Continuous Lip Region Research Articles

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

Qudsialemellus keralaensis gen. et sp. nov. (Nematoda: Dorylaimida: Belondiridae) from Western Ghats of India

Qudsialemellus keralaensis, a new genus and species of belondirid nematode is described and illustrated from the tropical rain forests of Western Ghats, India. The new genus is characterized by its rounded and continuous lip region; odontostyle attenuated with solid appearing tip; odontophore with distinct basal flanges; spiral muscular sheath around the expanded part of pharynx; spathulate cardia; female genital system mono-opisthodelpic; vulva transverse; tail long filiform, similar in both sexes; male with dorylaimoid spicules and two spaced ventromedian supplements. It comes close to the genera Qudsiella Jairajpuri, 1967, Paraqudsiella Siddiqi, 1981 and Durinemella Andrássy, 2009 belonging to the subfamily Swangeriinae Jairajpuri, 1964 but distinctly differs from all the three genera in the presence of a thick walled odontostyle with its tip almost solid appearing and odontophore with prominent basal flanges.

Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran.

Hemicycliophora ahvasiensis n. sp., recovered from the rhizospheric soil of date palm in Khuzestan province, southwest Iran, is described and illustrated based upon morphological, morphometric and molecular data. The new species is characterized by its sheath, closely fitting most of the body, cuticle with or without numerous irregular lines, sometimes appearing as blocks in distal body region. Lateral field without discrete longitudinal lines, but often with continuous broken striae or anastomoses. Continuous lip region with single annulus, slightly elevated labial disc, stylet with posteriorly sloping knobs. Vulva with or without slightly modified lips, spermatheca with sperm and tail conoid, symmetrically narrowing at distal region to form a narrow conical region. Morphologically, the new species looks similar to H. indica, H. labiata, H. siddiqii, H. tenuistriata and H. typica. The latter species appears more similar to the new species under light microscopy, but could be separated using the scanning electron microscopy and molecular data. The new species was also compared with H. epicharoides and H. dulli, two species with close phylogenetic affinities to it. The phylogenetic relationships of the new species were reconstructed and discussed using partial sequences of the D2-D3 expansion segments of large subunit, and internal transcribed spacer regions (LSU D2-D3 and ITS rDNA). Hemicycliophora conida, the second studied species, was recovered from north Iran and characterized by morphological and molecular data.

Paratylenchus jasmineae sp. n. (Nematoda: Paratylenchinae) from rhizosphere of Jasminum sambac in India

Summary A new species of pin nematode, Paratylenchus jasmineae sp. n., was isolated and described from the rhizosphere of jasmine in India. The new species can be diagnosed by having a relatively larger body length of 248-355 μm, stylet length of 24.6-28.5 μm, lateral field with four lateral lines, the presence of small post-vulval uterine sac and absence of advulval flaps in the females. Additional morphological characters included continuous lip region with small projected submedian lobes, large and oblong-shaped spermatheca, the presence of prevulval swelling, and arcuate conoid tail with finely rounded terminus. Molecular characterisation of the species was carried out based on internal transcribed spacer sequence (ITS rRNA) and D2-D3 expansion segment of 28S rRNA subunit. Phylogenetic analyses based on ITS and D2-D3 molecular markers resulted in clear separation of P. jasmineae sp. n. from other Paratylenchus species.

Taxonomy of the genus Doryllium Cobb, 1920 (Nematoda: Dorylaimida) with description of two new and a known species.

