Corn Production Area Research Articles

Relative impacts of Varroadestructor (Mesostigmata:Varroidae)infestation and pesticide exposure on honey bee colony health and survival in a high-intensity corn and soybean producing region in northern Iowa.

The negative effects of Varroa and pesticides on colony health and survival are among the most important concerns to beekeepers. To compare the relative contribution of Varroa, pesticides, and interactions between them on honey bee colony performance and survival, a 2-year longitudinal study was performed in corn and soybean growing areas of Iowa. Varroa infestation and pesticide content in stored pollen were measured from 3 apiaries across a gradient of corn and soybean production areas and compared to measurements of colony health and survival. Colonies were not treated for Varroa the first year, but were treated the second year, leading to reduced Varroa infestation that was associated with larger honey bee populations, increased honey production, and higher colony survival. Pesticide detections were highest in areas with high-intensity corn and soybean production treated with conventional methods. Pesticide detections were positively associated with honey bee population size in May 2015 in the intermediate conventional (IC) and intermediate organic (IO)apiaries. Varroa populations across all apiaries in October 2015 were negatively correlated with miticide and chlorpyrifos detections. Miticide detections across all apiaries and neonicotinoid detections in the IC apiary in May 2015 were higher in colonies that survived. In July 2015, colony survival was positively associated with total pesticide detections in all apiaries and chlorpyrifos exposure in the IC and high conventional (HC) apiaries. This research suggests that Varroa are a major cause of reduced colony performance and increased colony losses, and honey bees are resilient upon low to moderate pesticide detections.

New evidence on the impact of No-tillage management on agricultural carbon emissions.

Controlling agricultural carbon emissions contributes to achieving peak carbon emissions and carbon neutrality. However, as a conservation management practice of farmland, the impact of No-tillage management (NTM) on agricultural carbon emissions needs to be further discussed. The main purpose of this paper is to assess the direct effect and spatial spillover effect of NTM on agricultural carbon emissions, revealing the regulating mechanism of NTM on agricultural carbon emissions and the combined application of NTM. Results indicate that NTM reduces agricultural carbon emissions, which is significant in the central and western regions, along with the primary grain, corn, and rice production areas, as well as the northern regions of the Huai River. Furthermore, the spatial spillover analysis reveals that the implementation of NTM increases agricultural carbon emissions in neighboring regions, but financial support and cross-regional services can negatively regulate the relationship between NTM and space agricultural carbon emissions. This paper also finds that combining straw-returning technology and NTM reduces agricultural carbon emissions. Building a cross-regional coordination mechanism, an incentive mechanism, and innovating the conservation tillage model is essential for promoting the NTM and achieving agricultural carbon reduction.

First report of Curvularia leaf spot on Zea mays caused by Curvularia lunata in North Carolina.

In late July of 2022, corn leaves with spots were observed in a field at North Carolina State University's Vernon James Research and Extension Center (35.873294º N, 76.658599º W; Plymouth NC). The affected leaves contained small (two to three millimeters in diameter) tan-colored circular to oval lesions with reddish-brown margins and chlorotic haloes. The disease severity approached 50% on affected leaves. Leaf tissue from the margins of the lesions was excised and surface sterilized by soaking in 10 % bleach solution for two minutes followed by rinsing in distilled water. Next, leaf tissue was transferred to alkaline water agar amended with streptomycin (100 mgliter-1) and the plates were incubated at 27º C in dark. After one week, conidia were observed. Conidia were curved, light brown in color and contained three transverse septa. The size of the conidia (n= 30) ranged from 21-25 µm (average 24 µm) long by 7 to 10 µm wide (average 9 µm). These characteristics were typical of Curvularia lunata (Munkvold and White 2016). DNA from pure cultures was extracted, internal transcribed space region (ITS) was amplified using the primers ITS4 and ITS5 (White et al. 1990). Sequences were obtained and deposited into GenBank (accession no. OP998306). BLAST search indicated that the sequence was 100 % identical to C. lunata from Louisiana (MG 971305.1, Garcia- Aroca et al. 2018). Pathogenicity was confirmed on field corn cultivar 'Yellow dent' by inoculating two pots of two-week-old greenhouse-grown corn plants (6 plants per pot) by spraying conidial suspension with a concentration of 6 x 104 conidia /ml. The control plants (n= 6) were sprayed with distilled water and the plants were covered with a plastic bag for 24 hours. The plastic bags were removed and plants were moved to the greenhouse at 23º C. Four days after inoculation small round tan-colored lesions were observed and no symptoms on control plants. The experiment was repeated once and the pathogen was recovered from the symptomatic tissue. The morphology of the recovered isolate was similar to the original isolate. This is the first report of C. lunata causing leaf spot on corn in North Carolina. Although this disease has not been demonstrated to cause yield loss it has been detected more frequently in corn production areas of U.S. and should continue to be monitored going forward.

