Corticotropin-releasing Hormone Promoter Research Articles

Investigating the Role of CART/GPR160 Signaling in Stress-Induced Anorexia

Stress-induced anorexia represents a conserved adaptive response across diverse species. While this response can be crucial for survival in specific situations, it may become detrimental when prolonged stress exposure leads to unhealthy eating patterns, contributing to eating disorders like anorexia nervosa and bulimia. Feeding behavior is intricately connected to the stress response, as stress levels can influence appetite and energy expenditure. Central to the stress response are corticotropin-releasing hormone (CRH)-producing neurons, which secrete CRH, stimulating the production of ACTH in the pituitary gland and subsequently triggering the release of cortisol, a stress hormone, from the adrenal glands. The presence of CRH in the hypothalamus, a brain region involved in controlling feeding, suggests a complex interplay where stress and metabolic signals converge. One such signal is the peptide cocaine- and amphetamine-regulated transcript (CART) which has been shown to regulate feeding behavior, satiety, and metabolic function by signaling through its receptor GPR160 and downstream glucagon-like peptide (GLP)-1 signaling. In this study, we hypothesize that CART/GPR160 signals within CRH-producing neurons to control feeding behavior and stress responses. To test this hypothesis, we used a multifaceted approach, utilizing both wild type and GPR160-floxed rats in which GPR160 was knocked down specifically in CRH neurons using an AAV-Cre under the control of the CRH promoter injected bilaterally into the paraventricular nucleus. We monitored food and water intake, investigated CRH secretion from hypothalamic explants treated with CART, and assessed physiological changes in GPR160, CART, and other related molecules in various brain regions following acute stress. We also examined the effects of GPR160 knockdown in PVN neurons on plasma cortisol levels in response to restraint stress. While further studies are necessary to fully define the roles of CART and GPR160 in stress responses and feeding behavior control, our preliminary findings indicate that this ligand-receptor pair could serve as a novel therapeutic target for treating psychiatric diseases related to eating disorders. NIH. This is the full abstract presented at the American Physiology Summit 2024 meeting and is only available in HTML format. There are no additional versions or additional content available for this abstract. Physiology was not involved in the peer review process.

Signaling pathways involved in NMDA-induced suppression of M-channels in corticotropin-releasing hormone neurons in central amygdala.

Glutamate N-methyl-d-aspartate (NMDA) receptors (NMDARs) and Kv7/M channels are importantly involved in regulating neuronal activity involved in various physiological and pathological functions. Corticotropin-releasing hormone (CRH)-expressing neurons in the central nucleus of the amygdala (CeA) critically mediate autonomic response during stress. However, the interaction between NMDA receptors and Kv7/M channels in the CRHCeA neurons remains unclear. In this study, we identified rat CRHCeA neurons through the expression of an AAV viral vector-mediated enhanced green fluorescent protein (eGFP) driven by the rat CRH promoter. M-currents carried by Kv7/M channels were recorded using the whole-cell patch-clamp approach in eGFP-tagged CRHCeA neurons in brain slices. Acute exposure to NMDA significantly reduced M-currents recorded from the CRHCeA neurons. NMDA-induced suppression of M-currents was eliminated by chelating intracellular Ca2+ , supplying phosphatidylinositol 4,5-bisphosphate (PIP2) intracellularly, or blocking phosphoinositide3-kinase (PI3K). In contrast, inhibiting protein kinase C (PKC) or calmodulin did not alter NMDA-induced suppression of M-currents. Sustained exposure of NMDA decreased Kv7.3 membrane protein levels and suppressed M-currents, while the Kv7.2 expression levels remained unaltered. Pre-treatment of brain slices with PKC inhibitors alleviated the decreases in Kv7.3 and reduction of M-currents in CRHCeA neurons induced by NMDA. PKC inhibitors did not alter Kv7.2 and Kv7.3 membrane protein levels and M-currents in CRHCeA neurons. These data suggest that transient activation of NMDARs suppresses M-currents through the Ca2+ -dependent PI3K-PIP2 signaling pathway. In contrast, sustained activation of NMDARs reduces Kv7.3 protein expression and suppresses M-currents through a PKC-dependent pathway.