Two new and a known species of the genus Doryllium Cobb, 1920 are described and illustrated. Doryllium enigmatum n. sp. is characterized by a body length of 0.40-0.52 mm; continuous lip region; rounded lips; asymmetrical odontostyle, 5-6 µm long, and flanged odontophore 9-11 µm in length; pharynx with slender anterior part which expands into a slightly constricted pyriform basal bulb, occupying about 16-18% of total neck length; mono-opisthodelphic female genital system; 7-9 μm long anterior uterine sac; transverse vulva and rounded-hemispheroid tail. Doryllium asymmetricum n. sp. is characterized by its 0.52-0.63 mm long body; cap-like, slightly offset lip region; asymmetrical odontostyle, 6 µm in length and 9-11 µm long odontophore with weak flanges; pharynx with slender anterior part which expands gradually into pear-shaped basal bulb, occupying about 16.4-18.5% of total neck length; mono-opisthodelphic female genital system; anterior uterine sac 17-30 μm in length, filled with sperms; transverse vulva and rounded-hemispheroid tail. D. minor is redescribed based on specimens collected from several localities in India and Germany. The diagnosis of the genus Doryllium is emended and a valid list of species with their synonymies and a diagnostic compendium of all the known species is provided.

Description of a new species of the genus Anguillonema Fuchs, 1938 (Nematoda: Sphaerularioidea) with an identification key to the species.

Anguillonema iranicum n. sp. is described and illustrated as the second species of this genus from Iran, based on morphological, morphometric and molecular characteristics. It is identified by a short, thin body, a continuous lip region, six lines on the lateral field, a short, thin stylet, a posteriorly located pharyngo-intestinal junction to excretory pore, the presence of a post-vulval uterine sac, vulval position at 89% (87.4-89.9%) of body length, an elongate conoid tail with a rounded to pointed tip and not dorsally bent, and common functional males with short spicules and lacking a bursa. Morphological differences between the new species and the three known species of the genus, namely A. amolensis, A. crenati and A. poligraphi, are discussed. Molecular phylogenetic studies of the new species using partial 18S rDNA sequence revealed that it formed a sister clade with three species of Howardula, one species of Anguillonema and one unidentified isolate. In phylogenetic analyses using partial sequences of 28S rDNA D2-D3 segment, the new species formed a clade with two isolates of Parasitylenchus. A key to identification of Anguillonema species is also presented.

Two atypical new species of the genus Sectonema Thorne, 1930 (Nematoda, Dorylaimida, Aporcelaimidae) from Vietnam

Two new species of the genus Sectonema from natural habitats of northern Vietnam are studied. This paper includes their descriptions, measurements, line illustrations, and light microscope (LM) and scanning electron microscope (SEM) pictures. Sectonema tropicum sp. nov. is characterized by a 2.56–3.24 mm long body, 19–21 μm broad lip region, odontostyle 20–21 μm long at its ventral side, 730–834 μm long neck, pharyngeal expansion occupying 52–59% of total neck length, uterus a simple tube-like structure 150–242 μm long or 1.2–2.5 times the body diameter, pars refringens vaginae present, V = 48–52, short (31–40 μm, c = 70–91, c’ = 0.5–0.6) and rounded tail, 91–97 μm long spicules, and only one weakly developed ventromedian supplement. Sectonema vietnamense sp. nov. is characterized by its slender (a = 33–49) and 2.71–4.25 mm long body, 14–16 μm broad lip region, odontostyle 8–9 μm long at its ventral side, 716–918 μm long neck, pharyngeal expansion occupying 63–67% of total neck length, uterus simple and 209–242 μm long or 2.5–2.9 times the corresponding body diameter, pars refringens vaginae absent, V = 54, short (34–39 μm, c = 70–115, c’ = 0.6–0.8) and rounded tail, 59–75 μm long spicules, and three or four irregularly spaced ventromedian supplements bearing hiatus. Both species are also characterized by their nearly continuous lip region, an atypical feature in this genus. Molecular analysis of S. tropicum sp. nov. confirms that Sectonema is a natural (monophyletic) taxon, very close to Metaporcelaimus.

Rotylenchus castilloi n. sp. (Nematoda: Hoplolaimidae), a new species with long stylet from northern Iran.