Does the Policy of Decoupled Subsidies Improve the Agricultural Economic Resilience?—Evidence from China’s Main Corn Producing Regions

Various forms of agricultural subsidy policies often have a significant impact on the development of the agricultural economy and also shape the differentiated spatial pattern of regional agricultural economic resilience, while research on the evolution process of agricultural economic resilience and its influencing mechanisms is still very scarce. This study is based on the impact of China’s cancellation of the temporary corn storage policy on corn prices in 2016. By using an economic resilience analysis framework, we selected the indicators of total agricultural output value and disposable income of farmers to measure the agricultural economic resilience of various cities in Jilin Province and analyzed the characteristics and causes of the spatio-temporal change in agricultural economic resilience in Jilin Province from 2008 to 2021. The results show the following: (1) The transition from price and subsidy integration policy to decoupled subsidy policy helps to shape stronger regional agricultural economic resilience, but due to factors such as farmer policy dependence, low international corn prices, severe oversupply in the domestic corn market, and the suddenness of policy changes, there was a short-term decline in agricultural economic resilience in Jilin Province in the early stage of the decoupled subsidy policy (2016–2017), which rapidly increased after 2017. (2) The agricultural economic resilience levels of cities in Jilin Province showed different spatial differentiation characteristics at different stages within the study period, and the central region, as an important corn production area in Jilin Province, had significant changes in agricultural economic resilience. (3) During the execution of the price and subsidy integration policy, the enhancement of agricultural input capacity and agricultural output capacity helped to improve regional agricultural economic resilience; during the execution of the decoupled subsidy policy, the government’s support for agriculture and the potential of rural markets had a significant impact on the improvement of agricultural economic resilience. At the same time, the interaction and enhancement effect between influencing factors also had a profound impact on agricultural economic resilience.

Corn Production and Corn Seed Market in Kazakhstan

Agriculture is the strategic economic sector in Kazakhstan that requires further modernization and introduction of innovative practices to boost the agricultural production in the country. Though wheat and barley are main crops among Kazakhstani farmers, alternative crops like oilseeds, corn, vegetables, fruits, etc. contribute to the country’s gross agricultural product and food security. The corn production in Kazakhstan was rarely elucidated or discussed in the academic community. Though, this crop is an essential income source for many farmers in the southern Kazakhstan. The objective of this paper, therefore, is to shed light on the status, development, and perspectives of corn production in Kazakhstan with a focus on its seed market. The corn production area in Kazakhstan was around 301 thousand hectares in 2021, from which grain corn production comprised 63% and silage corn was 37%. The leading area of corn production in Kazakhstan was Almaty region. The region alone contributed 50% of grain corn in the country. Corn seeds of more than 25 originators were sold to Kazakhstani farmers in 2021. The latter planted more than 150 various corn hybrid varieties. 60% of all corn seeds were imported. The slow modernization of available equipment and agricultural practices were essential handicaps in quick and successful development of Kazakhstani farmers. The research about corn, corn production, corn market, and corn seed market in Kazakhstan is very limited. Therefore, further detailed studies in this field are necessary to illuminate various aspects of corn growing in Kazakhstan for international academic community.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Impacts of Future Climate Variability on Atrazine Accumulation and Transport in Corn Production Areas in the Midwestern United States.