Environmental enrichment prevents stress-induced epigenetic changes in the expression of glucocorticoid receptor and corticotrophin releasing hormone in the central nucleus of the amygdala to inhibit visceral hypersensitivity

IntroductionStress is a known trigger for the symptoms of irritable bowel syndrome (IBS), a gastrointestinal (GI) disorder that presents with abnormal bowel habits and abdominal pain due to visceral hypersensitivity. While behavioral therapies have been used to attenuate IBS symptoms, the underlying mechanisms by which these therapies interact with stress-induced pathology remains to be delineated. Here we use a rat model to test the hypothesis that exposure to environmental enrichment (EE) inhibits stress-induced changes within the brain-gut axis to prevent visceral and somatic hypersensitivity and colonic hyperpermeability. MethodsFemale rats (n = 8/group) were housed in EE one week before and one week during exposure to water avoidance stress (WAS) while controls were housed in standard cages (SH). One day after the final WAS exposure, colonic and somatic sensitivity were assessed by the visceromotor response (VMR) to colorectal distension (CRD) and withdrawal threshold elicited by an electronic von Frey on the hind paw of the rats respectively. All rats were returned to SH for 3 weeks before colonic and somatic sensitivity were reassessed on day 28. The rats were then immediately euthanized and the spinal cord was collected to assess changes in neuronal activation (assessed via ERK phosphorylation) in response to noxious CRD. A separate cohort of animals (n = 8/group) that did not undergo behavioral assessments was euthanized the day after the final WAS exposure and the central nucleus of the amygdala (CeA) was collected to investigate WAS and EE induced epigenetic changes at the glucocorticoid receptor (GR) and corticotrophin releasing hormone (CRH) promoter. The colon from these rats was also collected to assess colonic permeability via changes in transepithelial electrical resistance (TEER) in vitro. ResultsExposure to stress persistently increased VMR to CRD (P < 0.01) and decreased the hind paw withdrawal threshold (P < 0.001) in female rats. WAS also decreased TEER in the colon tissue of female rats (p = 0.05). In the CeA, WAS induced a decrease in histone acetylation at the GR promoter but increased histone acetylation at the CRH promoter and reduced GR-CRH interactions in the CeA. Analysis of the spinal cord showed that WAS increased CRD-evoked ERK phosphorylation in the dorsal horn. Exposure to EE prevented WAS-induced changes in the CeA, dorsal horn and colon respectively to prevent visceral and somatic hypersensitivity. ConclusionOur data reveals that behavioral therapies can produce long lasting molecular and epigenetic changes that can prevent stress-induced pathologies even after completion of the therapy. These results highlight the potential mechanisms by which behavioral therapies may ameliorate visceral pain associated stress-related pathologies such as the irritable bowel syndrome.

Activation of NMDA receptors suppresses Kv7 channel activity in corticotropin‐releasing hormone neurons in Amygdala

Corticotropin-releasing hormone (CRH)-expressing neurons in the central nucleus of the amygdala (CeA) are critically involved in autonomic response during stress. Glutamate N-methyl-D-aspartate (NMDA) receptors and Kv7 channels regulate the neuronal activity. However, the interaction between NMDA receptors and Kv7 channels remains unclear. CeA-CRH neurons were identified by an AAV virus-mediated expressing enhanced green fluorescent protein (eGFP) driven by the rat CRH promoter. M-currents carried by Kv7 channels were recorded by whole-cell patch-clamp approach in eGFP-tagged CeA-CRH neurons and Kv7 proteins were measured by western-blot. Acute application of NMDA significantly reduced M-currents recorded from CeA-CRH neurons. NMDA-induced suppression of M-currents was eliminated by chelating intracellular Ca2+ or supplying phosphatidylinositol 4,5-bisphosphate (PIP2) intracellularly but not by inhibiting protein kinase C (PKC), calmodulin, or phosphoinositide3-kinase (PI3K). Incubation of brain slices with NMDA decreased Kv7.3 membrane protein levels and M-currents, while the Kv7.2 expression levels was not altered. Treatment brain slice with PKC inhibitor alleviated the decreases in surface Kv7.3 levels and M-currents in CeA-CRH neurons induced by NMDA incubation. PKC inhibitor alone did not alter surface Kv7 levels and M-currents in CeA-CRH neurons. These data suggest that activation of NMDA receptors suppresses Kv7 channel activity through Ca2+-dependent PIP2 signaling in acute phase and PKC-dependent pathway in chronic phase.