Rotylenchus castilloi n. sp., a new bisexual species is described and illustrated based on morphological, morphometric and molecular data. The new species is characterised by having a hemispherical, continuous lip region with an irregular corncob-like appearance under SEM, very long stylet (62-68 µm), vulva located at 49.7-62.2% of body length from anterior end, with a protruding double epiptygma, a rounded to convex-conoid (rarely bi-lobed) tail with 8-12 annuli and specific sequences of D2-D3 segments of 28S and ITS1-rRNA genes. Differences between the new species and four other species of the genus (R. mesorobustus, R. cazorlaensis, R. magnus and R. jaeni) are discussed. Morphologically, the new species can be separated from these species mostly by its body length, lip region characters, stylet length and location of phasmid. Phylogenetic analyses using 721 bp partial sequences of D2-D3 expansion segments of the 28S and 590 bp ITS1-rRNA genes revealed the new species forming a clade with two isolates of R. eximius and two isolates of R. unisexus, two morphologically unrelated species.

Description of Ektaphelenchoides caspiensis n. sp. (Nematoda: Ektaphelenchinae) from Iran

Ektaphelenchoides caspiensis n. sp. is described and illustrated based on morphological, morphometric and molecular characters. The new species is characterised by its continuous lip region, obscure lateral field, females with body length of 499-572 μm, 9-10 μm long stylet, excretory pore posterior to base of metacorpus at 62-72 μm from anterior body end, short post-uterine sac ca 0.5 times corresponding body diam. or 4-9 μm long, and posterior body end (i.e., including ‘tail’) very long and filiform. Males are common and have 7-8 μm long spicules, five copulatory papillae and a long (109-140 μm) conoid tail with very long filiform terminus. Based on morphological and molecular characters, it comes close to five known species of the genus, namely: E. attenuata, E. fuchsi, E. kelardashtensis, E. musae and E. ruehmi. It differs from the closest species, E. kelardashtensis, by the shorter female stylet (9-10 vs 13-16 μm), more anterior vulva (V = 51.7-58.1 vs 61.5-68.0), more posterior excretory pore (62-72 vs 55-66 μm from anterior end), very long posterior body (i.e., including ‘tail’) in female, and male tail shape (conoid with very long filiform terminus vs conoid, sharply pointed). Comparisons with other close species of the genus are also discussed. Molecular analyses were performed using 732 bp of the partial ribosomal RNA large subunit gene (D2-D3 of LSU) using Bayesian inference (BI) and maximum likelihood (ML) methods and showed that the new species formed a clade with one species of the genus (E. fuchsi) and Devibursaphelenchus lini.

Description of Ektaphelenchoides fuchsi n. sp. (Nematoda: Ektaphelenchinae) from western Iran.

Ektaphelenchoides fuchsi n. sp., recovered from a soil sample around the rhizosphere of Cucurbita maxima in western Iran, is described and illustrated based on morphological and molecular characters. The new species is characterized by its body length of 529-712 µm, continuous lip region, lateral fields with three incisures, total stylet length of 14-18 µm with rounded basal knobs, excretory pore 70-84 µm and hemizonid 87-96 µm from the anterior end, post-uterine sac short, 6-9 µm long in female and tail conoid with long filiform terminus in male. Based on morphological and molecular characters, the new species is close to E. kelardashtensis, E. attenuata, and E. musae. It differs from the closest species E. kelardashtensis by its longer sylet (14-18 vs 13-16 µm) and stylet with basal knobs vs not, longer post uterine sac (6-9 vs 3-6 µm), more posterior position of excretory pore and hemizonid (70-84 vs 55-66 and 87-96 vs 67-78 µm, respectively), and longer spicules (12-13 vs 8-10 µm). Comparisons with other species of Ektaphelenchoides are also discussed. Molecular analyses were performed based on 631 bp of the partial ribosomal RNA large subunit gene (D2/D3 of LSU) and showed that E. fuchsi n. sp. is unique when compared with other species of the genus for which sequences of that region are available.