Atrazine is one of the most prevalent herbicides that has been widely applied to agricultural lands in the U.S. Understanding the transport and accumulation of atrazine in the subsurface under future climate scenarios is essential for future agriculture and water management. Here, we predict atrazine transport and accumulation under an intensive corn production land based on 20 projected global climate model (GCM) realizations, while considering uncertainties of transport parameters. Our study predicted continuous groundwater table declination and atrazine mass accumulation on the study site. We show that atrazine mass accumulation in corn production areas is subject to total precipitation in the atrazine application season, whereas atrazine plume movement is controlled by the sequence of annual precipitation. Atrazine mass transport and accumulation are more sensitive to climate variation on the field sites with low sorption and atrazine degradation rate. Under the extreme condition, the atrazine plume can migrate as far as five meters from the ground surface in only three years. While annual mean precipitation in the Midwestern U.S. is projected to increase in the future, groundwater vulnerability to atrazine and associated water quality impacts may rise in the U.S. Corn Belt, especially in sites with low atrazine degradation and sorption.

Combined Straw and Plastic Film Mulching Can Increase the Yield and Quality of Open Field Loose-Curd Cauliflower.

To evaluate the impact of straw mulching on the production of open field loose-curd cauliflower, this study analyzed the “Feicui No.9” cauliflower variety, grown in field trials in Northwest China, in 2019 and 2020. Plots in an open field were prepared without mulch (CK1) and with plastic film mulch (CK2), as experimental controls, along with three experimental mulching methods, including dual straw and plastic film mulch (T1), inter-row straw mulch (T2), and full straw mulch (T3). The effects of the different ground cover alternatives on loose-curd cauliflower's dry matter accumulation, yield, quality, and volatile compounds, were explored. The results showed that, compared with CK2 treatment, T1 treatment promoted the accumulation of dry matter, and increased the economic and biological yield, by 12.98 and 6.51%, respectively. The soluble sugar and vitamin C content in loose-curd cauliflower heads, subjected to T1 treatment, increased by 18.46 and 8.12%, respectively, and the nitrate content decreased by 25.57%. Moreover, the T1, T2, and T3 treatments significantly increased the levels of macro-, meso-, and microelements. Headspace solid-phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) was used to determine the volatile substances in loose-curd cauliflower heads from the 2020 harvesting period. Detected compounds included 17 aldehydes, 15 ketones, 10 alcohols, 15 esters, 29 hydrocarbons, 12 nitrogen-containing compounds, and 17 other substances. T1, T2, and T3 treatments increased the volatile substance content, whereas T1 treatment increased the quantity of volatile substances. In summary, dual mulching with straw and plastic film could promote dry matter accumulation, significantly increase the yield and quality, and effectively improve the flavor of loose-curd cauliflower. This mulching technique can be applied to open field vegetable and corn production areas, providing technical and theoretical support for the realization of high-yield, high-quality production models and a new straw recycling method.

Sultansuyu Tarım İşletme Müdürlüğüne Ait Silajlık Mısır Üretim Alanlarındaki Vejetasyon Değişiminin Landsat-8 Uydu Görüntüleri ile Değerlendirilmesi

Remote sensing (RS) is used effectively in agriculture as well as in many different fields. There are many mathematical models developed to predict characteristics such as yield, plant water consumption, plant growth and development in agricultural areas using RS techniques. In this study, the Normalized Vegetation Change Index (NDVI) and Vegetation Index Considering Soil Reflections (SAVI) were used. NDVI and SAVI satellite images are calculated using bands of near infrared (NIR) and red (RED) light wavelengths. Within the scope of the study, by using LANDSAT 8 satellite images of 2018 and 2019, the change in the silage corn production areas irrigated by the circular moving sprinkler irrigation (Center Pivot) systems in Yeniköy belonging to the General Directorate of Agriculture, Sultansuyu Agriculture Operation Directorate was analyzed during the plant development period. In this context, NDVI and SAVI maps obtained from satellite images were determined. Plant growth changes were evaluated for the period from sowing to harvest from the maps obtained. According to the results obtained from the study, it was determined that the plant growth and development satellite images of maize silage can be followed by NDVI and SAVI plant parameters obtained by using NIR and RED bands.

