CREB Serine Research Articles

GPx1-ERK1/2-CREB pathway regulates the distinct vulnerability of hippocampal neurons to oxidative stress via modulating mitochondrial dynamics following status epilepticus

Glutathione peroxidase-1 (GPx1) and cAMP/Ca2+ responsive element (CRE)-binding protein (CREB) regulate neuronal viability by maintaining the redox homeostasis. Since GPx1 and CREB reciprocally regulate each other, it is likely that GPx1-CREB interaction may play a neuroprotective role against oxidative stress, which are largely unknown. Thus, we investigated the underlying mechanisms of the reciprocal regulation between GPx1 and CREB in the male rat hippocampus. Under physiological condition, L-buthionine sulfoximine (BSO)-induced oxidative stress increased GPx1 expression, extracellular signal-regulated kinase 1/2 (ERK1/2) activity and CREB serine (S) 133 phosphorylation in CA1 neurons, but not dentate granule cells (DGC), which were diminished by GPx1 siRNA, U0126 or CREB knockdown. GPx1 knockdown inhibited ERK1/2 and CREB activations induced by BSO. CREB knockdown also decreased the efficacy of BSO on ERK1/2 activation. BSO facilitated dynamin-related protein 1 (DRP1)-mediated mitochondrial fission in CA1 neurons, which abrogated by GPx1 knockdown and U0126. CREB knockdown blunted BSO-induced DRP1 upregulation without affecting DRP1 S616 phosphorylation ratio. Following status epilepticus (SE), GPx1 expression was reduced in CA1 neurons and DGC. SE also decreased CREB activity CA1 neurons, but not DGC. SE degenerated CA1 neurons, but not DGC, accompanied by mitochondrial elongation. These post-SE events were ameliorated by N-acetylcysteine (NAC, an antioxidant), but deteriorated by GPx1 knockdown. These findings indicate that a transient GPx1-ERK1/2-CREB activation may be a defense mechanism to protect hippocampal neurons against oxidative stress via maintenance of proper mitochondrial dynamics.

CREB serine 133 is necessary for spatial cognitive flexibility and long-term potentiation

The transcription factor cAMP response element-binding protein (CREB) is widely regarded as orchestrating the genomic response that underpins a range of physiological functions in the central nervous system, including learning and memory. Of the means by which CREB can be regulated, emphasis has been placed on the phosphorylation of a key serine residue, S133, in the CREB protein, which is required for CREB-mediated transcriptional activation in response to a variety of activity-dependent stimuli. Understanding the role of CREB S133 has been complicated by molecular genetic techniques relying on over-expression of either dominant negative or activating transgenes that may distort the physiological role of endogenous CREB. A more elegant recent approach targeting S133 in the endogenous CREB gene has yielded a mouse with constitutive replacement of this residue with alanine (S133A), but has generated results (no behavioural phenotype and no effect on gene transcription) at odds with contemporary views as to the role of CREB S133, and which may reflect compensatory changes associated with the constitutive mutation. To avoid this potential complication, we generated a post-natal and forebrain-specific CREB S133A mutant in which the expression of the mutation was under the control of CaMKIIα promoter. Using male and female mice we show that CREB S133 is necessary for spatial cognitive flexibility, the regulation of basal synaptic transmission, and for the expression of long-term potentiation (LTP) in hippocampal area CA1. These data point to the importance of CREB S133 in neuronal function, synaptic plasticity and cognition in the mammalian brain.

Notch-Inducible Hyperphosphorylated CREB and Its Ultradian Oscillation in Long-Term Memory Formation

