and G21-599b from Alachua County. All three isolates produced curved or straight, cylindrical, obclavate, distoseptate brownish gray conidia with 3 to 8 septa, mostly tapering towards ends with dark brownish to black hilum, that ranged from averaged 62um x 25um (n=30, SD=8 for length and 3 for width). Conidiophores were brownish, septate, smooth, and straight, single or in small groups, simple or branched, and swollen at the upper tip. Internal transcribed spacer region (ITS) and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene sequences were amplified using primers ITS1/ITS4 and GPD-1/GPD-2 (Berbee et al. 1999). Reference sequences (Adhikari et al. 2020 and Manamgoda et al. 2014) were aligned using MUSCLE and trimmed to consistent length. Using concatenated sequence alignments of both loci, a maximum likelihood phylogenetic tree was constructed based on K2+G substitution model selected by BIC using Mega X (Kumar et al. 2018) with 1,000 bootstrap. The ITS and GPDG sequences of G21_599b, G21_599a and G21_562 (GenBank accessions OK614094 to 96, OP297398 to 400) showed 100% identity across 888 nucleotides across both loci to B. sorokiniana isolates CBS_110.14 and CBS_ 120.24 and were distinct from other reference isolates. To fulfill Koch's postulates, all three isolates were grown on PDA at 27°C and 12-h light/dark cycle. After a week, conidia were harvested in sterile water, and the conidial suspensions were adjusted to 105 conidia/ml using a hemocytometer. Each conidial suspension and Tween 20 water control was sprayed onto three seedlings of 'Sugar Baby' watermelon until runoff, and inoculated seedlings were sealed in a plastic bag for 24 hrs. The experiment was done in a greenhouse (20- 25°C) and repeated once. After a week of incubation, the same leaf lesion symptoms described above were observed on seedlings inoculated with conidia, whereas seedlings sprayed with the control were asymptomatic. Isolations from symptomatic tissue produced gray to black mycelia with conidia that were the same as described from field samples. To our knowledge, this is the first report of leaf spot on watermelon caused by B. sorokiniana. B. sorokiniana is a common pathogen of grasses and agronomic crops (Farr and Rossman 2020). The extent to which this emerging disease of Florida watermelon may negatively impact production is unknown and should be the subject of future observation and research.

Row-spacing and cultivar effects on sugarcane growth and yields in Florida histosols

Sugarcane (Saccharum spp. hybrids) is a major row crop in Florida. The effect of row-spacing on total row length per hectare can significantly effect the cost of major farm operations, including planting, harvesting and fertilizer application. In Florida, sugarcane is commonly planted at 1.5 m row-spacing. There is little information available on the effect of relatively narrow or wide spacing on the growth and yield of sugarcane, especially in new high-biomass cultivars. To determine sugarcane growth response to different row-spacing, a field trial was conducted in organic soil (Histosols) with four different row-spacings (1.2, 1.5, 1.8 m and a double row on a 1.5 m bed) and three sugarcane cultivars (CP 96-1252, CP 00-1101 and CP 01-1372). Data showed differential row-spacing effects on plant cane versus the first ratoon. In plant cane, depending on the cultivar, double row and 1.2 m spacing produced 17–46% and 23–42% greater sugar yield per hectare (TSH) than the current 1.5 m spacing, respectively. Overall, the combined average TSH of plant cane and the first ratoon in double and 1.2 m spacing was 20% and 26% greater than 1.5 m spacing. However, the yields in 1.5 m and 1.8 m row-spacing were similar. There was no significant effect in the first ratoon. There was no row-spacing effect on sucrose concentration. A similar response of cultivars to the tested row-spacings suggests that selecting cultivars for different row-spacings may not potentially show any yield improvements. Compared to the current 1.5 m spacing, narrow-spacing (1.2 m and double row) may potentially increase yields and wide (1.8 m) spacing reduce the production cost but further research is needed to understand the economic feasibility of different row configurations.

Pandemic Produce: Impacts of COVID-19 on Florida’s Fruit and Vegetable Industries

Abstract Florida has one of the most diverse agricultural economies in the United States, producing several dozen types of fruits and vegetables that are consumed within the state, across the country, and around the world. The COVID-19 pandemic and resulting policy responses occurred during the peak of spring harvest season for many crops in Florida, abruptly removing market demand from the food service industry and shifting consumer purchasing habits, which enabled insights into several aspects of the fruit and vegetable supply chain. This article examines how the COVID-19 pandemic impacted fruit and vegetable industries in Florida, how these industries responded to COVID-19 impacts, and how Florida’s experience compared to that of other states. Data are derived from several sources including a statewide survey that measured agricultural production losses in Florida resulting from COVID-19 in early 2020, interviews with Florida operations that provided insights into how the pandemic induced change across the food supply chain, and a survey of food supply chain operations in three regions of the United States conducted in 2021.