RETRACTED ARTICLE: An empirical study on the impact of human capital on cost efficiency: taking the main corn production areas in China as an example

This article has been retracted from publication in the Taylor & Francis journal, Acta Agriculturae Scandinavica, Section B — Soil & Plant Science. Following publication, concerns were raised by multiple third-parties around the content of the special issue and the decision-making process. Following an investigation by the Taylor & Francis Publishing Ethics & Integrity team in full cooperation with the Editor-in-Chief, it was confirmed that this article included in Special Issue titled “ Envisage Computer Modelling and Statistics for Agriculture”, guest edited by Gunasekaran Manogaran was not peer-reviewed appropriately, in line with the Journal's peer review standards and policy. As the stringency of the peer review process is core to the integrity of the publication process, the Editor and Publisher have decided to retract all of the articles within the above-named Special Issue. The journal has not confirmed if the authors were aware of this compromised peer review process. The journal is committed to correcting the scientific record and will fully cooperate with any institutional investigations into this matter. The authors have been informed of this decision. We have been informed in our decision-making by our policy on publishing ethics and integrity and the COPE guidelines.

Field testing of synthetic inseticides on fall armyworm (Spodoptera frugiferda J.E. Smith) in corn plant

Fall armyworm is a new pest in Indonesia that is currently of concern because of its widespread attack on corn production areas. FAW infestation in young plants will cause damage up to 90% and even corn plants can die. The study on the control of the fall armyworm (FAW) caused by Spodoptera frugiperda was conducted at the Bajeng Technology Research and Assessment Installation, Gowa, which took place from March-August 2020. The treatments were arranged in a randomized block design with 6 treatments repeated 4 times. The treatments consist of 4 synthetic insecticide treatments derived from 4 active ingredients (emamectin benzoate, spinoteram, carbofuran, chlorantraniliprole + tiamethoxam), one vegetable pesticide (nano pesticide; a.i. citronella, geraniol and citronellol) and one control treatment without pesticides. The treatment application was carried out 2 weeks after planting (WAP) then repeated every 2 weeks until the plants were 8 WAP. The treatment was carried out 2 times in the fegetative phase, 2 times in the generative phase. The plot area of each treatment is 5 x 5 m, the spacing is 70 x 20 cm. The results showed that the most effective insecticide to control FAW was Spinetoram followed by Emamectin Benzoate and Chlorantraniliprole. The average percentage of attacks in the spinetoram treatment was: 24.2% at 4 WAP, then 24.9% at 6 WAP, 29.1% and 37.1% at 10 WAP. The highest average yield was obtained in the insecticide treatment Spinetoram (10.7 t/ha) followed by Emamectin Benzoate (9.3 t/ha) and Chlorantraniliprole (8.9 t/ha), while the lowest yield was obtained in the control treatment (5.2 t/ha).

Mutual analyses of agriculture land use and transportation networks: The future location of soybean and corn production in Brazil.

CONTEXTGiven the need to expand food production to satisfy an increasing world population; regional land-use planners must direct this expansion to available, permitted areas (i.e., not legally protected forests) where production can be maximized and transportation costs, production costs and environmental impacts can be minimized. In this balancing act, the capabilities and layout of the current and future transport system are crucial in determining the spatial distribution of future agricultural production. OBJECTIVEThe objective of the present study was to develop a modeling framework to determine the optimal spatial distribution of new soybean and corn production areas in Brazil and transport flows needed to move these commodities to maximize economic gains and limit or reduce negative environmental impacts. METHODSInitially, we applied Data Envelopment Analysis (DEA) to classify regions suitable for expanding soybean and corn production according to an area's potential for superior agricultural performance. Subsequently, we used a Network Equilibrium Model (NEM) to determine the best spatial distribution of new soybean and corn production areas so that their production added to existing production meets the estimated 2050 demand and the optimal configuration of existing and proposed transportation infrastructure required to move this production to appropriate locations. RESULTS AND CONCLUSIONSWhen compared to a 2018 baseline, the complete operation of planned railroads and the positioning of future grain production to occupy regions indicated by the modeling could increase soybean and corn production by 66% without simultaneous deforestation, reduce carbon dioxide emissions due to interregional soybean and corn transport by about 14%, and reduce combined transport and production costs by about 2%. SIGNIFICANCEThe proposed modeling framework should be an extremely useful tool when determining sites for future agriculture production and the network matrix needed to transport this production, especially when considering the relationship between land use and transportation infrastructure.