Notch is a cell surface receptor that is known to regulate developmental processes by establishing physical contact between neighboring cells. Many recent studies show that it also plays an important role in the formation of long-term memory (LTM) in adults, implying that memory formation requires regulation at the level of cell-cell contacts among brain cells. Neither the target of Notch activity in LTM formation nor the underlying mechanism of regulation is known. We report here results of our studies in adult Drosophila melanogaster showing that Notch regulates dCrebB-17A, the CREB protein. CREB is a transcriptional factor that is pivotal for intrinsic and synaptic plasticity involved in LTM formation. Notch in conjunction with PKC activity upregulates the level of a hyperphosphorylated form of CREB (hyper-PO4 CREB) and triggers its ultradian oscillation, both of which are linked to LTM formation. One of the sites that is phosphorylated in hyper-PO4 CREB is serine 231, which is the functional equivalent of mammalian CREB serine 133, the phosphorylation of which is an important regulator of CREB functions. Our data suggest the model that Notch and PKC activities generate a cyclical accumulation of cytoplasmic hyper-PO4 CREB that is a precursor for generating the nuclear CREB isoforms. Cyclical accumulation of CREB might be important for repetitive aspects of LTM formation, such as memory consolidation. Because Notch, PKC, and CREB have been implicated in many neurodegenerative diseases (e.g., Alzheimer's disease), our data might also shed some light on memory loss and dementia.

Peter Richards

Notch is a cell surface receptor that is known to regulate developmental processes by establishing physical contact between neighboring cells. Many recent studies show that it also plays an important...

Pharmacological evaluation of insulin mimetic novel suppressors of PEPCK gene transcription from Paeoniae Rubra Radix

Paeoniae Rubra Radix (root of Paeonia lactiflora) has been frequently employed in Traditional Chinese Medicine (TCM) as and anti-diabetic therapy to enhance blood circulation and dissipate stasis. Previously, we identified a novel hypoglycemic action of a crude extract from Paeoniae Rubra Radix, which also suppressed phosphoenolpyruvate carboxykinase (PEPCK) gene transcription. Therefore, the current investigation intended to elucidate potential active bio-constituents of this herb and mechanisms of action. Glucocorticoid receptor (GR) nuclear localization, the PEPCK messenger (m)RNA level, pregnane X receptor (PXR) mRNA expression, cAMP-responsive element-binding protein (CREB) serine phosphorylation and DNA binding were evaluated in dexamethasone (Dex) and 8-bromo-cAMP (CA)-stimulated H4IIE cells, while efficacy of agents was assessed in a stable cell line containing a green fluorescent protein (GFP) reporter driven by the PEPCK promoter. HPLC profiling, colorimetric assays, and NMR analysis were employed for chemical characterization purpose. An extract of Paeoniae Rubra Radix lacking the insulin mimetic compound, 1,2,3,4,6-penta-O-galloyl-beta-d-glucose (PGG), and termed the non-PGG fraction (NPF), consisting of tannin polymers, suppressed PEPCK expression in the presence of an insulin receptor antagonist (HNMPA-AM(3)), suggesting the action of this fraction is independent of the insulin receptor. Furthermore, Dex-stimulated GR nuclear localization and transactivation were prevented by the NPF. Similarly, CA-stimulated CREB serine phosphorylation and DNA binding were also inhibited by the NPF in H4IIE cells. Hence NPF antagonizes both signaling pathways that induce PEPCK gene transcription. In conclusion, the current study proposes that the potent suppressive activity on PEPCK gene transcription observed with Paeoniae Rubra Radix extract, can be attributed to at least two distinct components, namely PGG and NPF.