Sex differences in the epigenetic regulation of chronic visceral pain following unpredictable early life stress.

We previously reported that early life stress (ELS) dysregulated glucocorticoid receptor (GR) and corticotrophin-releasing hormone (CRH) expression in the central nucleus of the amygdala (CeA). Epigenetic modifications serve as memories of adverse events that occurred during early life. Therefore, we hypothesized that epigenetic mechanisms alter GR and CRH expression in the CeA and underlie chronic visceral pain after ELS. Neonatal rats were exposed to unpredictable, predictable ELS, or odor only (no stress control) from postnatal days 8 to 12. In adulthood, visceral sensitivity was assessed or the CeA was isolated for Western blot or ChiP-qPCR to study histone modifications at the GR and CRH promoters. Female adult rats underwent stereotaxic implantation of indwelling cannulas for microinjections of garcinol (HAT inhibitor) into the CeA. After 7days of microinjections, visceral sensitivity was assessed or the CeA was isolated for ChIP-qPCR assays. Unpredictable ELS increased visceral sensitivity in adult female rats, but not in male counterparts. ELS increased histone 3 lysine 9 (H3K9) acetylation in the CeA and H3K9 acetylation levels at the GR promoter in the CeA of adult female rats. After unpredictable ELS, H3K9 acetylation was increased and GR binding was decreased at the CRH promoter. Administration of garcinol in the CeA of adult females, that underwent unpredictable ELS, normalized H3K9 acetylation and restored GR binding at the CRH promoter. Dysregulated histone acetylation and GR binding at the CRH promoter in the CeA are an important mechanism for "memorizing" ELS events mediating visceral pain in adulthood.

Hypothalamic insulin and glucagon-like peptide-1 levels in an animal model of depression and their effect on corticotropin-releasing hormone promoter gene activity in a hypothalamic cell line.

In depression, excessive glucocorticoid action may cause maladaptive brain changes, including in the pathways controlling energy metabolism. Insulin and glucagon-like peptide-1 (GLP-1), besides regulation of glucose homeostasis, also possess neurotrophic properties. Current study was aimed at investigating the influence of prenatal stress (PS) on insulin, GLP-1 and their receptor (IR and GLP-1R) levels in the hypothalamus. GLP-1 and GLP-1R were assayed also in the hippocampus and frontal cortex - brain regions mainly affected in depression. The second objective was to determine the influence of exendin-4 and insulin on CRH promoter gene activity in in vitro conditions. Adult male PS rats were subjected to acute stress and/or received orally glucose. Levels of hormones and their receptors were assayed with ELISA method. In vitro studies were performed on mHypoA-2/12 hypothalamic cell line, stably transfected with CRH promoter coupled with luciferase. PS has reduced GLP-1 and GLP-1R levels, attenuated glucose-induced increase in insulin concentration and increased the amount of phosphorylated IR in the hypothalamus of animals subjected to additional stress stimuli, and also decreased the GLP-1R level in the hippocampus. In vitro studies demonstrated that insulin is capable of increasing CRH promoter activity in the condition of stimulation of the cAMP/PKA pathway in the applied cellular model. Prenatal stress may act as a preconditioning factor, affecting the concentrations of hormones such as insulin and GLP-1 in the hypothalamus in response to adverse stimuli. The decreased GLP-1R level in the hippocampus could be linked with the disturbances in neuronal plasticity.