Reduction of Synthetic Nitrogen Fertilizer Using Tithonia-based Liquid Organic Fertilizer for Sweet Corn Production in Ultisols

Nitrogen (N) fertilization method is of great interest in nutrient management in sweet corn production. Sweet corn production areas in Indonesia have been increasingly extended to Ultisol land due to decline in the amount of arable land. Proper nitrogen management in Ultisols including the use of tithonia-based liquid organic fertilizer (LOF) as a way of reducing the use of synthetic N fertilizer need to be investigated. In this experiment, we aimed to determine the effects of various combinations of tithonia-based LOF and synthetic N on the growth and yields of sweet corn grown in Ultisols. This experiment was conducted from April to July 2018, in Bengkulu City, Indonesia at an elevation of 36 m above sea level and was arranged in complete randomized design with four replications. Treatments consisted of five combinations of LOF and synthetic N, i.e. 0 % LOF+100 % N, 25 % LOF+75 % of N, 50 % LOF+50 % N, 75 % LOF+25 % N, and 100 % LOF+0 % N. The results indicated that fertilizer combination composition significantly affected plant height, leaf greenness, husked ear weight, unhusked ear weight, and ear length of sweet corn, but did not affect leaf number and shoot dry weight. Overall, the use of 75% LOF in combination with 25% synthetic N produced similar results to 100% synthetic N. It was concluded that the use of tithonia-based LOF reduced the use of synthetic N fertilizer in sweet corn production grown in Ultisols. This conclusion should be further evaluated for sweet corn production under field conditions in Ultisols.

Assessment of acetochlor use areas in the sahel region of Western Africa using geospatial methods

The goal of this study was to determine the co-occurrence between acetochlor use on crops and potentially vulnerable soils in the Permanent Interstate Committee for Drought Control in the Sahel region of Western Africa. Acetochlor, a pre-emergence herbicide, is used primarily on row crops and has the potential to reach groundwater or surface water following a rain event shortly after application. Off-field transport is often determined by soil properties; therefore, soils within potential use areas were assessed and mapped to establish areas with soils vulnerable to leaching and/or runoff. Corn and cotton production areas were used as surrogate crops for high potential use areas of acetochlor within areas identified using GlobCover land use data and the Spatial Production Allocation Model agricultural statistics data. The geospatial analysis identified approximately 462 million ha of potentially vulnerable soils in the Sahel region of which 65.7 million ha are within agricultural areas. An adjustment for corn and cotton production areas showed that 2.2 million ha or 3.3% of agricultural fields could have potential restrictions for acetochlor use. Approximately 0.159 million ha of soils or 0.24% of agricultural fields are in the presence of shallow groundwater, defined by depth < 9 m. In addition, 0.0128 million ha or 0.02% were determined to be adjacent to surface water bodies. To understand the uncertainty associated with the use of specific land cover datasets, an overlay assessment was conducted using alternative data sources. Overlap between selected land cover datasets in the Sahel region varies and ranges from 24.7% to 75.5% based on a merged 2009 GlobCover and CCI LC datasets. In comparison with the merged 2005 and 2009 GlobCover dataset, the cropland overlaps range from 38.9% to 85.0%. This demonstrates that the choice of land cover dataset can have a significant impact on a spatial assessment. Results from this assessment demonstrate that only a small fraction of vulnerable agricultural soils across the region may be a risk for contamination by acetochlor of groundwater or surface resources, based on product label recommendations. Given the availability of spatial data in a region, the methods contained herein may additionally be used in other localities to provide similar information that can be helpful for water quality management.