Monocyte 15-Lipoxygenase Gene Expression Requires ERK1/2 MAPK Activity

IL-13 induces profound expression of 15-lipoxygenase (15-LO) in primary human monocytes. Our studies have defined the functional IL-13R complex, association of Jaks with the receptor components, and the tyrosine phosphorylation of several Stat molecules in response to IL-13. Furthermore, we identified both p38MAPK and protein kinase Cδ as critical regulators of 15-LO expression. In this study, we report an ERK1/2-dependent signaling cascade that regulates IL-13-mediated 15-LO gene expression. We show the rapid phosphorylation/activation of ERK1/2 upon IL-13 exposure. Our results indicate that Tyk2 kinase is required for the activation of ERK1/2, which is independent of the Jak2, p38MAPK, and protein kinase Cδ pathways, suggesting bifurcating parallel regulatory pathways downstream of the receptor. To investigate the signaling mechanisms associated with the ERK1/2-dependent expression of 15-LO, we explored the involvement of transcription factors, with predicted binding sites in the 15-LO promoter, in this process including Elk1, early growth response-1 (Egr-1), and CREB. Our findings indicate that IL-13 induces Egr-1 nuclear accumulation and CREB serine phosphorylation and that both are markedly attenuated by inhibition of ERK1/2 activity. We further show that ERK1/2 activity is required for both Egr-1 and CREB DNA binding to their cognate sequences identified within the 15-LO promoter. Furthermore, by transfecting monocytes with the decoy oligodeoxyribonucleotides specific for Egr-1 and CREB, we discovered that Egr-1 and CREB are directly involved in regulating 15-LO gene expression. These studies characterize an important regulatory role for ERK1/2 in mediating IL-13-induced monocyte 15-LO expression via the transcription factors Egr-1 and CREB.

NFAT and CREB Regulate Kaposi's Sarcoma-Associated Herpesvirus-Induced Cyclooxygenase 2 (COX-2)

COX-2 has been implicated in Kaposi's sarcoma-associated herpesvirus (KSHV) latency and pathogenesis (A. George Paul, N. Sharma-Walia, N. Kerur, C. White, and B. Chandran, Cancer Res. 70:3697-3708, 2010; P. P. Naranatt, H. H. Krishnan, S. R. Svojanovsky, C. Bloomer, S. Mathur, and B. Chandran, Cancer Res. 64:72-84, 2004; N. Sharma-Walia, A. G. Paul, V. Bottero, S. Sadagopan, M. V. Veettil, N. Kerur, and B. Chandran, PLoS Pathog. 6:e1000777, 2010; N. Sharma-Walia, H. Raghu, S. Sadagopan, R. Sivakumar, M. V. Veettil, P. P. Naranatt, M. M. Smith, and B. Chandran, J. Virol. 80:6534-6552, 2006). However, the precise regulatory mechanisms involved in COX-2 induction during KSHV infection have never been explored. Here, we identified cis-acting elements involved in the transcriptional regulation of COX-2 upon KSHV de novo infection. Promoter analysis using human COX-2 promoter deletion and mutation reporter constructs revealed that nuclear factor of activated T cells (NFAT) and the cyclic AMP (cAMP) response element (CRE) modulate KSHV-mediated transcriptional regulation of COX-2. Along with multiple KSHV-induced signaling pathways, infection-induced prostaglandin E(2) (PGE(2)) also augmented COX-2 transcription. Infection of endothelial cells markedly induced COX-2 expression via a cyclosporine A-sensitive, calcineurin/NFAT-dependent pathway. KSHV infection increased intracellular cAMP levels and activated protein kinase A (PKA), which phosphorylated the CRE-binding protein (CREB) at serine 133, which probably led to interaction with CRE in the COX-2 promoter, thereby enhancing COX-2 transcription. PKA selective inhibitor H-89 pretreatment strongly inhibited CREB serine 133, indicating the involvement of a cAMP-PKA-CREB-CRE loop in COX-2 transcriptional regulation. In contrast to phosphatidylinositol 3-kinase and protein kinase C, inhibition of FAK and Src effectively reduced KSHV infection-induced COX-2 transcription and protein levels. Collectively, our study indicates that mediation of COX-2 transcription upon KSHV infection is a paradigm of a complex regulatory milieu involving the interplay of multiple signal cascades and transcription factors. Intervention at each step of COX-2/PGE(2) induction can be used as a potential therapeutic target to treat KSHV-associated neoplasm and control inflammatory sequels of KSHV infection.