Neuroadaptations of presynaptic and postsynaptic GABAB receptor function in the paraventricular nucleus in response to chronic unpredictable stress.

Chronic stress impairs GABAA (GABA type A) receptor-mediated inhibition in the hypothalamic paraventricular nucleus (PVN). It is not clear whether GABAB receptor function is also altered. We hypothesize that chronic stress alters GABAB receptor function in PVN corticotrophin-releasing hormone (CRH) neurons to control hypothalamus-pituitary-adrenal axis activity. Whole-cell patch clamp recordings were made of PVN-CRH neurons expressing eGFP driven by CRH promoter in brain slices from unstressed rats and rats exposed to chronic unpredictable mild stress (CUMS). CUMS elevated the basal circulating corticosterone levels and increased the basal firing activity of PVN-CRH neurons. Microinjection of GABAB receptor agonist baclofen into the PVN suppressed the increased corticosterone levels in CUMS rats compared with unstressed rats. CUMS blunted the baclofen-induced inhibition on PVN-CRH neurons and outward currents in these neurons. Furthermore, CUMS reduced expression of GABAB1 (GABAB R1) protein in the PVN. Blocking NMDA receptors with AP5 restored the reduced baclofen-induced currents in CUMS rats but had no effect on GABAB1 expression. Furthermore, CUMS treatment augmented the baclofen-induced decrease in the frequency of glutamatergic excitatory postsynaptic currents (EPSCs) and GABAergic inhibitor postsynaptic currents in PVN-CRH neurons. The GABAB receptor antagonist CGP55845 increased the firing activity of PVN-CRH neurons only in CUMS-treated rats and not in unstressed rats. These findings suggest that chronic stress impairs postsynaptic GABAB receptor function but augments presynaptic GABAB receptor function in controlling glutamatergic and GABAergic synaptic inputs in PVN-CRH neurons.

Assessing placental corticotrophin-releasing hormone disruption by hexestrol in a cell model.

Studies have shown that corticotrophin-releasing hormone (CRH) and relaxin are associated with early delivery. Our lab previously has shown the mycotoxin zeranol increases placental CRH expression. The mycotoxin is used in the farming industry to promote cattle growth, and some synthetic hormones are also used for the same purposes. In order to complete the picture of these growth promoting agents, we attempted to examine the synthetic hormones on the placental gene expression in the current study. Among the tested compounds, hexestrol induced the CRH mRNA and protein expression at 100nM in JEG-3 cells. As signal transduction pathways have been described in the transcriptional control previously, the activations of several protein kinases were determined. P38, PKCβ and JNK were activated upon hexestrol treatment. Since the P38-inhibitor SB203580 prevented hexestrol from inducing CRH in a subsequent experiment, P38 was likely involved in the transcriptional regulation. Electrophoretic mobility shift assay revealed an increase in the CRE binding activity in CRH promoter. This study showed that hexestrol exposure might be a concern for pregnant women.

High activity of the stress promoter contributes to susceptibility to stress in the tree shrew.

Stress is increasingly present in everyday life in our fast-paced society and involved in the pathogenesis of many psychiatric diseases. Corticotrophin-releasing-hormone (CRH) plays a pivotal role in regulating the stress responses. The tree shrews are highly vulnerable to stress which makes them the promising animal models for studying stress responses. However, the mechanisms underlying their high stress-susceptibility remained unknown. Here we confirmed that cortisol was the dominate corticosteroid in tree shrew and was significantly increased after acute stress. Our study showed that the function of tree shrew CRH - hypothalamic-pituitary-adrenal (HPA) axis was nearly identical to human that contributed little to their hyper-responsiveness to stress. Using CRH transcriptional regulation analysis we discovered a peculiar active glucocorticoid receptor response element (aGRE) site within the tree shrew CRH promoter, which continued to recruit co-activators including SRC-1 (steroid receptor co-activator-1) to promote CRH transcription under basal or forskolin/dexamethasone treatment conditions. Basal CRH mRNA increased when the aGRE was knocked into the CRH promoter in human HeLa cells using CAS9/CRISPR. The aGRE functioned critically to form the “Stress promoter” that contributed to the higher CRH expression and susceptibility to stress. These findings implicated novel molecular bases of the stress-related diseases in specific populations.