Effects of Planting Date, Cultivar and Vernalization Using Gibberellic Acid on the Severity of Root-Knot Nematode Damage to Globe Artichoke in Subtropical Sandy Soil.

Globe artichoke (Cynara cardunculus var. scolymus L.) is a new alternative crop in Florida. This long-season crop poses a very high risk of root-knot nematode (RKN) damage, the most important nematode problem in vegetable production in Florida. This study aimed to examine the impact of RKN damage on artichoke production in the subtropical climate of Florida. Treatments consisted of four cultivars ('Green Globe Improved', 'Green Queen', 'Imperial Star', and 'Opal') planted on three different dates (October 5, October 19, and November 2) in Experiment 1, and three cultivars ('Green Globe Improved', 'Green Queen', and 'Imperial Star') grown with or without vernalization using gibberellic acid (GA3) in Experiment 2. Both field experiments were conducted on sandy soil in west-central Florida during the 2020-2021 and 2021-2022 growing seasons. We collected RKN population density and gall index (GI) data to assess RKN damage. In Experiment 1, all tested cultivars showed moderate to high RKN infection in the 2021-2022 season, with 43% to 75% of roots galled. There was no effect of planting dates on RKN damage in the 2020-2021 season. However, delaying the planting date from October 5 to November 2 reduced the RKN damage while increasing the RKN population densities in the 2021-2022 season. In Experiment 2, all tested cultivars showed high RKN infestation, with more than 80% of roots galled. Vernalization by GA3 did not affect the severity of RKN damage. Our results suggest that all tested artichoke cultivars are highly susceptible to RKN in subtropical environments of Florida, raising an alarm on the risk of RKN damage to commercial artichoke production and increasing awareness about the need for RKN management.

Plant-Parasitic Nematodes Associated with Cannabis sativa in Florida.

The subtropical climate of Florida allows for a wide range of crops to be grown. With the classification of hemp (Cannabis sativa L., <0.3% delta-9-tetrahydrocannabinol) as an agricultural commodity, hemp has become a potential alternative crop in Florida. Hemp cultivars of different geographies (Europe, China, and North America), and uses (fiber, oil and CBD), were evaluated in three field experiments. The field experiments evaluated a total of 26 cultivars and were conducted for two consecutive seasons at three different locations (soil types) in North (sandy loam), Central (fine sand), and South Florida (gravelly loam). Nematode soil populations were measured at the end of each season. A diverse population of plant-parasitic nematodes was found, with reniform nematodes (RN, Rotylenchulus reniformis) the dominant species in North and South Florida (up to 27.5 nematodes/cc soil), and RKN (Meloidogne javanica) the main species in central Florida (up to 4.7 nematodes/cc soil). Other nematodes that were commonly found in south Florida (and to a lesser extent north Florida) were spiral (Helicotylenchus spp.), stunt (Tylenchorhynchus spp.) and ring nematodes (Criconemoids), while in central Florida, stubby root (Nanidorus minor) and sting nematodes (Belonolaimus longicaduatus) were found. No significant difference among hemp cultivars was noted at any of the locations. RKN were found in all three regions and soils, while RN were only found in North and South Florida. This is the first report on plant-parasitic nematodes associated with hemp in Florida fields. Natural nematode populations varied greatly, depending on where in Florida hemp was grown. Growers who wish to include hemp in their crop rotation need to be aware of potential pest pressure from nematodes. More research is needed to determine to what extent nematodes, especially RKN and RN, can reduce hemp growth and yield.

Common Arthropod Pests in Blackberries and Pomegranates in Florida

Blackberry and pomegranate are growing in importance as alternative crops in Florida. In the past decade, blackberry production in Florida increased from 64 acres in 2007 to 173 acres in 2017. The many health benefits acquired from these fruits make them good alternative options for growers in Florida to diversify their operations by planting some new and less traditional crops, providing them a niche in the Florida agriculture market. The intended audience of this publication includes blackberry and pomegranate growers in Florida as well as Extension agents providing expert recommendations to both these industries. The purpose of this publication is to share information derived from a one-year field survey on commonly encountered pests.

Plant-Parasitic Nematodes Associated with Asian Vegetables in Florida

Root-knot nematodes (Meloidogyne spp.) are one of the main soilborne pathogens in Florida and cause considerable damage to many vegetables. Asian vegetables are important specialty crops in Florida, but no information is available on their hosts status to plant-parasitic nematodes, in particular to Meloidogyne spp. Therefore, we conducted a survey to learn what Asian vegetables are grown in Florida and plant-parasitic nematodes associated with these crops, and the potential damage these nematodes cause to Asian vegetables.