Transgenik Olmayan Mısırda (Zea mays L.) Yabancı Ot Mücedesinde Yaygın Olarak Kullanılan Herbisitlerin Karşılaştırılması

Yabancı otlar mısır üretiminde önemli ekonomik kayıplara neden olmaktadır. Yabancı ot mücadelesinde en yaygın kullanılan yöntem pratik olması bakımından herbisit kullanımıdır. Transgenik (GDO’lu) mısır üretiminde yabancı ot mücadelesi genellikle çıkış sonrası glyphosate ve 2.4-D herbisitlerinin kullanımına bağlı olarak yapılmaktadır. Ancak transgenik mısır üretiminin yasak olduğu Avrupa birliği ve Türkiye gibi ülkelerde mısır tarlalarında yabancı ot mücadelesi farklı herbisitlere bağlı olarak; ekim öncesi, çıkış öncesi ve çıkış sonrası olmak üzere üç ayrı dönemde yapılabilmektedir. Bu çalışmada transgenik olmayan mısır üretiminde sorun olan yabancı otlara karşı yaygın olarak kullanılan herbisitlerin yabancı ot kontrolüne ve mısır verimine etkisi araştırılmıştır. En yüksek verim sırasıyla dimethenamid-P 280 g/l + terbuthylazine 250 g/l (13.055 kg ha-1), mesotrione 75 g/l + nicosulfuron 30 g/l (12.979 kg ha-1) ve terbutylazine 270 g/l + pendimethalin 64 g/l (12.746 kg ha-1) uygulamalarından elde edilmiştir. Maksimum hasat indeksi sırasıyla dimethenamid-P 280 g/l + terbuthylazine 250 g/l (%53), mesotrione 75 g/l + nicosulfuron 30 g/l (%52) ve terbutylazine 270 g/l + pendimethalin 64 g/l (%50) uygulamalarında saptanmıştır. Yabancı ot indeksi sırasıyla dimethenamid-P 280 g/l + terbuthylazine 250 g/l (%7), mesotrione 75 g/l + nicosulfuron 30 g/l (%8) ve terbutylazine 270 g/l + pendimethalin 64 g/l (%10) uygulamalarında en iyi sonucu verdiği belirlenmiştir. Sonuçlar bir bütün olarak değerlendirildiğinde sırasıyla dimethenamid-P 280 g/l + terbuthylazine uygulamalarının öncelikli olarak tercih edilebileceği sonucuna varılmıştır. Ancak sadece kimyasallara bağlı mücadelelerin uzun dönemde çıkarabileceği çevresel sorunlar nedeniyle mısır üretiminde sürdürülebilir yabancı ot mücadelesi için münavebe, malçlama, solarizasyon, buhar ile toprak dezenfeksiyonu, akıllı kültivatörler ve sensörlü pülverizatörler kullanılması, dron ve dijital teknoloji gibi çevre dostu uygulamaların herbisit uygulamalarına entegre edilmesi gerekmektedir.

Estimation of the drought sensitivity of Hungarian soils based on corn yield responses

ABSTRACT During our soil-specific drought sensitivity research, an aim of ours was to ascertain how drought, a stress factor caused by the lack of precipitation, affects soil fertility. We used the five-year-long (1985–1989) soil and corn yield data of the National Pedological and Crop Production Database (NPCPD). We assigned the annual Pálfai Drought Index (PaDI) to the annual corn yield data of the NPCPD in order to identify drought-free corn yields and production areas. We determined the drought sensitivity of soils by comparing drought-free and annual yields. Based on the results of our statistical analyses, we created a seven-point drought sensitivity scale of soil types, based on which we produced a national soil-specific drought sensitivity index map. Our results may provide a good starting point for constructing large-scale (1: 10,000) climate sensitivity soil maps of agricultural lands, which can assist with soil-specific crop production that also adapts to climate change.