Chronic Unpredictable Mild Stress Induces Loss of GABA Inhibition in Corticotrophin-Releasing Hormone-Expressing Neurons through NKCC1 Upregulation

Introduction: Prolonged and repeated stresses cause hyperactivity of the hypothalamic-pituitary-adrenal (HPA) axis. The corticotrophin-releasing hormone (CRH)-expressing neurons in the hypothalamic paraventricular nucleus (PVN) are an essential component of the HPA axis. Materials and Methods: Chronic unpredictable mild stress (CUMS) was induced in Sprague-Dawley rats. GABA reversal potentials (E_GABA) were determined by using gramicidin-perforated recordings in identified PVN-CRH neurons through expressing enhanced green fluorescent protein driven by the CRH promoter. Plasma corticosterone (CORT) levels were measured in rats implanted with a cannula targeting the lateral ventricles and PVN. Results: Blocking the GABA_A receptor in the PVN with gabazine significantly increased plasma CORT levels in unstressed rats but did not change CORT levels in CUMS rats. CUMS caused a depolarizing shift in E_GABA in PVN-CRH neurons compared with E_GABA in PVN-CRH neurons in unstressed rats. Furthermore, CUMS induced a long-lasting increase in expression levels of the cation chloride cotransporter Na⁺-K⁺-Cl^--Cl^- (NKCC1) in the PVN but a transient decrease in expression levels of K⁺-Cl^--Cl^- in the PVN, which returned to the basal level 5 days after CUMS treatment. The NKCC1 inhibitor bumetanide decreased the basal firing activity of PVN-CRH neurons and normalized E_GABA and the gabazine-induced excitatory effect on PVN-CRH neurons in CUMS rats. In addition, central administration of bumetanide decreased basal circulating CORT levels in CUMS rats. Conclusions: These data suggest that chronic stress impairs GABAergic inhibition, resulting in HPA axis hyperactivity through upregulation of NKCC1.

Prenatal Restraint Stress is Associated with Demethylation of Corticotrophin Releasing Hormone (CRH) Promoter and Enhances CRH Transcriptional Responses to Stress in Adolescent Rats

Maternal stress can disturb normal fetal neurodevelopmental progress, and lead to negative behavioral and neuroendocrine consequences for the offspring. These effects may be related to alterations in the hypothalamic-pituitary-adrenal (HPA) axis. Early life events disrupting the function of the HPA axis may be associated with epigenetic modification. This study investigated the effect of maternal stress on the methylation rate of the corticotrophin-releasing hormone (CRH) promoter and HPA axis response to acute stress in the adolescent offspring of Sprague-Dawley rats. Pregnant dams were randomly assigned to two groups: restraint stress group and normal control group. Adolescent male and female offspring were used from each group. The results showed that prenatal stress is associated with the demethylation of the CRH promoter, and leads to anxiety-like behaviors in adolescent life stages, as well as hyper-responsiveness of the HPA axis. Together, these results imply that prenatal stress alters the normal HPA function, which may be via the epigenetic mechanism.

An N-Ethyl-N-Nitrosourea Induced Corticotropin-Releasing Hormone Promoter Mutation Provides a Mouse Model for Endogenous Glucocorticoid Excess