Using Supplemental Lighting to Grow Hemp in Florida

With the removal of hemp from the controlled substances list, hemp is now one of the emerging crops in Florida. There is limited information on how to grow this crop in Florida. Like hops, hemp is another recently introduced crop in the state, with one of the major yield-limiting factors of premature flowering induced by inadequate day length. This article provides guidelines for hemp growers in Florida on the use of supplemental lighting to control flowering and improve growth of hemp under Florida’s environmental conditions. Written by Johan Desaeger, Jacqueline Coburn, and Shinsuke Agehara, and published by the UF/IFAS Horticultural Sciences Department; 4 pp.https://edis.ifas.ufl.edu/hs1452

First Report of Leaf Rust on Blackberry (Rubus spp.) Caused by Kuehneola uredinis in Florida.

During the fall of 2020 and summer of 2021, symptoms of leaf rust were observed on blackberry plants of 'Kiowa', and breeding line 1734 (progeny of 'Natchez' and Arapaho') in a field trial at the University of Florida, Wimauma, FL. Symptoms consisted of small chlorotic spots (1 to 3 mm) on the upper side of the leaf, while the underside had yellow-orange pustules. Disease incidence was up to 100% on both 'Kiowa' and the breeding line 1734, and severity was up to 20% with most of the symptoms observed on older leaves. Two isolates were collected from 'Kiowa' and one from the breeding line 1734 for further investigation. Isolates were maintained and multiplied on healthy 'Kiowa' plants in growth chambers (25 ºC and 12-12 h photoperiod). Uredinia (n=30) were erumpent and ranged from 90 to 320 µm (Average=285 µm, SD=5.3 µm) in diameter. Urediniospores (n=50) were obovoid, yellow, and ranged from 24 to 36 μm long (Average=32 µm, SD=3.2 µm) and 22 to 30 μm wide (Average=28 µm, SD=2.5 µm). Based on morphology and literature, the pathogen was tentatively identified as Kuehneola uredinis (Link) Arth (Arthur 1906; Shands et al., 2018). Spores from a single uredinium of each isolate were collected with a needle and suspended in 50 µL of molecular biology-grade water yielding a final concentration of approximately 5 x 104 spores/mL. Two µL of each spore suspension was used for the PCR reactions. Two DNA fragments were amplified using the primers Rust2inv and LR6, and Rust18S-R and NS1 for the 5.8S-ITS2-28S gene region of rDNA (1,755 bp) and partial 18S gene region of rDNA (2,684 bp), respectively. The amplified products of the partial 28S gene region were sequenced with the primers LR3 and LR0R, and the 18S gene region with NS5, NS6, and NS4 (Aime 2006). DNA sequences were deposited in GenBank (accession nos. OK509845 - OK509848). BLASTn searches revealed that the isolates were 100% identical to K. uredinis reported causing leaf rust on blackberry in California (1044/1044bp, and 1540/1540bp for accession numbers MF158087, and MF158088, respectively). To test for pathogenicity, blackberry cultivars Kiowa, Natchez, Osage, Ouachita, Ponca, Prime-Ark® 45, Prime-Ark® Freedom, Prime-Ark® Traveler, and Prime-Ark® Horizon were inoculated. Five plants of each cultivar were inoculated with a mixture of spores of the three isolates, and two plants of each cultivar were used as controls. Spores were washed from leaves of 'Kiowa' exhibiting sporulation using a suspension of 1% Tween 20 in deionized water. The final concentration of the inoculum was adjusted to 104 spores/mL. Plants were inoculated in the greenhouse with a spray bottle until run-off and kept inside clear plastic boxes for 48 h. Controls were sprayed with sterile deionized water. Plants were watered by mists of 3 s every 10 min twice a week. Disease incidence and severity were evaluated weekly on five leaves per plant that had been tagged before inoculation. The experiment was repeated once. Symptoms identical to the original were only observed in 'Kiowa' and 'Prime-Ark® Freedom'. One week after inoculation, disease incidence was already 100% in both cultivars, with at least one pustule on all the inoculated leaves, and six weeks later disease severity was up to 50% (Average= 35%, SD=2.4%). To our knowledge, this is the first report of K. uredinis causing leaf rust on blackberry in Florida. This disease was reported on Rubus spp. in several U.S. states, and recently in California on Rubus ursinus (Farr and Rossman 2021; Shands et al. 2018). Blackberry is an emerging crop in Florida and efforts should be implemented to monitor the occurrence and spread of leaf rust considering that urediniospores disperse long distances by wind, especially if growers choose the susceptible cultivars 'Kiowa' and 'Prime-Ark Freedom'. The apparent resistance observed in other commercial cultivars such as 'Osage', 'Ouachita', and 'Ponca' may serve as valuable breeding parents for developing new blackberry cultivars with resistance to leaf rust.