COMPARISON OF FARM SIZE CALCULATION IN PLANT PRODUCTION IN THE CONDITIONS OF THE SLOVAK AND CZECH REPUBLIC

The agricultural sector in the Czech and Slovak Republic has problems in big and also in small farms. The pa- per is based on the assumption of the family farm algorithm, which is focused on the plant production. A family farm is represented by two adults and two children. The aim is to calculate the minimum size of the farm in hectare needed to achieve the average income (in the national economy) of the 4-member family in the Czech Republic and in Slovakia. The algorithms for determining the size of a family farm focused on crop farming in the corn production area in the economic and production conditions of the Czech Republic and the Slovak Republic were given the following inputs: the average annual income of a 4 member family, own costs for chosen crops, prices crops, average subsidies for agricultural land, average annual harvests of chosen crops. Data were obtained from the ministries of agriculture and statistical offices from both states. We calculate the average 4 member family in Slovakia needs to earn minimum 16 77.44 Euro per year and in the Czech Republic 18 322.08 Euro per year. The results of the paper proved that, according to the model of an average farm focused on crop production, the acreage of 89.99 ha in Slovakia and 122.31 ha in the Czech Republic of agricultural land needs to have one family farm. We are calculating with following commodities: wheat, barley, grain maize, sunflower, oil rape, potatoes and pea. One way to track changes in farm structure is to examine trends in the average size of holding, or average herd size in the case of livestock farms. However, this measure can seriously underestimate the pace of change where much of the growth (in area farmed, or in livestock numbers) takes place on the larger holdings. The persistence of many small holdings, even though the share of the land or livestock that they control is small and may be falling, tends to mask the extent of structural change as measured by averages. The aim of submitted paper is to determine the minimum size of agricultural land of a small family farm focused on plant production in the economic and production conditions of the Czech and Slovak Republics. In the submitted paper the data on farmers has been used in Slovakia and the Czech Republic from the data of business calculations by Research Institute of Agricultural and Food Economics from Slovakia and Research Institute of Agricultural Economy from Czech Republic. Key words: farm size, agricultural land, crop production, crops, costs, prices, subsidies.

Assessing the current and future biological control potential of Trichogramma ostriniae on its hosts Ostrinia furnacalis and Ostrinia nubilalis.

Understanding interactions between biocontrol agents and their pest hosts under climate change should assist implementation of biocontrol strategies, by identifying appropriate biocontrol agents for release or determining the optimal timing of releases. Species distribution models (SDMs) were applied to evaluate the distributions of Trichogramma ostriniae and its native host, Ostrinia furnacalis, in southeastern Asia, and a non-native host, Ostrinia nubilalis, in a novel range, North America, using MAXENT and CLIMEX modelling approaches. The models led to similar predictions about the expected distribution of the two species in Asia, and emphasized likely mismatches between host and natural enemy. Trichogramma ostriniae was predicted to occur in the summer corn region of China, with distribution limits linked to its sensitivity to cold, seasonality of radiation and precipitation. The modelled Ostrinia nubilalis distribution overlapped with the main corn production areas of the northeastern USA and Canada; temporary/seasonal suitable habitat was also predicted across the southeastern USA. Climate change scenarios are predicted to favour T. ostriniae over its hosts in northeastern China and North America. The modelling approaches used here proved useful for assessing environmental factors linked to an egg parasitoid and its lepidopteran hosts and identifying areas potentially suitable for inundative releases. © 2017 Society of Chemical Industry.

Assessment of the agro-climatic indices to improve crop yield forecasting

Weather has a major impact on agriculture. Statistical models have been used to estimate or forecast crop yield from weather information. In this paper, a general statistical framework is developed in order to rank and quantify the information content of weather information. The methodology is tested over the US, for corn yield. The weather sensitivity of different corn production areas is first analyzed. More than fifty agro-climatic indices have been compared. The study shows that variability in yield is more likely to be due to weather variability in medium and low production areas. The two best yield predictors are the temperature and then the Standardized Precipitation–Evapotranspiration Index (SPEI) in July. While corn in the north Eastern regions is not significantly affected by weather variation, on the East coast, the weather-based mixed model is able to explain about 32% (corr = 0.57) of the yield variability, but in some particularly weather-sensitive states, such as Virginia, this number can reach 64% (corr = 0.80). Two applications are tested: yield estimation at the end of the year for monitoring purpose, and seasonal prediction. It is shown that some agro-climatic indices can significantly improve crop yield modeling when compared to simpler direct weather information (average correlation increase of 0.12 at the US scale).

Cereal Rye Cover Crop Suppresses Winter Annual Weeds

Cover crop (CC) adoption has increased in North America corn and soybean production areas. The objective was to evaluate the impact of cereal rye CC on winter annual weeds. Cereal rye reduced winter annual weed density and biomass by >90% at time of spring termination, showing potential as a component of an integrated weed management program.