Cushing's syndrome, which is characterized by excessive circulating glucocorticoid concentrations, may be due to ACTH-dependent or -independent causes that include anterior pituitary and adrenal cortical tumors, respectively. ACTH secretion is stimulated by CRH, and we report a mouse model for Cushing's syndrome due to an N-ethyl-N-nitrosourea (ENU) induced Crh mutation at −120 bp of the promoter region, which significantly increased luciferase reporter activity and was thus a gain-of-function mutation. Crh−120/+ mice, when compared with wild-type littermates, had obesity, muscle wasting, thin skin, hair loss, and elevated plasma and urinary concentrations of corticosterone. In addition, Crh−120/+ mice had hyperglycemia, hyperfructosaminemia, hyperinsulinemia, hypercholesterolemia, hypertriglyceridemia, and hyperleptinemia but normal adiponectin. Crh−120/+ mice also had low bone mineral density, hypercalcemia, hypercalciuria, and decreased concentrations of plasma PTH and osteocalcin. Bone histomorphometry revealed Crh−120/+ mice to have significant reductions in mineralizing surface area, mineral apposition, bone formation rates, osteoblast number, and the percentage of corticoendosteal bone covered by osteoblasts, which was accompanied by an increase in adipocytes in the bone marrow. Thus, a mouse model for Cushing's syndrome has been established, and this will help in further elucidating the pathophysiological effects of glucocorticoid excess and in evaluating treatments for corticosteroid-induced osteoporosis.

AB0027 Impact of additional genetic markers of rheumatoid arthritis on pattern of functional stress responses

BackgroundGrowing evidence supports the hypothesis that alteration of the stress response and interactions between the autonomic nervous system, the hypothalamus-pituitary-adrenal axis and the immune system contributes to the pathogenesis of...

Zeranol upregulates corticotropin releasing hormone expression in the placental cell line JEG-3

Corticotrophin-releasing hormone (CRH) plays a pivotal role in the control of parturition in human. Increased amount of plasma CRH is associated with pre-mature delivery. Zeranol or α-zearalanol is a mycotoxin produced by fungi in the Fusarium family. Unlike other mycotoxins, exposure to zeranol appears to have minimal health risk. In North America, it is used as a growth-promoting agent in livestock. Because of the health concern of zeranol residue in meat, this practice has not been adopted in Europe. In our study zeranol could induce CRH protein expression in JEG-3 cells as low as 0.1nM. As electrophoretic mobility shift assay indicated an increase in the CRE binding activity in CRH promoter, the induction was likely triggered by transcriptional regulation. We further looked into the signal transduction pathway and PKCδ and ERK-1/2 were found to be activated. This study showed that zeranol could increase CRH expression in placental cells, and the findings might be a concern for pregnant women.

An N-ethyl-N-nitrosourea induced Corticotrophin releasing hormone promoter mutation provides a mouse model of Cushing's syndrome

An N-ethyl-N-nitrosourea induced Corticotrophin releasing hormone promoter mutation provides a mouse model of Cushing's syndrome

Functional stress response in patients with rheumatoid arthritis: Impact of genetic factors

It is still incompletely understood how the stress response contributes to the pathogenesis of rheumatoid arthritis (RA). To characterize neuroimmune interactions, common variants in the genes of the β2-adrenergic receptor (beta2AR) and corticotropin releasing hormone (CRH) were studied together with functional stress responses in RA patients. An allele-specific PCR was used to determine the polymorphisms of the beta2AR (position 16, 27, 164), as well as the polymorphic sequences in the 5′ flanking region of the human CRH gene in RA patients (n = 310) and controls (n = 305). The autonomic response upon stressful stimuli was investigated studying heart rate variability, and the dynamics of blood glucose levels, CRH, and cortisol production under insulin hypoglycemia (IHT). There was a highly significant distortion in the distribution of the beta2AR polymorphism at codon 16 between RA patients and controls (p = 0.00001). It was also revealed a significant decrease of parasympathetic activity in patients with homozygosity for Gly 16 compared to Arg16Gly RA patients. In addition, the CRH promoter polymorphisms exerted a significant influence on the stress response of RA patients undergoing IHT. The integrated cortisol response to hypoglycemia was significantly lower in RA patients bearing the A1B1 allele compared to the A2B2 (p = 0.016). Polymorphisms of the beta2AR and CRH are associated with disturbed functional stress reactivity on various levels in RA patients. Further studies are warranted to determine the role of genetic factors on stress response in the disease process of RA.