Morphological, molecular characterisation and phylogenetic position of Longidorus mindanaoensis n. sp. (Nematoda: Longidoridae) from a Philippine Avicennia mangrove habitat

Longidorus mindanaoensis n. sp. is described from samples associated with riverine mangroves in the Philippines and is the first Longidorus species collected from such a habitat. Its relationship within the genus is inferred from molecular and morphological data. Phylogenetic inferences were performed for D2-D3 and SSU rDNA using appropriate phylogenetic algorithms. The new species is characterised by a thickened basal layer of the body cuticle with prominent spiral fibres, a dome-shaped continuous lip region, an oval to elliptical fovea with pore-like opening, the guiding ring at 2.2-2.5 lip region diam. from the anterior end, very weakly developed odontophore, all three pharyngeal gland nuclei at about the mid-point of the basal bulb, vulva at 30-39%, tail convex-conoid to hemispherical, shorter than anal body diam., males with 19-24 ventromedian supplements, and four juvenile stages, all with the replacement odontostyle at a short distance from the functional one. On the basis of amphid shape and structure, shape of anterior body region and general body shape, L. mindanaoensis n. sp. comes close to L. caespiticola, L. eridanicus, L. helveticus, L. macrosoma, L. poessneckensis, L. orongorongensis, L. waikouaitii and L. belondiroides. D2-D3 analysis placed the new species as sister to L. pisi and the two combined are sister clade to a monophyletic group that includes (L. poessneckensis (L. caespiticola (L. helveticus, L. macrosoma))). However, on the basis of SSU phylogeny, L. mindanaoensis n. sp. is positioned within a clade that includes (Longidorus sp. (L. mindanaoensis n. sp. (L. poessneckensis (L. helveticus, L. macrosoma)))). The ‘close’ relationship of the new species with L. pisi in the D2-D3 tree is incongruent with the widely different morphology of the two species. The other species that are close to the new species in the cladogram are in agreement with the morphology.

Two new and two known species of the family Belondiridae Thorne, 1939 (Nematoda: Dorylaimida) from Singapore

Two new and two known species belonging to the dorylaim nematode family Belondiridae Thorne, 1939 are reported and described for the first time from Singapore. Axonchium singaporense sp. nov. is characterized by having body 1.1–1.3 mm long, continuous lip region, cephalic framework distinctly sclerotized, odontostyle 6 μm long, posteriorly directed vagina, anterior uterine sac 30–50 μm long and clavate tail. Dorylaimellus (D.) hulqus sp. nov. is characterized by having body 0.4–0.5 mm long; offset lip region; odontostyle 5 μm long; expanded part of pharynx about 59–73% of neck length; longitudinal vulva; amphidelphic gonad; prerectum about four to five times anal body width in length and hemispheroid tail. A redescription of Oxybelondira penangi Ahmad and Jairajpuri, 1979 is provided and Axonchium amplicolle Cobb, 1920 is recorded for the first time from Singapore.

Three new and a known species of Tylencholaimoidea (Nematoda: Dorylaimida) from Singapore

Three new and a known species of soil-inhabiting nematodes belonging to the superfamily Tylencholaimoidea Filipjev, 1934 are described and illustrated from Singapore. Tantunema enigmatum n. sp. is characterised by having 0.33–0.41 mm long body; angular, distinctly offset lip region; well developed circumoral sclerotization; odontostyle slender with aperture about one-fourth of its length; simple rod-like odontophore; anterior part of pharynx slender, weakly muscular, expanding abruptly into a cylindroid basal bulb, constriction present between two parts of pharynx; expanded portion divisible into a short conical, less muscular anterior part and a posterior muscular cylindrical part with thickened inner lining; lumen of the posterior one-third of expanded portion distinctly widened and thickened; mono-opisthodelphic female genital system and short hemispheroid tail. Dorella shamimi n. sp. is characterised by having 0.58–0.62 mm long body; continuous lip region with indistinct labial papillae; labial disc absent; 10–10.5 µm long odontostyle with a large pad-like muscular structure attached on ventral side of posterior half of its length extending to the anterior part of the odontophore; odontophore asymmetrical with round, transparent, knob-like thickening; pharynx with a short terminal oval bulb; mono-prodelphic female genital system with a short post-uterine sac; short conoid tail, with rounded terminus, and males with 18–18.5 µm long, simple arcuate spicules and a single ventromedian supplement. Tylencholaimus singaporensis n. sp. is characterized by having 0.35–0.47 mm long body; distinctly offset, cap-like lip region, 4.5–5.5 µm long, slender odontostyle, simple rod-like odontophore with small but distinct basal knobs, pharyngeal expansion abrupt, mono-prodelphic genital system with no post-uterine sac, and short hemispheroid tail with distinct terminal caudal pore. Tylencholaimus intermedius Peña-Santiago & Coomans, 1996 is reported for the first time from Singapore.