Oxidative stress-mediated up-regulation of myocardial ischemic preconditioning up-regulated protein 1 gene expression in H9c2 cardiomyocytes is regulated by cyclic AMP-response element binding protein

The cyclic AMP (cAMP)/protein kinase A (PKA) cascade plays a central role in cardiomyocyte proliferation and apoptosis. Here, we show that H 2O 2 stimulates expression of the antiapoptotic myocardial ischemic preconditioning up-regulated protein 1 (Mipu1) gene in H9c2 cardiomyocytes through a pathway involving the cAMP-response element binding protein (CREB). Stimulation of H9c2 cardiomyocytes with H 2O 2 resulted in increased Mipu1 promoter activity. Analysis of the rat Mipu1 promoter revealed two potential cAMP-response elements, one of which (CRE-II, TGTGGATGTTGACGAGCTTGT) was shown, using mutagenesis and deletion analysis, to be functional. Subsequent studies established that H 2O 2 increased phosphorylation of CREB serine 133 through a pathway involving PKA activation. Phospho-CREB was demonstrated to bind to CRE-II of the Mipu1 promoter, and H 2O 2 treatment resulted in increases in their interaction as assessed by ChIP. Furthermore, H 2O 2-mediated up-regulation of Mipu1 protein expression was abrogated by the suppression of CREB expression with small interfering RNA of CREB. It was demonstrated that the H 2O 2-induced up-regulation of Mipu1 in H9c2 cardiomyocytes was mediated by cAMP/PKA-dependent CREB activation.

Chronic Lymphocytic Leukemia and B and T Cells Differ in Their Response to Cyclic Nucleotide Phosphodiesterase Inhibitors

Phosphodiesterase (PDE)4 inhibitors, which activate cAMP signaling by reducing cAMP catabolism, are known to induce apoptosis in B lineage chronic lymphocytic leukemia (CLL) cells but not normal human T cells. The explanation for such differential sensitivity remains unknown. In this study, we report studies contrasting the response to PDE4 inhibitor treatment in CLL cells and normal human T and B cells. Affymetrix gene chip analysis in the three cell populations following treatment with the PDE4 inhibitor rolipram identified a set of up-regulated transcripts with unusually high fold changes in the CLL samples, several of which are likely part of compensatory negative feedback loops. The high fold changes were due to low basal transcript levels in CLL cells, suggesting that cAMP-mediated signaling may be unusually tightly regulated in this cell type. Rolipram treatment augmented cAMP levels and induced ATF-1/CREB serine 63/133 phosphorylation in both B lineage cell types but not T cells. As treatment with the broad-spectrum PDE inhibitor 3-isobutyl-1-methylxanthine induced T cell CREB phosphorylation, we tested a series of family-specific PDE inhibitors for their ability to mimic 3-isobutyl-1-methylxanthine-induced ATF-1/CREB phosphorylation. Whereas PDE3 inhibitors alone had no effect, the combination of PDE3 and PDE4 inhibitors induced ATF-1/CREB serine 63/133 phosphorylation in T cells. Consistent with this observation, PDE3B transcript and protein levels were low in CLL cells but easily detectable in T cells. Combined PDE3/4 inhibition did not induce T cell apoptosis, suggesting that cAMP-mediated signal transduction that leads to robust ATF-1/CREB serine 63/133 phosphorylation is not sufficient to induce apoptosis in this lymphoid lineage.

Glucose-Dependent Insulinotropic Polypeptide-Mediated Up-Regulation of β-Cell Antiapoptotic Bcl-2 Gene Expression Is Coordinated by Cyclic AMP (cAMP) Response Element Binding Protein (CREB) and cAMP-Responsive CREB Coactivator 2

The cyclic AMP (cAMP)/protein kinase A (PKA) cascade plays a central role in beta-cell proliferation and apoptosis. Here, we show that the incretin hormone glucose-dependent insulinotropic polypeptide (GIP) stimulates expression of the antiapoptotic Bcl-2 gene in pancreatic beta cells through a pathway involving AMP-activated protein kinase (AMPK), cAMP-responsive CREB coactivator 2 (TORC2), and cAMP response element binding protein (CREB). Stimulation of beta-INS-1 (clone 832/13) cells with GIP resulted in increased Bcl-2 promoter activity. Analysis of the rat Bcl-2 promoter revealed two potential cAMP response elements, one of which (CRE-I [GTGACGTAC]) was shown, using mutagenesis and deletion analysis, to be functional. Subsequent studies established that GIP increased the nuclear localization of TORC2 and phosphorylation of CREB serine 133 through a pathway involving PKA activation and reduced AMPK phosphorylation. At the nuclear level, phospho-CREB and TORC2 were demonstrated to bind to CRE-I of the Bcl-2 promoter, and GIP treatment resulted in increases in their interaction. Furthermore, GIP-mediated cytoprotection was partially reversed by small interfering RNA-mediated reduction in BCL-2 or TORC2/CREB or by pharmacological activation of AMPK. The antiapoptotic effect of GIP in beta cells is therefore partially mediated through a novel mode of transcriptional regulation of Bcl-2 involving cAMP/PKA/AMPK-dependent regulation of CREB/TORC2 activity.