Maternal Deprivation in Rats is Associated with Corticotrophin‐Releasing Hormone (CRH) Promoter Hypomethylation and Enhances CRH Transcriptional Responses to Stress in Adulthood

Exposure to stress during early development causes long-lasting alterations in behaviour and hypothalamic pituitary adrenal (HPA) axis activity, including increased expression of corticotrophin-releasing hormone (CRH). To determine whether early-life stress causes epigenetic changes in the CRH promoter leading to increased CRH transcription, 8-week old female and male rats, subjected to maternal deprivation (MD) between days 2 and 13 post-birth, were studied for HPA axis responses to stress and CRH promoter methylation in the hypothalamic paraventricular nucleus (PVN) and central nucleus of the amygdala (CeA). Plasma corticosterone and PVN CRH heteronuclear (hn)RNA responses to acute restraint stress were higher in MD rats of both sexes. DNA methylation analysis of the CRH promoter revealed a significantly lower percentage of methylation in two CpGs preceding (CpG1) and inside (CpG2) the cyclic AMP-response element (CRE) at -230 bp in the CRH promoter in the PVN but not the CeA of MD rats. Gel-shift assays, using nuclear proteins from forskolin-treated hypothalamic 4B cells and CRH promoter CRE oligonucleotides, unmethylated or methylated at CpG1, revealed a strong band that was supershifted by phospho-cAMP response element-binding antibody. This band was 50% weaker using oligonucleotides methylated at CpG2 (intra-CRE), or methylated at both CpG1 and CpG2. These findings demonstrate that HPA axis hypersensitivity caused by neonatal stress causes long-lasting enhanced CRH transcriptional activity in the PVN of both sexes. Hypomethylation of the CRH promoter CRE, a region critical for CRH transcriptional activation, could serve as a mechanism for the increased transcriptional responses to stress observed in MD rats.

Lack of association between two polymorphisms in the corticotropin-releasing hormone gene promoter and preterm birth in a Hispanic population