Paratimmus provulvatus gen. nov., sp. nov. (Dorylaimida: Mydonomidae) from natural forests in Arunachal Pradesh, India

A new genus of soil-inhabiting nematode belonging to the family Mydonomidae Thorne, 1964 is described and illustrated from natural forests of Arunachal Pradesh, India. Paratimmus provulvatus gen. nov., sp .nov. is characterized by having a continuous lip region; tiny, asymmetrical odontostyle; single distinctly sclerotized guiding ring; simple, rod-like odontophore; a thin sheath (not spiral) around basal pharyngeal bulb; elongate conoid cardia; mono-opisthodelphic female genital system; transverse vulva; long filiform tail in both sexes and males with dorylaimoid spicules and three to four spaced ventromedian supplements.

New and known species of Dorylaimoidea (Nematoda: Dorylaimida) from Singapore

AbstractA new genus and three new and nine known species of Dorylaimoidea are recorded for the first time from Singapore. Rafflesius singaporensis gen. n., sp. n. is characterised by having a continuous lip region with amalgamated lips; labial papillae not protruding above labial contour; slender, dorylaimoid odontostyle with aperture one third its length; abrupt pharyngeal expansion; DO and DN far posterior to beginning of expansion; both pair of subventrals in the posterior third of expanded part; monoopisthodelphic female genital system, and long filiform tail. Oriverutus nusi sp. n. is characterised by having 0.81-0.89 mm long, slender body; offset lip region with distinct lips and labial papillae; 19-20 μm long, attenuated odontostyle; amphidelphic female genital system and elongate conoid tail with slightly dorsally bent tip. Saevadorella microstyla sp. n. is characterised by having 0.33-0.37 mm long body; offset lip region; 10.5-11.5 μm long, attenuated odontostyle; rod-like odontophore; amphidelphic female genital system and short, conoid, ventrally arcuate tail. Saevadorella parva sp. n. is characterised by having 0.37-0.54 mm long body; distinctly offset lip region; 21.5-22.5 μm long attenuated odontostyle; amphidelphic genital system and short conoid, ventrally arcuate tail. Mesodorylaimus flagellatus, M. pusillus, Amphidorylaimus infecundus, Discolaimium clavatum, Labronema nepalense, Oriverutus sundarus, O. microdorus, O. parvus and O. asaccatus are recorded for the first time from Singapore.

Description of Dorylaimoides punctatus n. sp. and Paractinolaimus acutus n. sp. (Nematoda: Dorylaimida) from Korea

Soil samples collected from Taebak Changkunbong and Undal mountains of Kyungbuk Province, yielded two new species of the order Dorylaimida which are described and illustrated below. Dorylaimoides punctatus n. sp. (Nematoda: Dorylaimida) is 1.2–1.4 mm long; b = 5.9–6.9; c = 14.6–17.7; odontostyle 7.3–8.5 μm; spicules 33.5–36.5 μm; ventromedian supplements 5–6 and is characterized by having zig-zag lines on body cuticle, continuous lip region, elongate conoid tail and comes close to Dorylaimoides micoletzkyi (De Man, 1921) Thorne & Swanger, 1936 and Dorylaimoides leptus Husain & Khan, 1968. Paractinolaimus acutus n. sp. (Nematoda: Dorylaimida) is 2.1–2.4 mm long; b = 4.3–4.9; c = 10–12; odontostyle 25–27 μm and characterized by having continuous lip region, longitudinally oval vulva and long filiform tail with acute tip and comes close to Parctinolaimus aruprus Khan et al., 1994 and Parctinolaimus baldus Thorne, 1967.