Reversal of human cytomegalovirus major immediate-early enhancer/promoter silencing in quiescently infected cells via the cyclic AMP signaling pathway.

The human cytomegalovirus (HCMV) major immediate-early (MIE) enhancer contains five functional cyclic AMP (cAMP) response elements (CRE). Because the CRE in their native context do not contribute appreciably to MIE enhancer/promoter activity in lytically infected human fibroblasts and NTera2 (NT2)-derived neurons, we postulated that they might have a role in MIE enhancer/promoter reactivation in quiescently infected cells. Here, we show that stimulation of the cAMP signaling pathway by treatment with forskolin (FSK), an adenylyl cyclase activator, greatly alleviates MIE enhancer/promoter silencing in quiescently infected NT2 neuronal precursors. The effect is immediate, independent of de novo protein synthesis, associated with the phosphorylation of ATF-1 serine 63 and CREB serine 133, dependent on protein kinase A (PKA) and the enhancer's CRE, and linked to viral-lytic-cycle advancement. Coupling of FSK treatment with the inhibition of either histone deacetylases or protein synthesis synergistically activates MIE gene expression in a manner suggesting that MIE enhancer/promoter silencing is optimally relieved by an interplay of multiple regulatory mechanisms. In contrast, MIE enhancer/promoter silence is not overcome by stimulation of the gamma interferon (IFN-gamma) signaling pathway, despite the enhancer having two IFN-gamma-activated-site-like elements. We conclude that stimulation of the cAMP/PKA signaling pathway drives CRE-dependent MIE enhancer/promoter activation in quiescently infected cells, thus exposing a potential mode of regulation in HCMV reactivation.

Pairing of forskolin and KCl increases differentiation of immortalized hippocampal neurons in a CREB Serine 133 phosphorylation-dependent and extracellular-regulated protein kinase-independent manner

Although cAMP response element binding protein (CREB)- and extracellular-regulated protein kinase (ERK)-mediated pathways have been linked to each other in neuronal differentiation, involvement of these in hippocampal neuronal cell line has not been defined. Using an immortalized hippocampal cell line, HiB5, we have tried a pairing of forskolin with KCl depolarization, which acts as an ERK and CREB kinase activator in hippocampal neurons, to investigate if an activation of ERK and phosphorylation of CREB at the critical regulatory site, serine 133 might be coupled in differentiation. Differentiation toward a neuronal phenotype was synergistically and markedly increased by the pairing of forskolin and KCl depolarization. The synergistic effect was accompanied by an increase in phosphorylation of CREB Ser-133, but not phosphorylation of ERK, and was not inhibited by MEK inhibitor, PD98059. These findings indicate that phosphorylation of the transcriptional factor CREB may function to facilitate differentiation of HiB5 cells.

Phosphorylation-dependent targeting of cAMP response element binding protein to the ubiquitin/proteasome pathway in hypoxia.