The molecular mechanisms involved in the initiation of preterm labor are still unknown. Several studies have shown that corticotropin-releasing hormone (CRH) is one of the main molecules related to the onset of preterm labor. CRH is a hypothalamic hormone that is also synthesized by the placenta and fetal membranes during the third trimester of pregnancy. Changes in CRH concentration in late pregnancy, both term and preterm, seem to depend on ethnicity, since Hispanic women have a higher plasma concentration of this hormone at 30 weeks of pregnancy compared with black or nonHispanic women. Furthermore, concentrations of CRH in white women with preterm labor are higher compared with black women with preterm labor [1]. These ethnic variations can be partly explained by differences in genetic background, such as the presence of polymorphisms in the CRH gene. The CRH gene promoter has 4 polymorphisms that have been designated: T-3371G, C-3531G, T-2353C, and T-684C. Three of these polymorphisms (C-3531G, T-2353C, T-684C) cosegregated completely resulting in 2 alleles: A1 and A2. Including the fourth polymorphism in the CRH promoter (T-3371G), the combined alleles have been designated as A1B1, A1B2, A2B1, and A2B2 [2]. The association of these polymorphisms with diseases and their molecular and biological functions have been reported. Populationbased studies have shown that the A2B1 compound allele is protective for the development of rheumatoid arthritis; meanwhile, the A1B1 allele is associated with the development of rheumatoid arthritis [3]. Moreover, in vitro studies using cells transiently transfected with the combined haplotype of the CRH gene promoter coupled to a reporter gene have shown differences in transcriptional activity [4]. It was hypothesized that polymorphisms in the CRH promoter influence the expression of this hormone in pregnant women, and thus might play a role in the induction of preterm birth. The aim of the present studywas to assess the association of CRH polymorphisms with spontaneous preterm birth in a Hispanic population. Patients included in the study were Hispanic women who were receiving obstetric care at the UMAE HGO4 “Luis Castelazo Ayala”, Mexico City, Mexico, between September 2006 and December 2007. The Institutional Review Board and the research ethics committee approved the protocol for sample collection. All study participants gave written informed consent before sample collection. All included pregnancies in this study were singleton live births. Gestational age was determined by last menstrual period and corroborated by ultrasound dating. The control group (n=55) comprised women with normal term deliveries without complications related to pregnancy. The case group comprised women with preterm birth (n=65), defined as preterm delivery preceded by spontaneous labor. Genomic DNA was extracted from placental samples using the QIAamp DNAMini Kit (Qiagen, Valencia, CA, USA), according to themanufacturer's instructions. Polymorphisms in the CRH promoter were analyzed by PCR-RFLP technique, as previously described [5]. Primers used to analyze the CRH promoter polymorphisms in this study were: CRHA: forward 5′ GCTGTTCTTGTGATAGTAAATA 3′, reverse 5′ CCC CAGAGGAAGAGAAGC 3′; CRHB: forward 5′ TGAAGGTACAAGGTGATACAAGTG ACAA 3′, reverse 5′ ACACAAACTGAGGTGAAAAGATGAA 3′. Statistical analysis was performed with Stata SE, version 11.0 (Stata Corp., College Station, TX, USA). The haplotype analysis was performed using the web tool SNPstats. Pb0.05 was considered statistically significant. The demographic characteristics of the 2 groups are shown in Table 1. As expected, the estimated gestational age on admission and neonatal birth weight were significantly different between the preterm and term groups. Distribution of both polymorphisms in the population was consistent with Hardy-Weinberg equilibrium. The frequencies of CRH-A and -B were in accordance with previously published data in other populations. No differences in genotype and allele frequencies for CRH-A and -B were observed between the 2 groups (Table 2). Furthermore, haplotype analysis for both polymorphisms did not reveal significant differences between preterm and term groups (data not shown). This study compared the presence of 2 polymorphisms located in the promoter of the CRH gene in a Hispanic population that had normal term or preterm delivery. The results showed that there was no association between the presence of these polymorphisms and spontaneous preterm birth in this population. However, study of the

Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3

Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described.

17β-Estradiol Is Required for the Sexually Dimorphic Effects of Repeated Binge-Pattern Alcohol Exposure on the HPA Axis during Adolescence

Alcohol consumption during adolescence has long-term sexually dimorphic effects on anxiety behavior and mood disorders. We have previously shown that repeated binge-pattern alcohol exposure increased the expression of two critical central regulators of stress and anxiety, corticotrophin-releasing hormone (CRH) and arginine vasopressin (AVP), in adolescent male rats. By contrast, there was no effect of alcohol on these same genes in adolescent females. Therefore, we tested the hypothesis that 17β-estradiol (E2), the predominant sex steroid hormone in females, prevents alcohol-induced changes in CRH and AVP gene expression in the paraventricular nucleus (PVN) of the hypothalamus. To test this hypothesis, postnatal day (PND) 26 females were ovariectomized and given E2 replacement or cholesterol as a control. Next, they were given an alcohol exposure paradigm of 1) saline alone, 2) acute (single dose) or 3) a repeated binge-pattern. Our results showed that acute and repeated binge-pattern alcohol treatment increased plasma ACTH and CORT levels in both E2- and Ch-treated groups, however habituation to repeated binge-pattern alcohol exposure was evident only in E2-treated animals. Further, repeated binge-pattern alcohol exposure significantly decreased CRH and AVP mRNA in Ch-, but not E2-treated animals, which was consistent with our previous observations in gonad intact females. We further tested the effects of E2 and alcohol treatment on the activity of the wild type CRH promoter in a PVN-derived neuronal cell line. Alcohol increased CRH promoter activity in these cells and concomitant treatment with E2 completely abolished the effect. Together our data suggest that E2 regulates the reactivity of the HPA axis to a repeated stressor through modulation of the habituation response and further serves to maintain normal steady state mRNA levels of CRH and AVP in the PVN in response to a repeated alcohol stressor.