Loofilaimus, a Remarkable New Genus of Dorylaimida From Iran

Loofilaimus, a remarkable new genus of dorylaim nematodes is described from Iran. It is characterized by a continuous lip region with amalgamated lips; sclerotized cheilostome forming a bowl-shaped cavity, odontostyle short and wide, oesophagus conspicuously muscular along its entire length, amphidelphic gonads and short hemispheroid tails in both sexes. A new Family Loofilaimidae is proposed under Superfamily Tylencholaimoidea to accommodate this genus which has a curious mixture of characters of different dorylaim groups.

Two new species of Xiphinema (Nematoda: Dorylaimida) from Colombia

Two new species of Xiphinema are described from Colombia. X. colombiense n.sp. is characterized by a continuous lip region, a median vulva with both genital tracts fully developed and without Z-differentiation, a total stylet length of 197–233 μm and a short, rounded tail bearing two pairs of pores and with refractive lines leading through the cuticle to a terminal depression in the protoplasm; it is differentiated from X. clavatum Heyns, 1965, X. guirani Luc & Williams, 1978, X. pyrenaicum Dalmasso, 1969, X. silvaticum Luc & Williams, 1978 and X. yapoense Luc, 1958. X. riocaquetae n.sp. is distinguished from X. macrostylum Esser, 1966. ac]19810707

Two New Species of Longidoridae (Dorylaimida) From Saudi Arabia

Two new species of Longidoridae are described from poorly growing date palms in Saudi Arabia. Longidorus orientalis n. sp., found in Dirab and Riyadh, (and also in soil around roots of grapevine in several localities in Iraq) is characterized by round, continuous lip region, bilobed amphids and hemispherical female tail, body length of 4-6 mm and odontostyle length of 96-113 μm. L. taniwha apud About-Eid, 1970 from Egypt is possibly identical with it. Xiphinema phoenicis n. sp. closely resembles X. diversicaudatum (Micoletzky, 1927), but is distinctly more slender (a being 83-124 in females, 92-126 in males; in diversicaudatum 67-84 in females, 66-92 in males), the vulva is more posterior (45-51 vs 38-46), the odontophore is shorter relative to the odontostyle, and the females possess a well developed, more compact Z-organ. X. phoenicis was found only at Riyadh, together with numerous specimens of Longidorus africanus Merny, 1966, and a few L. siddiqii Aboul-Eid, 1970 and Xiphinema italiae Meyl, 1953.

Three New Tylenchs (Nematoda) From Australia

Tylenchorhynchus tobari n. sp., monosexual, L = 0.61-0.77 mm, V = 51-56, stylet = 17-19 μm, is distinguished by its four-lobed lip region with thin four-lobed disc, narrow body annules with longitudinal striae on neck, cuticular markings in mid ventral line behind vulva, about 50 annules on tail, non-annulated terminus. Tylenchorhynchus velatus n. sp., bisexual, L = 0.66-0.80 mm, V = 51-57, stylet = 22-25 μm, is distinguished by its six-lobed lip region with thin oval disc, vulval sheath about 10 μm long, tail with about 25 annules, annulated terminus. Morulaimus simplex n. sp., bisexual, L = 1.15-1.61 mm, V = 51-59, stylet = 62-74 μm, is distinguished by its continuous lip region less elaborately divided than in other known species, inconspicuous labial framework, prominent sclerotisation behind basal plate, tail with 35-45 annules, terminus annulated.