Hypoxia activates a number of gene products through degradation of the transcriptional coactivator cAMP response element binding protein (CREB). Other transcriptional regulators (e.g., beta-catenin and NF-kappa B) are controlled through phosphorylation-targeted proteasomal degradation, and thus, we hypothesized a similar degradative pathway for CREB. Differential display analysis of mRNA derived from hypoxic epithelia revealed a specific and time-dependent repression of protein phosphatase 1 (PP1), a serine phosphatase important in CREB dephosphorylation. Subsequent studies identified a previously unappreciated proteasomal-targeting motif within the primary structure of CREB (DSVTDS), which functions as a substrate for PP1. Ambient hypoxia resulted in temporally sequential CREB serine phosphorylation, ubiquitination, and degradation (in vitro and in vivo). HIV-tat peptide-facilitated loading of intact epithelia with phosphopeptides corresponding to this proteasome targeting motif resulted in inhibition of CREB ubiquitination. Further studies revealed that PP1 inhibitors mimicked hypoxia-induced gene expression, whereas proteasome inhibitors reversed the hypoxic phenotype. Thus, hypoxia establishes conditions that target CREB to proteasomal degradation. These studies may provide unique insight into a general mechanism of transcriptional regulation by hypoxia.

Phosphocitrate Inhibits a Basic Calcium Phosphate and Calcium Pyrophosphate Dihydrate Crystal-induced Mitogen-activated Protein Kinase Cascade Signal Transduction Pathway

Calcium deposition diseases caused by calcium pyrophosphate dihydrate (CPPD) and basic calcium phosphate (BCP) crystals are a significant source of morbidity in the elderly. We have shown previously that both types of crystals can induce mitogenesis, as well as metalloproteinase synthesis and secretion by fibroblasts and chondrocytes. These responses may promote degradation of articular tissues. We have also shown previously that both CPPD and BCP crystals activate expression of the c-fos and c-jun proto-oncogenes. Phosphocitrate (PC) can specifically block mitogenesis and proto-oncogene expression induced by either BCP or CPPD crystals in 3T3 cells and human fibroblasts, suggesting that PC may be an effective therapy for calcium deposition diseases. To understand how PC inhibits BCP and CPPD-mediated cellular effects, we have investigated the mechanism by which BCP and CPPD transduce signals to the nucleus. Here we demonstrate that BCP and CPPD crystals activate a protein kinase signal transduction pathway involving p42 and p44 mitogen-activated protein (MAP) kinases (ERK 2 and ERK 1). BCP and CPPD also cause phosphorylation of a nuclear transcription factor, cyclic AMP response element-binding protein (CREB), on serine 133, a residue essential for CREB's ability to transactivate. Treatment of cells with PC at concentrations of 10(-3) to 10(-5) M blocked both the activation of p42/p44 MAP kinases, and CREB serine 133 phosphorylation, in a dose-dependent fashion. At 10(-3) M, a PC analogue, n-sulfo-2-aminotricarballylate and citrate also modulate this signal transduction pathway. Inhibition by PC is specific for BCP- and CPPD-mediated signaling, since all three compounds had no effect on serum-induced p42/P44 or interleukin-1beta induced p38 MAP kinase activities. Treatment of cells with an inhibitor of MEK1, an upstream activator of MAPKs, significantly inhibited crystal-induced cell proliferation, suggesting that the MAPK pathway is a significant mediator of crystal-induced signals.

L-type Voltage-sensitive Ca2+ Channel Activation Regulates c-fos Transcription at Multiple Levels

A mechanism by which voltage-sensitive Ca2+ channel (VSCC) activation triggers c-fos transcription has been characterized. Ca2+ influx through VSCCs stimulates phosphorylation of the transcription factor cAMP response element-binding protein (CREB) on serine 133 leading to an increase in the formation of transcription complexes that can elongate through a transcription pause site within the c-fos gene. Ca(2+)-stimulated CREB serine 133 phosphorylation is mediated by a Ca(2+)-activated kinase and is not dependent on the cAMP-dependent protein kinase (PKA). While necessary for c-fos transcriptional induction following VSCC opening, CREB serine 133 phosphorylation is not sufficient for transcriptional activation. A second, PKA-dependent event is required. Following induction, c-fos transcription is rapidly down-regulated. Dephosphorylation of CREB serine 133 parallels and likely mediates the transcriptional shut-off event. These results suggest that the phosphorylation and dephosphorylation of CREB controls its ability to regulate transcription in membrane-depolarized cells and that multiple pathways contribute to Ca(2+)-activated gene expression.